CN114574464B - High-fidelity DNA polymerase mutant and application thereof - Google Patents
High-fidelity DNA polymerase mutant and application thereof Download PDFInfo
- Publication number
- CN114574464B CN114574464B CN202210478070.2A CN202210478070A CN114574464B CN 114574464 B CN114574464 B CN 114574464B CN 202210478070 A CN202210478070 A CN 202210478070A CN 114574464 B CN114574464 B CN 114574464B
- Authority
- CN
- China
- Prior art keywords
- glu
- lys
- ile
- leu
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a high-fidelity DNA polymerase mutant and application thereof, a gene, a recombinant plasmid and a genetic engineering bacterium, and relates to the technical field of biology. The high-fidelity DNA polymerase mutant provided by the invention mutates Gly at 149 to Ala and Gly at 574 to Ala in wild high-fidelity DNA polymerization. The high-fidelity DNA polymerase mutant has the amplification efficiency as high as 10s/kb, breaks through the limit of the high-fidelity amplification efficiency, and has good amplification capability on a large-fragment DNA template (40 kb).
Description
Technical Field
The invention relates to the technical field of biology, in particular to a high-fidelity DNA polymerase mutant and application thereof, a gene, a recombinant plasmid and a genetic engineering bacterium.
Background
Since the beginning of its discovery, DNA polymerases have gained wide attention in the biomedical field and are therefore also widely used in experimental studies in molecular biology, such as DNA sequencing, mutation, nucleic acid amplification, etc. As early as a novel Taq DNA polymerase derived from Thermus aquaticus YT-1, which has 5'-3' DNA exonuclease activity and 5'-3' DNA polymerase activity, was widely used in PCR applications, and a strain producing the enzyme was grown in hot springs at about 75 ℃ and thus resistant to high temperature denaturation. Later related studies isolated a variety of DNA polymerases from other species, but since they did not have 3'-5' exonuclease proofreading activity, they were prone to incorporate wrong bases during amplification, leading to the inability to faithfully amplify templates until the discovery of highly guaranteed DNA polymerases, and such enzymes were characterized by 3'-5' exonuclease proofreading activity that could recognize bases erroneously incorporated into extended strands and cleave them, and by DNA polymerase activity that could react with template strands with bases that catalyze template complementarity and continue the extension amplification, thereby ensuring high identity between newly amplified strands and templates, and making it possible to amplify templates with high fidelity.
The high-fidelity DNA polymerase consists of a polymerization center and an enzyme digestion center, wherein the polymerization center is responsible for DNA polymerization; and the enzyme digestion center is responsible for exerting the 3'→ 5' exonuclease function of the PCR product, and excises the incorporated unpaired bases to ensure the template dependence of the PCR product. The DNA polymerization reaction is closed by the mismatching base which can not be corrected or is difficult to be corrected in time, and the fidelity of the mature final product of the DNA polymerization reaction is also ensured. Whereas a mismatched primer containing phosphorothioate modifications that are resistant to exonuclease digestion cannot be corrected in time for its mismatched bases by 3'→ 5' exonuclease, resulting in premature termination of the DNA polymerization reaction. In order to further realize the wide application of high-fidelity DNA polymerase, the amplification efficiency and the amplification length of the DNA polymerase need to be further optimized.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The first object of the present invention is to provide a high-fidelity DNA polymerase mutant to solve at least one of the above problems.
The second purpose of the invention is to provide the application of the high-fidelity DNA polymerase mutant in preparing nucleic acid amplification products.
The third object of the present invention is to provide a nucleic acid amplification product.
The fourth object of the present invention is to provide a gene encoding the high fidelity DNA polymerase mutant as described above.
The fifth object of the present invention is to provide a recombinant plasmid.
The sixth purpose of the invention is to provide a genetically engineered bacterium.
In a first aspect, the invention provides a high-fidelity DNA polymerase mutant, wherein the amino acid sequence of the high-fidelity DNA polymerase mutant is shown as SEQ ID NO. 1.
As a further technical scheme, the nucleotide sequence of the high-fidelity DNA polymerase mutant is shown in SEQ ID NO. 2.
In a second aspect, the invention provides an application of a high-fidelity DNA polymerase mutant in preparation of a nucleic acid amplification product.
In a third aspect, the present invention provides a nucleic acid amplification product comprising the high fidelity DNA polymerase mutant described above.
In a fourth aspect, the present invention provides a gene encoding the high fidelity DNA polymerase mutant described above.
As a further technical scheme, the gene has a nucleotide sequence shown in SEQ ID NO. 2.
In a fifth aspect, the present invention provides a recombinant plasmid comprising a vector and the above gene.
As a further embodiment, the vector comprises the pET-24a (+) plasmid.
In a sixth aspect, the invention provides a genetically engineered bacterium containing the recombinant plasmid.
As a further technical scheme, the genetic engineering bacteria comprise escherichia coli.
Compared with the prior art, the invention has the following beneficial effects:
the high-fidelity DNA polymerase mutant provided by the invention mutates the 149 th Gly of wild high-fidelity DNA polymerization into Ala, and the 574 th Gly into Ala. The high-fidelity DNA polymerase mutant has the amplification efficiency as high as 10s/kb, breaks through the limit of the high-fidelity amplification efficiency, and has good amplification capability on a large-fragment DNA template (40 kb).
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the prior art descriptions will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is a diagram showing the conformational analysis of wild-type high fidelity DNA polymerase;
FIG. 2 shows the results of electrophoresis of the nucleic acids in example 1;
FIG. 3 shows the results of the electrophoresis of the nucleic acids in example 2.
Detailed Description
Embodiments of the present invention will be described in detail below with reference to embodiments and examples, but it will be understood by those skilled in the art that the following embodiments and examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. Those who do not specify the conditions are performed according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
In a first aspect, the present invention provides a high fidelity DNA polymerase mutant, wherein the amino acid sequence of the high fidelity DNA polymerase mutant is shown in SEQ ID No. 1:
MILDVDYITEEGKPVIRLFKKENGKFKIEHDRTFRPYIYALLRDDSKIEEVKKITGERHGKIVRIVDVEKVEKKFLGKPITVWKLYLEHPQDVPTIREKVREHPAVVDIFEYDIPFAKRYLIDKGLIPMEGEEELKILAFDIETLYHEAEEFGKGPIIMISYADENEAKVITWKNIDLPYVEVVSSEREMIKRFLRIIREKDPDIIVTYNGDSFDFPYLAKRAEKLGIKLTIGRDGSEPKMQRIGDMTAVEVKGRIHFDLYHVITRTINLPTYTLEAVYEAIFGKPKEKVYADEIAKAWESGENLERVAKYSMEDAKATYELGKEFLPMEIQLSRLVGQPLWDVSRSSTGNLVEWFLLRKAYERNEVAPNKPSEEEYQRRLRESYTGGFVKEPEKGLWENIVYLDFRALYPSIIITHNVSPDTLNLEGCKNYDIAPQVGHKFCKDIPGFIPSLLGHLLEERQKIKTKMKETQDPIEKILLDYRQKAIKLLANSFYGYYGYAKARWYCKECAESVTAWGRKYIELVWKELEEKFGFKVLYIDTDGLYATIPGGESEEIKKKALEFVKYINSKLPALLELEYEGFYKRGFFVTKKRYAVIDEEGKVITRGLEIVRRDWSEIAKETQARVLETILKHGDVEEAVRIVKEVIQKLANYEIPPEKLAIYEQITRPLHEYKAIGPHVAVAKKLAAKGVKIKPGMVIGYIVLRGDGPISNRAILAEEYDPKKHKYDAEYYIENQVLPAVLRILEGFGYRKEDLRYQKTRQVGLTSWLNIKKS（SEQ ID NO.1）。
according to the invention, firstly, rational design is carried out based on the original amino acid sequence of wild type high-fidelity DNA polymerase (SWISS MODEL analysis and molecular docking AutoDock 4, molecular dynamics simulation (Amber 18)) to analyze the conformational difference, as shown in figure 1, GLY149 site and GLY574 site of wild type high-fidelity DNA polymerization are mutated into Ala, and researches show that the high-fidelity DNA polymerase mutant breaks through the limit of high-fidelity amplification efficiency and has good amplification capability for a large-fragment DNA template (40 kb). Wherein the amino acid sequence of the wild type high-fidelity DNA polymerase is shown as SEQ ID NO. 3:
MILDVDYITEEGKPVIRLFKKENGKFKIEHDRTFRPYIYALLRDDSKIEEVKKITGERHGKIVRIVDVEKVEKKFLGKPITVWKLYLEHPQDVPTIREKVREHPAVVDIFEYDIPFAKRYLIDKGLIPMEGEEELKILAFDIETLYHEGEEFGKGPIIMISYADENEAKVITWKNIDLPYVEVVSSEREMIKRFLRIIREKDPDIIVTYNGDSFDFPYLAKRAEKLGIKLTIGRDGSEPKMQRIGDMTAVEVKGRIHFDLYHVITRTINLPTYTLEAVYEAIFGKPKEKVYADEIAKAWESGENLERVAKYSMEDAKATYELGKEFLPMEIQLSRLVGQPLWDVSRSSTGNLVEWFLLRKAYERNEVAPNKPSEEEYQRRLRESYTGGFVKEPEKGLWENIVYLDFRALYPSIIITHNVSPDTLNLEGCKNYDIAPQVGHKFCKDIPGFIPSLLGHLLEERQKIKTKMKETQDPIEKILLDYRQKAIKLLANSFYGYYGYAKARWYCKECAESVTAWGRKYIELVWKELEEKFGFKVLYIDTDGLYATIPGGESEEIKKKALEFVKYINSKLPGLLELEYEGFYKRGFFVTKKRYAVIDEEGKVITRGLEIVRRDWSEIAKETQARVLETILKHGDVEEAVRIVKEVIQKLANYEIPPEKLAIYEQITRPLHEYKAIGPHVAVAKKLAAKGVKIKPGMVIGYIVLRGDGPISNRAILAEEYDPKKHKYDAEYYIENQVLPAVLRILEGFGYRKEDLRYQKTRQVGLTSWLNIKKS（SEQ ID NO.3）。
in some preferred embodiments, the nucleotide sequence of the high fidelity DNA polymerase mutant is as shown in SEQ ID NO. 2:
ATGATTTTAGATGTTGACTATATCACTGAAGAGGGTAAACCTGTCATACGTTTGTTTAAGAAAGAAAATGGCAAGTTCAAAATTGAGCATGATCGCACCTTTCGACCCTACATCTATGCTCTTCTCCGGGACGATTCTAAGATAGAAGAGGTAAAAAAGATTACAGGAGAAAGACACGGGAAAATCGTGAGGATAGTTGACGTCGAGAAGGTAGAAAAAAAGTTCCTAGGTAAACCAATTACGGTGTGGAAGCTGTACTTAGAGCATCCGCAAGATGTTCCTACTATCCGTGAAAAAGTCCGCGAGCACCCCGCCGTAGTGGACATATTTGAATATGATATTCCATTCGCAAAGCGATACTTGATCGACAAAGGCCTTATACCGATGGAGGGAGAAGAGGAACTCAAGATTCTAGCGTTTGATATCGAGACCCTGTATCATGAAGCGGAGGAATTCGGTAAAGGCCCTATAATTATGATCTCCTACGCTGACGAGAACGAAGCCAAGGTTATAACATGGAAAAATATTGATTTACCCTATGTCGAGGTAGTGTCATCGGAACGGGAGATGATCAAGAGATTTTTGAGGATAATTCGTGAAAAAGACCCAGATATCATAGTTACGTACAACGGAGACAGTTTCGATTTTCCGTATCTTGCAAAGCGCGCGGAGAAACTCGGGATTAAGCTAACTATCGGTCGAGACGGCAGCGAACCTAAAATGCAGCGGATAGGAGATATGACCGCTGTCGAGGTAAAGGGGAGAATTCACTTCGACCTGTACCATGTGATCACAAGGACGATAAATTTACCCACTTATACCTTGGAAGCCGTTTACGAGGCAATTTTTGGTAAACCAAAGGAAAAAGTCTATGCGGATGAGATCGCTAAGGCCTGGGAATCTGGCGAGAACCTTGAACGTGTAGCAAAATACTCCATGGAGGACGCGAAGGCTACATATGAACTCGGAAAAGAGTTCCTACCGATGGAAATACAACTGTCACGCTTAGTGGGGCAGCCTTTGTGGGATGTTTCGCGAAGTAGCACGGGTAATCTTGTCGAGTGGTTTCTCCTACGGAAGGCCTACGAAAGAAACGAGGTAGCACCCAATAAACCATCTGAAGAGGAATATCAAAGGCGTCTGCGCGAGTCCTACACTGGCGGATTCGTGAAGGAACCGGAGAAAGGGTTATGGGAAAACATTGTTTATTTGGACTTTCGAGCGCTTTACCCTTCAATCATAATTACCCACAATGTCTCGCCCGATACACTCAACCTAGAGGGTTGTAAGAATTATGACATCGCTCCACAGGTAGGCCATAAATTCTGCAAGGATATACCGGGATTTATTCCTAGTCTGTTAGGGCACTTGCTTGAAGAGCGGCAAAAAATCAAGACGAAAATGAAGGAAACTCAGGACCCCATAGAGAAAATTCTCCTAGATTACAGACAAAAGGCCATCAAACTGTTAGCAAACAGCTTCTATGGTTACTATGGCTACGCGAAGGCTAGGTGGTATTGTAAAGAATGCGCCGAGTCTGTGACCGCATGGGGACGTAAGTACATAGAATTGGTTTGGAAAGAGCTTGAAGAGAAGTTTGGGTTCAAAGTCCTCTATATTGACACAGATGGTCTATACGCGACGATCCCAGGCGGAGAATCCGAGGAAATAAAGAAAAAGGCTCTGGAGTTTGTAAAATATATTAATTCAAAGTTACCGGCGTTGCTTGAACTCGAGTACGAAGGTTTCTATAAACGCGGCTTTTTCGTGACTAAGAAACGATACGCCGTTATCGACGAGGAAGGAAAGGTCATAACCCGGGGGCTAGAGATTGTAAGAAGGGATTGGTCGGAAATCGCAAAAGAGACACAGGCGCGTGTGCTGGAAACGATATTAAAGCATGGTGACGTTGAGGAAGCTGTCCGCATTGTAAAAGAGGTGATCCAAAAGTTGGCCAACTATGAAATACCTCCCGAGAAACTTGCAATTTACGAACAGATCACTCGACCACTCCACGAGTATAAGGCGATAGGCCCGCATGTTGCTGTCGCCAAAAAGCTAGCAGCGAAAGGAGTAAAGATTAAACCTGGGATGGTGATCGGTTACATAGTTCTGCGGGGCGATGGACCCATTAGTAATAGAGCTATCTTAGCCGAAGAGTATGACCCAAAGAAACACAAGTACGATGCAGAATATTACATAGAGAACCAAGTCTTGCCGGCGGTACTTAGGATTCTCGAAGGGTTTGGTTATCGTAAAGAGGACCTACGCTACCAGAAGACCCGACAAGTGGGCCTGACAAGCTGGTTAAATATCAAAAAGTCTTAA（SEQ ID NO.2）。
in a second aspect, the invention provides an application of a high-fidelity DNA polymerase mutant in preparation of a nucleic acid amplification product.
The high-fidelity DNA polymerase mutant provided by the invention has the amplification efficiency as high as 10s/kb, breaks through the limit of the high-fidelity amplification efficiency, has good amplification capability on a large-fragment DNA template (40 kb), and can be used for preparing a nucleic acid amplification product.
In a third aspect, the present invention provides a nucleic acid amplification product comprising the high fidelity DNA polymerase mutant described above. The nucleic acid amplification product has high amplification efficiency and can be used for amplifying a large fragment DNA template (40 kb).
In a fourth aspect, the present invention provides a gene encoding the high fidelity DNA polymerase mutant described above. For example, the gene may have a nucleotide sequence shown in SEQ ID NO. 2.
In a fifth aspect, the present invention provides a recombinant plasmid comprising a vector and the above gene. The vector includes but is not limited to pET-24a (+) plasmid.
In a sixth aspect, the invention provides a genetically engineered bacterium containing the recombinant plasmid. Wherein the genetically engineered bacteria comprise Escherichia coli.
The present invention is further illustrated by the following specific examples and comparative examples, but it should be understood that these examples are for illustrative purposes only and are not to be construed as limiting the invention in any way.
The primers used in the following examples are shown in the following table:
example 1
According to the invention, the original amino acid sequence of wild-type high-fidelity DNA polymerase (proofast DNA polymerase) is modeled by SWISS-MODEL, short-fragment dNTP is used as a substrate to perform molecular docking simulation, and random mutation is performed on GLY149 locus and GLY574 locus by selection through early-stage experiment screening and testing. The specific implementation is as follows:
1) The specific procedure for mutating proofast DNA polymerase is as follows: the proofast DNA polymerase is constructed and expressed by taking pET-24a (+) as a vector, in order to quickly and accurately construct and obtain a recombinant vector and take escherichia coli BL21 as a final host, the invention adopts Golden gate assembly technology to design a PCR primer.
2) The specific implementation is as follows: inputting the original amino acid sequence of proofast DNA polymerase into Codon Optimizer software and simultaneously inputting the Escherichia coli genome sequence information, and deriving the nucleic acid sequence SEQ ID NO.3 corresponding to the proofast DNA polymerase.
3) The pMD18-T-proofast plasmid is synthesized according to the above information.
4) pMD18-T-proofast plasmid is used as a template, random mutation primers P1/P2 and P3/P4 are designed by using the pMD18-T-proofast plasmid as the template to carry out random mutation on a GLY149 site and a GLY574 site, and a PCR reaction system is set as follows:
reaction procedure: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 20s, circulation at 30, and extension at 72 ℃ for 5min.
5) The PCR product obtained above was subjected to agarose Gel electrophoresis, and a mutant fragment was obtained by Gel recovery (ATGPure ™ Gel DNA Extraction Mini Kit).
6) The linearized recombinant vector DNA fragment of proofast DNA polymerase obtained above was subjected to a self-circularization recombination reaction according to the following system.
Remarking: 5 XUFO Buffer is one of the components of the kit C101 independently developed by the company team.
7) Mu.l of the recombinant ligation product obtained above was transformed into 100. Mu.l of DH5a competent cells, placed on ice for 30 min under cold shock, then hot shocked at 42 ℃ for 45 s, placed on ice for 5min under cold shock, added with 890. Mu.l of LB medium and incubated at 37 ℃ for 1h on a shaker at 200 rpm. The cells were collected by centrifugation at 4000rpm for 1min, 100. Mu.l of the supernatant was resuspended and plated on Amp-resistant plates to select positive clones. Colony PCR verification is carried out through M13F primers and M13R primers, and positive clones are picked for transfer sequencing.
8) The proofast DNA polymerase recombinant plasmid with successful mutation by sequencing verification is cut into pET-24a (+) plasmid and a plurality of pMD18-T-proofast respectively according to the following enzyme digestion system Mut Obtaining linear carrier pET-24a (+) and proofast from mutant plasmid Mut A mutated DNA fragment.
9) The resulting enzyme-cleaved product was electrophoresed on agarose nucleic acid, and the correct band was excised and recovered with the ATGPure ™ PCR product purification kit of Biotech Ltd, nanjing, to obtain a DNA fragment.
10 Pro ofast obtained as described above) is added Mut The mutant gene fragment and the pET-24a vector DNA fragment were ligated overnight using a kit (M101) from Nanjing giant Biotech Ltd.
11 Mu.l of the recombinant ligation product obtained above was transformed into 100. Mu.l of BL21 (rosseta) competent cells, placed on ice for 30 min with cold shock, then hot shock at 42 ℃ for 45 s, then placed on ice for 5min with cold shock, added with 890. Mu.l of LB medium and incubated at 37 ℃ for 1h with a shaker at 200 rpm. The cells were collected by centrifugation at 4000rpm for 1min, 100. Mu.l of the supernatant was resuspended and plated on Kan-resistant plates to select positive clones. Colony PCR verification is carried out through a T7 primer and a T7terminator primer, and positive clones are picked for transfer sequencing.
12 A total of 9 mutants were obtained by sequencing analysis of random mutations at the positions GLY149 and GLY574, as shown in the table below.
The nine mutant strains were transferred to 3 ml LB overnight, the next day to 500ml LB until OD600=0.6-0.8, and induced with 0.5mM IPTG at 37 ℃ for 16 hours. And (3) after fermentation induction expression is finished, centrifugally collecting the thalli, resuspending the thalli by using 20 mM Tris-HCl and 500 mM NaCl, and purifying by using Ni column affinity chromatography to obtain the mutant protein.
13 The 9 mutated proofast obtained in the above were configured into a PCR reaction system as follows to perform the in-machine experiment.
Three parallel groups with different extension time are respectively arranged, namely three levels of 10s/1kb, 30s/1kb and 60s/1 kb.
Reaction procedure: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 15s, annealing at 58 deg.C for 15s, extension at 72 deg.C for 20s/60s/120s, circulation for 30s, and extension at 72 deg.C for 5min. The results of nucleic acid electrophoresis of the PCR reaction products in the different rate tests are shown in FIG. 2.
Example 2 amplification of 40kb lambda DNA by Gly149Ala/Gly574Ala mutant and wild type proofast
The Gly149Ala/Gly574Ala mutant and the wild type proofast are configured into a PCR reaction system according to the following system to carry out the computer experiment.
Three parallel groups with different extension time are respectively arranged, namely three levels of 10s/1kb, 30s/1kb and 60s/1 kb.
Reaction procedures are as follows: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 15s, annealing at 58 deg.C for 15s, extension at 72 deg.C for 10s, circulation at 30, and extension at 72 deg.C for 5min. The PCR reaction products under different rate tests were subjected to nucleic acid electrophoresis.
The amplification results at an extension time of 10s/kb are shown in FIG. 3, and from the comparative analysis of the results in FIG. 3, the amplification effect of the Gly149Ala/Gly574Ala mutant at an extension time of 10s is superior to that of the wild type, and the primer specificity is better than that of the wild type.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Nanjing Judge Biotech Co., ltd
<120> high-fidelity DNA polymerase mutant and application thereof, product, gene, recombinant plasmid and gene engineering bacterium
<160> 15
<170> PatentIn version 3.5
<210> 1
<211> 775
<212> PRT
<213> Artificial sequence
<400> 1
Met Ile Leu Asp Val Asp Tyr Ile Thr Glu Glu Gly Lys Pro Val Ile
1 5 10 15
Arg Leu Phe Lys Lys Glu Asn Gly Lys Phe Lys Ile Glu His Asp Arg
20 25 30
Thr Phe Arg Pro Tyr Ile Tyr Ala Leu Leu Arg Asp Asp Ser Lys Ile
35 40 45
Glu Glu Val Lys Lys Ile Thr Gly Glu Arg His Gly Lys Ile Val Arg
50 55 60
Ile Val Asp Val Glu Lys Val Glu Lys Lys Phe Leu Gly Lys Pro Ile
65 70 75 80
Thr Val Trp Lys Leu Tyr Leu Glu His Pro Gln Asp Val Pro Thr Ile
85 90 95
Arg Glu Lys Val Arg Glu His Pro Ala Val Val Asp Ile Phe Glu Tyr
100 105 110
Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro
115 120 125
Met Glu Gly Glu Glu Glu Leu Lys Ile Leu Ala Phe Asp Ile Glu Thr
130 135 140
Leu Tyr His Glu Ala Glu Glu Phe Gly Lys Gly Pro Ile Ile Met Ile
145 150 155 160
Ser Tyr Ala Asp Glu Asn Glu Ala Lys Val Ile Thr Trp Lys Asn Ile
165 170 175
Asp Leu Pro Tyr Val Glu Val Val Ser Ser Glu Arg Glu Met Ile Lys
180 185 190
Arg Phe Leu Arg Ile Ile Arg Glu Lys Asp Pro Asp Ile Ile Val Thr
195 200 205
Tyr Asn Gly Asp Ser Phe Asp Phe Pro Tyr Leu Ala Lys Arg Ala Glu
210 215 220
Lys Leu Gly Ile Lys Leu Thr Ile Gly Arg Asp Gly Ser Glu Pro Lys
225 230 235 240
Met Gln Arg Ile Gly Asp Met Thr Ala Val Glu Val Lys Gly Arg Ile
245 250 255
His Phe Asp Leu Tyr His Val Ile Thr Arg Thr Ile Asn Leu Pro Thr
260 265 270
Tyr Thr Leu Glu Ala Val Tyr Glu Ala Ile Phe Gly Lys Pro Lys Glu
275 280 285
Lys Val Tyr Ala Asp Glu Ile Ala Lys Ala Trp Glu Ser Gly Glu Asn
290 295 300
Leu Glu Arg Val Ala Lys Tyr Ser Met Glu Asp Ala Lys Ala Thr Tyr
305 310 315 320
Glu Leu Gly Lys Glu Phe Leu Pro Met Glu Ile Gln Leu Ser Arg Leu
325 330 335
Val Gly Gln Pro Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu
340 345 350
Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Val Ala
355 360 365
Pro Asn Lys Pro Ser Glu Glu Glu Tyr Gln Arg Arg Leu Arg Glu Ser
370 375 380
Tyr Thr Gly Gly Phe Val Lys Glu Pro Glu Lys Gly Leu Trp Glu Asn
385 390 395 400
Ile Val Tyr Leu Asp Phe Arg Ala Leu Tyr Pro Ser Ile Ile Ile Thr
405 410 415
His Asn Val Ser Pro Asp Thr Leu Asn Leu Glu Gly Cys Lys Asn Tyr
420 425 430
Asp Ile Ala Pro Gln Val Gly His Lys Phe Cys Lys Asp Ile Pro Gly
435 440 445
Phe Ile Pro Ser Leu Leu Gly His Leu Leu Glu Glu Arg Gln Lys Ile
450 455 460
Lys Thr Lys Met Lys Glu Thr Gln Asp Pro Ile Glu Lys Ile Leu Leu
465 470 475 480
Asp Tyr Arg Gln Lys Ala Ile Lys Leu Leu Ala Asn Ser Phe Tyr Gly
485 490 495
Tyr Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu
500 505 510
Ser Val Thr Ala Trp Gly Arg Lys Tyr Ile Glu Leu Val Trp Lys Glu
515 520 525
Leu Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ile Asp Thr Asp Gly
530 535 540
Leu Tyr Ala Thr Ile Pro Gly Gly Glu Ser Glu Glu Ile Lys Lys Lys
545 550 555 560
Ala Leu Glu Phe Val Lys Tyr Ile Asn Ser Lys Leu Pro Ala Leu Leu
565 570 575
Glu Leu Glu Tyr Glu Gly Phe Tyr Lys Arg Gly Phe Phe Val Thr Lys
580 585 590
Lys Arg Tyr Ala Val Ile Asp Glu Glu Gly Lys Val Ile Thr Arg Gly
595 600 605
Leu Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln
610 615 620
Ala Arg Val Leu Glu Thr Ile Leu Lys His Gly Asp Val Glu Glu Ala
625 630 635 640
Val Arg Ile Val Lys Glu Val Ile Gln Lys Leu Ala Asn Tyr Glu Ile
645 650 655
Pro Pro Glu Lys Leu Ala Ile Tyr Glu Gln Ile Thr Arg Pro Leu His
660 665 670
Glu Tyr Lys Ala Ile Gly Pro His Val Ala Val Ala Lys Lys Leu Ala
675 680 685
Ala Lys Gly Val Lys Ile Lys Pro Gly Met Val Ile Gly Tyr Ile Val
690 695 700
Leu Arg Gly Asp Gly Pro Ile Ser Asn Arg Ala Ile Leu Ala Glu Glu
705 710 715 720
Tyr Asp Pro Lys Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn
725 730 735
Gln Val Leu Pro Ala Val Leu Arg Ile Leu Glu Gly Phe Gly Tyr Arg
740 745 750
Lys Glu Asp Leu Arg Tyr Gln Lys Thr Arg Gln Val Gly Leu Thr Ser
755 760 765
Trp Leu Asn Ile Lys Lys Ser
770 775
<210> 2
<211> 2328
<212> DNA
<213> Artificial sequence
<400> 2
atgattttag atgttgacta tatcactgaa gagggtaaac ctgtcatacg tttgtttaag 60
aaagaaaatg gcaagttcaa aattgagcat gatcgcacct ttcgacccta catctatgct 120
cttctccggg acgattctaa gatagaagag gtaaaaaaga ttacaggaga aagacacggg 180
aaaatcgtga ggatagttga cgtcgagaag gtagaaaaaa agttcctagg taaaccaatt 240
acggtgtgga agctgtactt agagcatccg caagatgttc ctactatccg tgaaaaagtc 300
cgcgagcacc ccgccgtagt ggacatattt gaatatgata ttccattcgc aaagcgatac 360
ttgatcgaca aaggccttat accgatggag ggagaagagg aactcaagat tctagcgttt 420
gatatcgaga ccctgtatca tgaagcggag gaattcggta aaggccctat aattatgatc 480
tcctacgctg acgagaacga agccaaggtt ataacatgga aaaatattga tttaccctat 540
gtcgaggtag tgtcatcgga acgggagatg atcaagagat ttttgaggat aattcgtgaa 600
aaagacccag atatcatagt tacgtacaac ggagacagtt tcgattttcc gtatcttgca 660
aagcgcgcgg agaaactcgg gattaagcta actatcggtc gagacggcag cgaacctaaa 720
atgcagcgga taggagatat gaccgctgtc gaggtaaagg ggagaattca cttcgacctg 780
taccatgtga tcacaaggac gataaattta cccacttata ccttggaagc cgtttacgag 840
gcaatttttg gtaaaccaaa ggaaaaagtc tatgcggatg agatcgctaa ggcctgggaa 900
tctggcgaga accttgaacg tgtagcaaaa tactccatgg aggacgcgaa ggctacatat 960
gaactcggaa aagagttcct accgatggaa atacaactgt cacgcttagt ggggcagcct 1020
ttgtgggatg tttcgcgaag tagcacgggt aatcttgtcg agtggtttct cctacggaag 1080
gcctacgaaa gaaacgaggt agcacccaat aaaccatctg aagaggaata tcaaaggcgt 1140
ctgcgcgagt cctacactgg cggattcgtg aaggaaccgg agaaagggtt atgggaaaac 1200
attgtttatt tggactttcg agcgctttac ccttcaatca taattaccca caatgtctcg 1260
cccgatacac tcaacctaga gggttgtaag aattatgaca tcgctccaca ggtaggccat 1320
aaattctgca aggatatacc gggatttatt cctagtctgt tagggcactt gcttgaagag 1380
cggcaaaaaa tcaagacgaa aatgaaggaa actcaggacc ccatagagaa aattctccta 1440
gattacagac aaaaggccat caaactgtta gcaaacagct tctatggtta ctatggctac 1500
gcgaaggcta ggtggtattg taaagaatgc gccgagtctg tgaccgcatg gggacgtaag 1560
tacatagaat tggtttggaa agagcttgaa gagaagtttg ggttcaaagt cctctatatt 1620
gacacagatg gtctatacgc gacgatccca ggcggagaat ccgaggaaat aaagaaaaag 1680
gctctggagt ttgtaaaata tattaattca aagttaccgg cgttgcttga actcgagtac 1740
gaaggtttct ataaacgcgg ctttttcgtg actaagaaac gatacgccgt tatcgacgag 1800
gaaggaaagg tcataacccg ggggctagag attgtaagaa gggattggtc ggaaatcgca 1860
aaagagacac aggcgcgtgt gctggaaacg atattaaagc atggtgacgt tgaggaagct 1920
gtccgcattg taaaagaggt gatccaaaag ttggccaact atgaaatacc tcccgagaaa 1980
cttgcaattt acgaacagat cactcgacca ctccacgagt ataaggcgat aggcccgcat 2040
gttgctgtcg ccaaaaagct agcagcgaaa ggagtaaaga ttaaacctgg gatggtgatc 2100
ggttacatag ttctgcgggg cgatggaccc attagtaata gagctatctt agccgaagag 2160
tatgacccaa agaaacacaa gtacgatgca gaatattaca tagagaacca agtcttgccg 2220
gcggtactta ggattctcga agggtttggt tatcgtaaag aggacctacg ctaccagaag 2280
acccgacaag tgggcctgac aagctggtta aatatcaaaa agtcttaa 2328
<210> 3
<211> 775
<212> PRT
<213> Artificial sequence
<400> 3
Met Ile Leu Asp Val Asp Tyr Ile Thr Glu Glu Gly Lys Pro Val Ile
1 5 10 15
Arg Leu Phe Lys Lys Glu Asn Gly Lys Phe Lys Ile Glu His Asp Arg
20 25 30
Thr Phe Arg Pro Tyr Ile Tyr Ala Leu Leu Arg Asp Asp Ser Lys Ile
35 40 45
Glu Glu Val Lys Lys Ile Thr Gly Glu Arg His Gly Lys Ile Val Arg
50 55 60
Ile Val Asp Val Glu Lys Val Glu Lys Lys Phe Leu Gly Lys Pro Ile
65 70 75 80
Thr Val Trp Lys Leu Tyr Leu Glu His Pro Gln Asp Val Pro Thr Ile
85 90 95
Arg Glu Lys Val Arg Glu His Pro Ala Val Val Asp Ile Phe Glu Tyr
100 105 110
Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro
115 120 125
Met Glu Gly Glu Glu Glu Leu Lys Ile Leu Ala Phe Asp Ile Glu Thr
130 135 140
Leu Tyr His Glu Gly Glu Glu Phe Gly Lys Gly Pro Ile Ile Met Ile
145 150 155 160
Ser Tyr Ala Asp Glu Asn Glu Ala Lys Val Ile Thr Trp Lys Asn Ile
165 170 175
Asp Leu Pro Tyr Val Glu Val Val Ser Ser Glu Arg Glu Met Ile Lys
180 185 190
Arg Phe Leu Arg Ile Ile Arg Glu Lys Asp Pro Asp Ile Ile Val Thr
195 200 205
Tyr Asn Gly Asp Ser Phe Asp Phe Pro Tyr Leu Ala Lys Arg Ala Glu
210 215 220
Lys Leu Gly Ile Lys Leu Thr Ile Gly Arg Asp Gly Ser Glu Pro Lys
225 230 235 240
Met Gln Arg Ile Gly Asp Met Thr Ala Val Glu Val Lys Gly Arg Ile
245 250 255
His Phe Asp Leu Tyr His Val Ile Thr Arg Thr Ile Asn Leu Pro Thr
260 265 270
Tyr Thr Leu Glu Ala Val Tyr Glu Ala Ile Phe Gly Lys Pro Lys Glu
275 280 285
Lys Val Tyr Ala Asp Glu Ile Ala Lys Ala Trp Glu Ser Gly Glu Asn
290 295 300
Leu Glu Arg Val Ala Lys Tyr Ser Met Glu Asp Ala Lys Ala Thr Tyr
305 310 315 320
Glu Leu Gly Lys Glu Phe Leu Pro Met Glu Ile Gln Leu Ser Arg Leu
325 330 335
Val Gly Gln Pro Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu
340 345 350
Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Val Ala
355 360 365
Pro Asn Lys Pro Ser Glu Glu Glu Tyr Gln Arg Arg Leu Arg Glu Ser
370 375 380
Tyr Thr Gly Gly Phe Val Lys Glu Pro Glu Lys Gly Leu Trp Glu Asn
385 390 395 400
Ile Val Tyr Leu Asp Phe Arg Ala Leu Tyr Pro Ser Ile Ile Ile Thr
405 410 415
His Asn Val Ser Pro Asp Thr Leu Asn Leu Glu Gly Cys Lys Asn Tyr
420 425 430
Asp Ile Ala Pro Gln Val Gly His Lys Phe Cys Lys Asp Ile Pro Gly
435 440 445
Phe Ile Pro Ser Leu Leu Gly His Leu Leu Glu Glu Arg Gln Lys Ile
450 455 460
Lys Thr Lys Met Lys Glu Thr Gln Asp Pro Ile Glu Lys Ile Leu Leu
465 470 475 480
Asp Tyr Arg Gln Lys Ala Ile Lys Leu Leu Ala Asn Ser Phe Tyr Gly
485 490 495
Tyr Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu
500 505 510
Ser Val Thr Ala Trp Gly Arg Lys Tyr Ile Glu Leu Val Trp Lys Glu
515 520 525
Leu Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ile Asp Thr Asp Gly
530 535 540
Leu Tyr Ala Thr Ile Pro Gly Gly Glu Ser Glu Glu Ile Lys Lys Lys
545 550 555 560
Ala Leu Glu Phe Val Lys Tyr Ile Asn Ser Lys Leu Pro Gly Leu Leu
565 570 575
Glu Leu Glu Tyr Glu Gly Phe Tyr Lys Arg Gly Phe Phe Val Thr Lys
580 585 590
Lys Arg Tyr Ala Val Ile Asp Glu Glu Gly Lys Val Ile Thr Arg Gly
595 600 605
Leu Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln
610 615 620
Ala Arg Val Leu Glu Thr Ile Leu Lys His Gly Asp Val Glu Glu Ala
625 630 635 640
Val Arg Ile Val Lys Glu Val Ile Gln Lys Leu Ala Asn Tyr Glu Ile
645 650 655
Pro Pro Glu Lys Leu Ala Ile Tyr Glu Gln Ile Thr Arg Pro Leu His
660 665 670
Glu Tyr Lys Ala Ile Gly Pro His Val Ala Val Ala Lys Lys Leu Ala
675 680 685
Ala Lys Gly Val Lys Ile Lys Pro Gly Met Val Ile Gly Tyr Ile Val
690 695 700
Leu Arg Gly Asp Gly Pro Ile Ser Asn Arg Ala Ile Leu Ala Glu Glu
705 710 715 720
Tyr Asp Pro Lys Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn
725 730 735
Gln Val Leu Pro Ala Val Leu Arg Ile Leu Glu Gly Phe Gly Tyr Arg
740 745 750
Lys Glu Asp Leu Arg Tyr Gln Lys Thr Arg Gln Val Gly Leu Thr Ser
755 760 765
Trp Leu Asn Ile Lys Lys Ser
770 775
<210> 4
<211> 27
<212> DNA
<213> Artificial sequence
<400> 4
cctgtatcat gaagcggagg aattcgg 27
<210> 5
<211> 27
<212> DNA
<213> Artificial sequence
<400> 5
ccgaattcct ccgcttcatg atacagg 27
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence
<400> 6
caaagttacc ggcgttgctt gaac 24
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence
<400> 7
gttcaagcaa cgccggtaac tttg 24
<210> 8
<211> 18
<212> DNA
<213> Artificial sequence
<400> 8
caggaaacag ctatgacc 18
<210> 9
<211> 18
<212> DNA
<213> Artificial sequence
<400> 9
tgtaaaacga cggccagt 18
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence
<400> 10
taatacgact cactataggg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence
<400> 11
acatccactt tgcctttctc 20
<210> 12
<211> 22
<212> DNA
<213> Artificial sequence
<400> 12
gcatctactc gtcgcgaacc gc 22
<210> 13
<211> 21
<212> DNA
<213> Artificial sequence
<400> 13
caatgattct tatcagaaac c 21
<210> 14
<211> 22
<212> DNA
<213> Artificial sequence
<400> 14
ccataattgc atctactcgt cg 22
<210> 15
<211> 22
<212> DNA
<213> Artificial sequence
<400> 15
cagctgcgtc gtttgacatc ag 22
Claims (10)
1. The high-fidelity DNA polymerase mutant is characterized in that the amino acid sequence of the high-fidelity DNA polymerase mutant is shown as SEQ ID NO. 1.
2. The high-fidelity DNA polymerase mutant of claim 1, wherein the nucleotide sequence of the high-fidelity DNA polymerase mutant is shown in SEQ ID No. 2.
3. Use of the high fidelity DNA polymerase mutant of claim 1 in the preparation of a product for nucleic acid amplification.
4. A product for nucleic acid amplification comprising the high-fidelity DNA polymerase mutant of claim 1.
5. A gene encoding the high fidelity DNA polymerase mutant of claim 1.
6. The gene of claim 5, wherein the gene is a nucleotide sequence shown in SEQ ID No. 2.
7. A recombinant plasmid comprising a vector and the gene of claim 5 or 6.
8. The recombinant plasmid of claim 7, wherein the vector is a pET-24a (+) plasmid.
9. A genetically engineered bacterium comprising the recombinant plasmid of claim 7 or 8.
10. The genetically engineered bacterium of claim 9, wherein the genetically engineered bacterium is escherichia coli.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210478070.2A CN114574464B (en) | 2022-05-05 | 2022-05-05 | High-fidelity DNA polymerase mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210478070.2A CN114574464B (en) | 2022-05-05 | 2022-05-05 | High-fidelity DNA polymerase mutant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114574464A CN114574464A (en) | 2022-06-03 |
| CN114574464B true CN114574464B (en) | 2022-10-14 |
Family
ID=81777950
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210478070.2A Active CN114574464B (en) | 2022-05-05 | 2022-05-05 | High-fidelity DNA polymerase mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114574464B (en) |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ATE491032T1 (en) * | 2005-01-06 | 2010-12-15 | Life Technologies Corp | POLYPEPTIDES WITH NUCLEIC ACID BINDING ACTIVITY |
| CN109022387B (en) * | 2018-08-29 | 2020-12-22 | 华南理工大学 | Mutant Pfu DNA polymerase and preparation method and application thereof |
| CN111518873B (en) * | 2020-05-11 | 2024-07-09 | 上海羿鸣生物科技有限公司 | Optimized method for amplifying target nucleic acid and application |
| CN113604450B (en) * | 2021-08-18 | 2023-08-18 | 华南理工大学 | KOD DNA polymerase mutant and preparation method and application thereof |
| CN114262697B (en) * | 2021-12-30 | 2022-12-13 | 南京巨匠生物科技有限公司 | Bsu DNA polymerase and Bsu DNA polymerase mutant as well as gene, plasmid and genetic engineering bacteria thereof |
| CN114369586B (en) * | 2022-03-21 | 2022-06-07 | 南京巨匠生物科技有限公司 | Taq DNA polymerase mutant and application thereof, product, gene, plasmid and genetic engineering bacteria |
-
2022
- 2022-05-05 CN CN202210478070.2A patent/CN114574464B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114574464A (en) | 2022-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1918370B1 (en) | Mutant pcna | |
| EP1817413B1 (en) | Oligonucleotide ladder assembly and system for generating molecular diversity | |
| JP2020505004A (en) | Novel polypeptide and method for producing IMP using the same | |
| WO1999006538A1 (en) | Thermococcus barosii dna polymerase mutants | |
| JPH10503381A (en) | Purified Thermococcus barossi DNA polymerase | |
| CN114561372B (en) | Bst DNA polymerase mutant and application thereof, product, gene, recombinant plasmid and genetic engineering bacterium | |
| CN114934030A (en) | High-specificity Taq DNA polymerase variant and application thereof in genome editing and/or gene mutation detection | |
| CN108949719B (en) | Coding error-prone DNA polymerase and preparation method thereof | |
| JP7014256B2 (en) | Nucleic acid amplification reagent | |
| JP2017178804A (en) | Fusion protein | |
| CN109868271B (en) | Method for de novo synthesis of DNA shuffling libraries using on-chip synthetic oligonucleotide libraries | |
| CN114574464B (en) | High-fidelity DNA polymerase mutant and application thereof | |
| KR100777230B1 (en) | Mutant dna polymerases and their genes from themococcus | |
| CN114990080B (en) | Lysine mutant thermostable nucleic acid ligase | |
| US20050053989A1 (en) | Libraries of recombinant chimeric proteins | |
| CN114250206B (en) | Methyltransferase mutant, recombinant vector, recombinant engineering bacterium and application thereof | |
| CN114480345B (en) | MazF mutant, recombinant vector, recombinant engineering bacterium and application thereof | |
| WO2023082266A1 (en) | Chimeric dna polymerase and use thereof | |
| CN116410952B (en) | Mutant Taq DNA polymerase, coding gene, recombinant expression vector, recombinant bacterium and application thereof | |
| JP5935382B2 (en) | RrhJ1II nuclease and its gene | |
| KR100969477B1 (en) | Thermococcus guaymasensis DNA polymerase and Polymerase Chain Reaction method using it | |
| JP3880173B2 (en) | DNA synthase | |
| CN116655752A (en) | Chimeric polymerase and application thereof | |
| CN117821412A (en) | dCE-KOD DNA polymerase and preparation method and application thereof | |
| US20070202508A1 (en) | Novel thermophilic proteins and the nucleic acids encoding them |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |