CN114574464A - High-fidelity DNA polymerase mutant and application thereof, product, gene, recombinant plasmid and genetic engineering bacterium - Google Patents

High-fidelity DNA polymerase mutant and application thereof, product, gene, recombinant plasmid and genetic engineering bacterium Download PDF

Info

Publication number
CN114574464A
CN114574464A CN202210478070.2A CN202210478070A CN114574464A CN 114574464 A CN114574464 A CN 114574464A CN 202210478070 A CN202210478070 A CN 202210478070A CN 114574464 A CN114574464 A CN 114574464A
Authority
CN
China
Prior art keywords
glu
lys
ile
leu
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210478070.2A
Other languages
Chinese (zh)
Other versions
CN114574464B (en
Inventor
刁含文
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Jujiang Biotechnology Co ltd
Original Assignee
Nanjing Jujiang Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Jujiang Biotechnology Co ltd filed Critical Nanjing Jujiang Biotechnology Co ltd
Priority to CN202210478070.2A priority Critical patent/CN114574464B/en
Publication of CN114574464A publication Critical patent/CN114574464A/en
Application granted granted Critical
Publication of CN114574464B publication Critical patent/CN114574464B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention provides a high-fidelity DNA polymerase mutant and application thereof, and products, genes, recombinant plasmids and genetic engineering bacteria, relating to the technical field of biology. The high-fidelity DNA polymerase mutant provided by the invention mutates Gly at 149 to Ala and Gly at 574 to Ala in wild high-fidelity DNA polymerization. The high-fidelity DNA polymerase mutant has the amplification efficiency as high as 10s/kb, breaks through the limit of the high-fidelity amplification efficiency, and has good amplification capability on a large-fragment DNA template (40 kb).

Description

High-fidelity DNA polymerase mutant and application thereof, product, gene, recombinant plasmid and genetic engineering bacterium
Technical Field
The invention relates to the technical field of biology, in particular to a high-fidelity DNA polymerase mutant and application thereof, as well as a product, a gene, a recombinant plasmid and a genetic engineering bacterium.
Background
Since the beginning of its discovery, DNA polymerases have gained wide attention in the biomedical field and are therefore widely used in experimental studies in molecular biology, such as DNA sequencing, mutation, nucleic acid amplification, etc. The Taq DNA polymerase originating from Thermus aquaticus YT-1, which was originally developed and widely used in PCR technology, has 5'-3' DNA exonuclease activity and 5'-3' DNA polymerase activity, and a strain producing the same is grown in hot springs at about 75 ℃ and thus is resistant to high-temperature denaturation. Later related studies isolated a variety of DNA polymerases from other species, but since they did not have 3'-5' exonuclease proofreading activity and were prone to incorporate wrong bases during amplification, they could not faithfully amplify templates until they were discovered, they were characterized by their 3'-5' exonuclease proofreading activity of recognizing the bases erroneously incorporated into the extended strand and cleaving it, and their DNA polymerase activity of reacting bases capable of catalyzing template complementarity with the template strand and continuing the extension amplification, thereby ensuring high identity between the newly amplified strand and the template and making it possible to amplify templates with high fidelity.
The high-fidelity DNA polymerase consists of a polymerization center and an enzyme digestion center, wherein the polymerization center is responsible for DNA polymerization; and the enzyme digestion center is responsible for playing the 3'→ 5' exonuclease function of the PCR product, and excises the incorporated unpaired bases to ensure the template dependence of the PCR product. The DNA polymerization reaction is closed by the mismatching base which can not be corrected or is difficult to be corrected in time, and the fidelity of the mature final product of the DNA polymerization reaction is also ensured. Whereas a mismatched primer containing phosphorothioate modifications that are resistant to exonuclease digestion cannot be corrected in time for its mismatched bases by 3'→ 5' exonuclease, resulting in premature termination of the DNA polymerization reaction. Further optimization of amplification efficiency and amplification length is needed to further realize the wide application of high fidelity DNA polymerase.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The first object of the present invention is to provide a high-fidelity DNA polymerase mutant to solve at least one of the above problems.
The second purpose of the invention is to provide the application of the high-fidelity DNA polymerase mutant in the preparation of nucleic acid amplification products.
The third object of the present invention is to provide a nucleic acid amplification product.
The fourth object of the present invention is to provide a gene encoding the high fidelity DNA polymerase mutant.
The fifth object of the present invention is to provide a recombinant plasmid.
The sixth purpose of the invention is to provide a genetically engineered bacterium.
In a first aspect, the invention provides a high-fidelity DNA polymerase mutant, wherein the amino acid sequence of the high-fidelity DNA polymerase mutant is shown as SEQ ID NO. 1.
As a further technical scheme, the nucleotide sequence of the high-fidelity DNA polymerase mutant is shown in SEQ ID NO. 2.
In a second aspect, the invention provides an application of a high-fidelity DNA polymerase mutant in preparation of a nucleic acid amplification product.
In a third aspect, the present invention provides a nucleic acid amplification product comprising the high fidelity DNA polymerase mutant described above.
In a fourth aspect, the present invention provides a gene encoding the high fidelity DNA polymerase mutant described above.
As a further technical scheme, the gene has a nucleotide sequence shown in SEQ ID NO. 2.
In a fifth aspect, the present invention provides a recombinant plasmid comprising a vector and the above gene.
As a further embodiment, the vector comprises the pET-24a (+) plasmid.
In a sixth aspect, the invention provides a genetically engineered bacterium containing the recombinant plasmid.
As a further technical scheme, the genetic engineering bacteria comprise escherichia coli.
Compared with the prior art, the invention has the following beneficial effects:
the high-fidelity DNA polymerase mutant provided by the invention mutates Gly at 149 to Ala and Gly at 574 to Ala in wild high-fidelity DNA polymerization. The high-fidelity DNA polymerase mutant has the amplification efficiency as high as 10s/kb, breaks through the limit of the high-fidelity amplification efficiency, and has good amplification capability on a large-fragment DNA template (40 kb).
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is a conformational analysis of wild-type high fidelity DNA polymerase;
FIG. 2 shows the results of the nucleic acid electrophoresis in example 1;
FIG. 3 shows the results of the nucleic acid electrophoresis in example 2.
Detailed Description
Embodiments of the present invention will be described in detail below with reference to embodiments and examples, but those skilled in the art will understand that the following embodiments and examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention. Those who do not specify the conditions are performed according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
In a first aspect, the present invention provides a high fidelity DNA polymerase mutant, wherein the amino acid sequence of the high fidelity DNA polymerase mutant is shown in SEQ ID No. 1:
MILDVDYITEEGKPVIRLFKKENGKFKIEHDRTFRPYIYALLRDDSKIEEVKKITGERHGKIVRIVDVEKVEKKFLGKPITVWKLYLEHPQDVPTIREKVREHPAVVDIFEYDIPFAKRYLIDKGLIPMEGEEELKILAFDIETLYHEAEEFGKGPIIMISYADENEAKVITWKNIDLPYVEVVSSEREMIKRFLRIIREKDPDIIVTYNGDSFDFPYLAKRAEKLGIKLTIGRDGSEPKMQRIGDMTAVEVKGRIHFDLYHVITRTINLPTYTLEAVYEAIFGKPKEKVYADEIAKAWESGENLERVAKYSMEDAKATYELGKEFLPMEIQLSRLVGQPLWDVSRSSTGNLVEWFLLRKAYERNEVAPNKPSEEEYQRRLRESYTGGFVKEPEKGLWENIVYLDFRALYPSIIITHNVSPDTLNLEGCKNYDIAPQVGHKFCKDIPGFIPSLLGHLLEERQKIKTKMKETQDPIEKILLDYRQKAIKLLANSFYGYYGYAKARWYCKECAESVTAWGRKYIELVWKELEEKFGFKVLYIDTDGLYATIPGGESEEIKKKALEFVKYINSKLPALLELEYEGFYKRGFFVTKKRYAVIDEEGKVITRGLEIVRRDWSEIAKETQARVLETILKHGDVEEAVRIVKEVIQKLANYEIPPEKLAIYEQITRPLHEYKAIGPHVAVAKKLAAKGVKIKPGMVIGYIVLRGDGPISNRAILAEEYDPKKHKYDAEYYIENQVLPAVLRILEGFGYRKEDLRYQKTRQVGLTSWLNIKKS（SEQ ID NO.1）。
according to the invention, firstly, rational design is carried out based on the original amino acid sequence of wild type high-fidelity DNA polymerase (SWISS MODEL analysis and molecular docking AutoDock 4, molecular dynamics simulation (Amber 18)) to analyze the conformational difference, as shown in figure 1, GLY149 site and GLY574 site of wild type high-fidelity DNA polymerization are mutated into Ala, and researches show that the high-fidelity DNA polymerase mutant breaks through the limit of high-fidelity amplification efficiency and has good amplification capability for a large-fragment DNA template (40 kb). Wherein the amino acid sequence of the wild type high-fidelity DNA polymerase is shown in SEQ ID NO. 3:
MILDVDYITEEGKPVIRLFKKENGKFKIEHDRTFRPYIYALLRDDSKIEEVKKITGERHGKIVRIVDVEKVEKKFLGKPITVWKLYLEHPQDVPTIREKVREHPAVVDIFEYDIPFAKRYLIDKGLIPMEGEEELKILAFDIETLYHEGEEFGKGPIIMISYADENEAKVITWKNIDLPYVEVVSSEREMIKRFLRIIREKDPDIIVTYNGDSFDFPYLAKRAEKLGIKLTIGRDGSEPKMQRIGDMTAVEVKGRIHFDLYHVITRTINLPTYTLEAVYEAIFGKPKEKVYADEIAKAWESGENLERVAKYSMEDAKATYELGKEFLPMEIQLSRLVGQPLWDVSRSSTGNLVEWFLLRKAYERNEVAPNKPSEEEYQRRLRESYTGGFVKEPEKGLWENIVYLDFRALYPSIIITHNVSPDTLNLEGCKNYDIAPQVGHKFCKDIPGFIPSLLGHLLEERQKIKTKMKETQDPIEKILLDYRQKAIKLLANSFYGYYGYAKARWYCKECAESVTAWGRKYIELVWKELEEKFGFKVLYIDTDGLYATIPGGESEEIKKKALEFVKYINSKLPGLLELEYEGFYKRGFFVTKKRYAVIDEEGKVITRGLEIVRRDWSEIAKETQARVLETILKHGDVEEAVRIVKEVIQKLANYEIPPEKLAIYEQITRPLHEYKAIGPHVAVAKKLAAKGVKIKPGMVIGYIVLRGDGPISNRAILAEEYDPKKHKYDAEYYIENQVLPAVLRILEGFGYRKEDLRYQKTRQVGLTSWLNIKKS（SEQ ID NO.3）。
in some preferred embodiments, the nucleotide sequence of the high fidelity DNA polymerase mutant is as shown in SEQ ID NO. 2:
ATGATTTTAGATGTTGACTATATCACTGAAGAGGGTAAACCTGTCATACGTTTGTTTAAGAAAGAAAATGGCAAGTTCAAAATTGAGCATGATCGCACCTTTCGACCCTACATCTATGCTCTTCTCCGGGACGATTCTAAGATAGAAGAGGTAAAAAAGATTACAGGAGAAAGACACGGGAAAATCGTGAGGATAGTTGACGTCGAGAAGGTAGAAAAAAAGTTCCTAGGTAAACCAATTACGGTGTGGAAGCTGTACTTAGAGCATCCGCAAGATGTTCCTACTATCCGTGAAAAAGTCCGCGAGCACCCCGCCGTAGTGGACATATTTGAATATGATATTCCATTCGCAAAGCGATACTTGATCGACAAAGGCCTTATACCGATGGAGGGAGAAGAGGAACTCAAGATTCTAGCGTTTGATATCGAGACCCTGTATCATGAAGCGGAGGAATTCGGTAAAGGCCCTATAATTATGATCTCCTACGCTGACGAGAACGAAGCCAAGGTTATAACATGGAAAAATATTGATTTACCCTATGTCGAGGTAGTGTCATCGGAACGGGAGATGATCAAGAGATTTTTGAGGATAATTCGTGAAAAAGACCCAGATATCATAGTTACGTACAACGGAGACAGTTTCGATTTTCCGTATCTTGCAAAGCGCGCGGAGAAACTCGGGATTAAGCTAACTATCGGTCGAGACGGCAGCGAACCTAAAATGCAGCGGATAGGAGATATGACCGCTGTCGAGGTAAAGGGGAGAATTCACTTCGACCTGTACCATGTGATCACAAGGACGATAAATTTACCCACTTATACCTTGGAAGCCGTTTACGAGGCAATTTTTGGTAAACCAAAGGAAAAAGTCTATGCGGATGAGATCGCTAAGGCCTGGGAATCTGGCGAGAACCTTGAACGTGTAGCAAAATACTCCATGGAGGACGCGAAGGCTACATATGAACTCGGAAAAGAGTTCCTACCGATGGAAATACAACTGTCACGCTTAGTGGGGCAGCCTTTGTGGGATGTTTCGCGAAGTAGCACGGGTAATCTTGTCGAGTGGTTTCTCCTACGGAAGGCCTACGAAAGAAACGAGGTAGCACCCAATAAACCATCTGAAGAGGAATATCAAAGGCGTCTGCGCGAGTCCTACACTGGCGGATTCGTGAAGGAACCGGAGAAAGGGTTATGGGAAAACATTGTTTATTTGGACTTTCGAGCGCTTTACCCTTCAATCATAATTACCCACAATGTCTCGCCCGATACACTCAACCTAGAGGGTTGTAAGAATTATGACATCGCTCCACAGGTAGGCCATAAATTCTGCAAGGATATACCGGGATTTATTCCTAGTCTGTTAGGGCACTTGCTTGAAGAGCGGCAAAAAATCAAGACGAAAATGAAGGAAACTCAGGACCCCATAGAGAAAATTCTCCTAGATTACAGACAAAAGGCCATCAAACTGTTAGCAAACAGCTTCTATGGTTACTATGGCTACGCGAAGGCTAGGTGGTATTGTAAAGAATGCGCCGAGTCTGTGACCGCATGGGGACGTAAGTACATAGAATTGGTTTGGAAAGAGCTTGAAGAGAAGTTTGGGTTCAAAGTCCTCTATATTGACACAGATGGTCTATACGCGACGATCCCAGGCGGAGAATCCGAGGAAATAAAGAAAAAGGCTCTGGAGTTTGTAAAATATATTAATTCAAAGTTACCGGCGTTGCTTGAACTCGAGTACGAAGGTTTCTATAAACGCGGCTTTTTCGTGACTAAGAAACGATACGCCGTTATCGACGAGGAAGGAAAGGTCATAACCCGGGGGCTAGAGATTGTAAGAAGGGATTGGTCGGAAATCGCAAAAGAGACACAGGCGCGTGTGCTGGAAACGATATTAAAGCATGGTGACGTTGAGGAAGCTGTCCGCATTGTAAAAGAGGTGATCCAAAAGTTGGCCAACTATGAAATACCTCCCGAGAAACTTGCAATTTACGAACAGATCACTCGACCACTCCACGAGTATAAGGCGATAGGCCCGCATGTTGCTGTCGCCAAAAAGCTAGCAGCGAAAGGAGTAAAGATTAAACCTGGGATGGTGATCGGTTACATAGTTCTGCGGGGCGATGGACCCATTAGTAATAGAGCTATCTTAGCCGAAGAGTATGACCCAAAGAAACACAAGTACGATGCAGAATATTACATAGAGAACCAAGTCTTGCCGGCGGTACTTAGGATTCTCGAAGGGTTTGGTTATCGTAAAGAGGACCTACGCTACCAGAAGACCCGACAAGTGGGCCTGACAAGCTGGTTAAATATCAAAAAGTCTTAA（SEQ ID NO.2）。
in a second aspect, the invention provides an application of a high-fidelity DNA polymerase mutant in preparation of a nucleic acid amplification product.
The high-fidelity DNA polymerase mutant provided by the invention has the amplification efficiency as high as 10s/kb, breaks through the limit of the high-fidelity amplification efficiency, has good amplification capability on a large-fragment DNA template (40 kb), and can be used for preparing a nucleic acid amplification product.
In a third aspect, the present invention provides a nucleic acid amplification product comprising the high fidelity DNA polymerase mutant described above. The nucleic acid amplification product has high amplification efficiency and can be used for amplifying a large fragment DNA template (40 kb).
In a fourth aspect, the present invention provides a gene encoding the high fidelity DNA polymerase mutant described above. For example, the gene may have a nucleotide sequence shown in SEQ ID NO. 2.
In a fifth aspect, the present invention provides a recombinant plasmid comprising a vector and the above gene. The vector includes but is not limited to pET-24a (+) plasmid.
In a sixth aspect, the invention provides a genetically engineered bacterium containing the recombinant plasmid. Wherein the genetically engineered bacteria comprise Escherichia coli.
The invention is further illustrated by the following specific examples and comparative examples, but it should be understood that these examples are for purposes of illustration only and are not to be construed as limiting the invention in any way.
The primers used in the following examples are shown in the following table:
Figure P_220429162350132_132710001
example 1
According to the invention, the original amino acid sequence of wild-type high-fidelity DNA polymerase (proofast DNA polymerase) is modeled by SWISS-MODEL, short-segment dNTP is used as a substrate to perform molecular docking simulation, and random mutation is performed on a GLY149 site and a GLY574 site by early-stage experimental screening and testing. The specific implementation is as follows:
1) the specific procedure for mutating proofast DNA polymerase is as follows: the proofast DNA polymerase is constructed and expressed by taking pET-24a (+) as a vector, in order to quickly and accurately construct and obtain a recombinant vector, and taking escherichia coli BL21 as a final host, the invention adopts Golden gate assembly technology to design a PCR primer.
2) The specific implementation is as follows: inputting the original amino acid sequence of proofast DNA polymerase into Codon Optimizer software and simultaneously inputting the Escherichia coli genome sequence information, and deriving the nucleic acid sequence SEQ ID NO.3 corresponding to the proofast DNA polymerase.
3) The pMD18-T-proofast plasmid was synthesized based on the above information.
4) The pMD18-T-proofast plasmid is used as a template, random mutation primers P1/P2 and P3/P4 are designed by using the pMD18-T-proofast plasmid as the template to carry out random mutation on a GLY149 site and a GLY574 site, and a PCR reaction system is set as follows:
Figure P_220429162350226_226970001
reaction procedure: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 20s, circulation at 30, and extension at 72 ℃ for 5 min.
5) The PCR product obtained above was subjected to agarose Gel electrophoresis, and a mutant fragment was obtained by Gel recovery (ATGPure ™ Gel DNA Extraction Mini Kit).
6) The linearized recombinant vector DNA fragment of proofast DNA polymerase obtained above was subjected to a self-circularization recombination reaction according to the following system.
Figure P_220429162350273_273851001
Remarking: 5 XUFO Buffer is one of the components of the kit C101 independently developed by the company team.
7) Mu.l of the recombinant ligation product obtained above was transformed into 100. mu.l of DH5a competent cells, placed on ice for 30 min under cold shock, then subjected to heat shock at 42 ℃ for 45 s, placed on ice for 5min under cold shock, added with 890. mu.l of LB medium and incubated at 37 ℃ for 1h on a shaker at 200 rpm. The cells were collected by centrifugation at 4000rpm for 1min, 100. mu.l of the supernatant was resuspended and plated on Amp-resistant plates to select positive clones. Positive clones were picked for transfer sequencing by colony PCR validation with M13F primer and M13R primer.
8) The proofast DNA polymerase recombinant plasmid with successful mutation by sequencing verification is cut into pET-24a (+) plasmid and a plurality of pMD18-T-proofast according to the following enzyme digestion systemMutObtaining linear carrier pET-24a (+) and proofast from mutant plasmidMutA mutated DNA fragment.
Figure P_220429162350305_305098001
9) The resulting enzyme-cleaved product was electrophoresed on agarose nucleic acid, and the correct band was excised and recovered with the ATGPure ™ PCR product purification kit of Biotech Ltd, Nanjing, to obtain a DNA fragment.
10) Proofast obtained as described aboveMutThe mutant gene fragment and the pET-24a vector DNA fragment were ligated overnight using a kit (M101) from Nanjing giant Biotech Ltd.
11) 10. mu.l of the recombinant ligation product obtained above was transformed into 100. mu.l of BL21(rosseta) competent cells, subjected to cold shock on ice for 30 min, then subjected to heat shock at 42 ℃ for 45 s, further subjected to cold shock on ice for 5min, added with 890. mu.l of LB medium, and incubated at 37 ℃ for 1h on a shaker at 200 rpm. The cells were collected by centrifugation at 4000rpm for 1min, 100. mu.l of the supernatant was resuspended and plated on Kan-resistant plates to select positive clones. Colony PCR verification is carried out by a T7 primer and a T7terminator primer, and positive clones are picked for transfer sequencing.
12) A total of 9 mutants were obtained by sequencing analysis of random mutations at the GLY149 and GLY574 sites, as shown in the following table.
Figure P_220429162350353_353450001
The nine mutant strains were transferred to 3 ml LB overnight, the next day to 500ml LB medium until OD600=0.6-0.8, and induced with 0.5mM IPTG at 37 ℃ for 16 hours. And after fermentation induction expression is finished, centrifugally collecting the thalli, re-suspending the thalli by using 20 mM Tris-HCl and 500 mM NaCl, and purifying by using Ni column affinity chromatography to obtain the mutant protein.
13) The 9 mutated proofasts obtained above were configured into a PCR reaction system as follows for the in-machine experiment.
Figure P_220429162350384_384229001
Three parallel groups with different extension times, namely three levels of 10s/1kb, 30s/1kb and 60s/1kb, are respectively set.
Reaction procedure: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 15s, annealing at 58 deg.C for 15s, extension at 72 deg.C for 20s/60s/120s, circulation at 30, and extension at 72 deg.C for 5 min. The PCR reaction products under the different rate tests were subjected to nucleic acid electrophoresis, and the results are shown in FIG. 2.
Example 2 amplification of 40kb Lambda DNA with Gly149Ala/Gly574Ala mutant and wild type proofast
The Gly149Ala/Gly574Ala mutant and the wild type proofast are configured into a PCR reaction system according to the following system to carry out the computer experiment.
Figure P_220429162350431_431593001
Three parallel groups with different extension times, namely three levels of 10s/1kb, 30s/1kb and 60s/1kb, are respectively set.
Reaction procedure: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 15s, annealing at 58 deg.C for 15s, extension at 72 deg.C for 10s, circulation at 30, and extension at 72 deg.C for 5 min. The PCR reaction products under different rate tests were subjected to nucleic acid electrophoresis.
The amplification results at an extension time of 10s/kb are shown in FIG. 3, and from the comparative analysis of the results in FIG. 3, the amplification effect of the Gly149Ala/Gly574Ala mutant at an extension time of 10s is superior to that of the wild type, and the primer specificity is better than that of the wild type.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Nanjing Judge Biotech Co., Ltd
<120> high-fidelity DNA polymerase mutant and application thereof, product, gene, recombinant plasmid and gene engineering bacterium
<160> 15
<170> PatentIn version 3.5
<210> 1
<211> 775
<212> PRT
<213> Artificial sequence
<400> 1
Met Ile Leu Asp Val Asp Tyr Ile Thr Glu Glu Gly Lys Pro Val Ile
1 5 10 15
Arg Leu Phe Lys Lys Glu Asn Gly Lys Phe Lys Ile Glu His Asp Arg
20 25 30
Thr Phe Arg Pro Tyr Ile Tyr Ala Leu Leu Arg Asp Asp Ser Lys Ile
35 40 45
Glu Glu Val Lys Lys Ile Thr Gly Glu Arg His Gly Lys Ile Val Arg
50 55 60
Ile Val Asp Val Glu Lys Val Glu Lys Lys Phe Leu Gly Lys Pro Ile
65 70 75 80
Thr Val Trp Lys Leu Tyr Leu Glu His Pro Gln Asp Val Pro Thr Ile
85 90 95
Arg Glu Lys Val Arg Glu His Pro Ala Val Val Asp Ile Phe Glu Tyr
100 105 110
Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro
115 120 125
Met Glu Gly Glu Glu Glu Leu Lys Ile Leu Ala Phe Asp Ile Glu Thr
130 135 140
Leu Tyr His Glu Ala Glu Glu Phe Gly Lys Gly Pro Ile Ile Met Ile
145 150 155 160
Ser Tyr Ala Asp Glu Asn Glu Ala Lys Val Ile Thr Trp Lys Asn Ile
165 170 175
Asp Leu Pro Tyr Val Glu Val Val Ser Ser Glu Arg Glu Met Ile Lys
180 185 190
Arg Phe Leu Arg Ile Ile Arg Glu Lys Asp Pro Asp Ile Ile Val Thr
195 200 205
Tyr Asn Gly Asp Ser Phe Asp Phe Pro Tyr Leu Ala Lys Arg Ala Glu
210 215 220
Lys Leu Gly Ile Lys Leu Thr Ile Gly Arg Asp Gly Ser Glu Pro Lys
225 230 235 240
Met Gln Arg Ile Gly Asp Met Thr Ala Val Glu Val Lys Gly Arg Ile
245 250 255
His Phe Asp Leu Tyr His Val Ile Thr Arg Thr Ile Asn Leu Pro Thr
260 265 270
Tyr Thr Leu Glu Ala Val Tyr Glu Ala Ile Phe Gly Lys Pro Lys Glu
275 280 285
Lys Val Tyr Ala Asp Glu Ile Ala Lys Ala Trp Glu Ser Gly Glu Asn
290 295 300
Leu Glu Arg Val Ala Lys Tyr Ser Met Glu Asp Ala Lys Ala Thr Tyr
305 310 315 320
Glu Leu Gly Lys Glu Phe Leu Pro Met Glu Ile Gln Leu Ser Arg Leu
325 330 335
Val Gly Gln Pro Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu
340 345 350
Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Val Ala
355 360 365
Pro Asn Lys Pro Ser Glu Glu Glu Tyr Gln Arg Arg Leu Arg Glu Ser
370 375 380
Tyr Thr Gly Gly Phe Val Lys Glu Pro Glu Lys Gly Leu Trp Glu Asn
385 390 395 400
Ile Val Tyr Leu Asp Phe Arg Ala Leu Tyr Pro Ser Ile Ile Ile Thr
405 410 415
His Asn Val Ser Pro Asp Thr Leu Asn Leu Glu Gly Cys Lys Asn Tyr
420 425 430
Asp Ile Ala Pro Gln Val Gly His Lys Phe Cys Lys Asp Ile Pro Gly
435 440 445
Phe Ile Pro Ser Leu Leu Gly His Leu Leu Glu Glu Arg Gln Lys Ile
450 455 460
Lys Thr Lys Met Lys Glu Thr Gln Asp Pro Ile Glu Lys Ile Leu Leu
465 470 475 480
Asp Tyr Arg Gln Lys Ala Ile Lys Leu Leu Ala Asn Ser Phe Tyr Gly
485 490 495
Tyr Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu
500 505 510
Ser Val Thr Ala Trp Gly Arg Lys Tyr Ile Glu Leu Val Trp Lys Glu
515 520 525
Leu Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ile Asp Thr Asp Gly
530 535 540
Leu Tyr Ala Thr Ile Pro Gly Gly Glu Ser Glu Glu Ile Lys Lys Lys
545 550 555 560
Ala Leu Glu Phe Val Lys Tyr Ile Asn Ser Lys Leu Pro Ala Leu Leu
565 570 575
Glu Leu Glu Tyr Glu Gly Phe Tyr Lys Arg Gly Phe Phe Val Thr Lys
580 585 590
Lys Arg Tyr Ala Val Ile Asp Glu Glu Gly Lys Val Ile Thr Arg Gly
595 600 605
Leu Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln
610 615 620
Ala Arg Val Leu Glu Thr Ile Leu Lys His Gly Asp Val Glu Glu Ala
625 630 635 640
Val Arg Ile Val Lys Glu Val Ile Gln Lys Leu Ala Asn Tyr Glu Ile
645 650 655
Pro Pro Glu Lys Leu Ala Ile Tyr Glu Gln Ile Thr Arg Pro Leu His
660 665 670
Glu Tyr Lys Ala Ile Gly Pro His Val Ala Val Ala Lys Lys Leu Ala
675 680 685
Ala Lys Gly Val Lys Ile Lys Pro Gly Met Val Ile Gly Tyr Ile Val
690 695 700
Leu Arg Gly Asp Gly Pro Ile Ser Asn Arg Ala Ile Leu Ala Glu Glu
705 710 715 720
Tyr Asp Pro Lys Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn
725 730 735
Gln Val Leu Pro Ala Val Leu Arg Ile Leu Glu Gly Phe Gly Tyr Arg
740 745 750
Lys Glu Asp Leu Arg Tyr Gln Lys Thr Arg Gln Val Gly Leu Thr Ser
755 760 765
Trp Leu Asn Ile Lys Lys Ser
770 775
<210> 2
<211> 2328
<212> DNA
<213> Artificial sequence
<400> 2
atgattttag atgttgacta tatcactgaa gagggtaaac ctgtcatacg tttgtttaag 60
aaagaaaatg gcaagttcaa aattgagcat gatcgcacct ttcgacccta catctatgct 120
cttctccggg acgattctaa gatagaagag gtaaaaaaga ttacaggaga aagacacggg 180
aaaatcgtga ggatagttga cgtcgagaag gtagaaaaaa agttcctagg taaaccaatt 240
acggtgtgga agctgtactt agagcatccg caagatgttc ctactatccg tgaaaaagtc 300
cgcgagcacc ccgccgtagt ggacatattt gaatatgata ttccattcgc aaagcgatac 360
ttgatcgaca aaggccttat accgatggag ggagaagagg aactcaagat tctagcgttt 420
gatatcgaga ccctgtatca tgaagcggag gaattcggta aaggccctat aattatgatc 480
tcctacgctg acgagaacga agccaaggtt ataacatgga aaaatattga tttaccctat 540
gtcgaggtag tgtcatcgga acgggagatg atcaagagat ttttgaggat aattcgtgaa 600
aaagacccag atatcatagt tacgtacaac ggagacagtt tcgattttcc gtatcttgca 660
aagcgcgcgg agaaactcgg gattaagcta actatcggtc gagacggcag cgaacctaaa 720
atgcagcgga taggagatat gaccgctgtc gaggtaaagg ggagaattca cttcgacctg 780
taccatgtga tcacaaggac gataaattta cccacttata ccttggaagc cgtttacgag 840
gcaatttttg gtaaaccaaa ggaaaaagtc tatgcggatg agatcgctaa ggcctgggaa 900
tctggcgaga accttgaacg tgtagcaaaa tactccatgg aggacgcgaa ggctacatat 960
gaactcggaa aagagttcct accgatggaa atacaactgt cacgcttagt ggggcagcct 1020
ttgtgggatg tttcgcgaag tagcacgggt aatcttgtcg agtggtttct cctacggaag 1080
gcctacgaaa gaaacgaggt agcacccaat aaaccatctg aagaggaata tcaaaggcgt 1140
ctgcgcgagt cctacactgg cggattcgtg aaggaaccgg agaaagggtt atgggaaaac 1200
attgtttatt tggactttcg agcgctttac ccttcaatca taattaccca caatgtctcg 1260
cccgatacac tcaacctaga gggttgtaag aattatgaca tcgctccaca ggtaggccat 1320
aaattctgca aggatatacc gggatttatt cctagtctgt tagggcactt gcttgaagag 1380
cggcaaaaaa tcaagacgaa aatgaaggaa actcaggacc ccatagagaa aattctccta 1440
gattacagac aaaaggccat caaactgtta gcaaacagct tctatggtta ctatggctac 1500
gcgaaggcta ggtggtattg taaagaatgc gccgagtctg tgaccgcatg gggacgtaag 1560
tacatagaat tggtttggaa agagcttgaa gagaagtttg ggttcaaagt cctctatatt 1620
gacacagatg gtctatacgc gacgatccca ggcggagaat ccgaggaaat aaagaaaaag 1680
gctctggagt ttgtaaaata tattaattca aagttaccgg cgttgcttga actcgagtac 1740
gaaggtttct ataaacgcgg ctttttcgtg actaagaaac gatacgccgt tatcgacgag 1800
gaaggaaagg tcataacccg ggggctagag attgtaagaa gggattggtc ggaaatcgca 1860
aaagagacac aggcgcgtgt gctggaaacg atattaaagc atggtgacgt tgaggaagct 1920
gtccgcattg taaaagaggt gatccaaaag ttggccaact atgaaatacc tcccgagaaa 1980
cttgcaattt acgaacagat cactcgacca ctccacgagt ataaggcgat aggcccgcat 2040
gttgctgtcg ccaaaaagct agcagcgaaa ggagtaaaga ttaaacctgg gatggtgatc 2100
ggttacatag ttctgcgggg cgatggaccc attagtaata gagctatctt agccgaagag 2160
tatgacccaa agaaacacaa gtacgatgca gaatattaca tagagaacca agtcttgccg 2220
gcggtactta ggattctcga agggtttggt tatcgtaaag aggacctacg ctaccagaag 2280
acccgacaag tgggcctgac aagctggtta aatatcaaaa agtcttaa 2328
<210> 3
<211> 775
<212> PRT
<213> Artificial sequence
<400> 3
Met Ile Leu Asp Val Asp Tyr Ile Thr Glu Glu Gly Lys Pro Val Ile
1 5 10 15
Arg Leu Phe Lys Lys Glu Asn Gly Lys Phe Lys Ile Glu His Asp Arg
20 25 30
Thr Phe Arg Pro Tyr Ile Tyr Ala Leu Leu Arg Asp Asp Ser Lys Ile
35 40 45
Glu Glu Val Lys Lys Ile Thr Gly Glu Arg His Gly Lys Ile Val Arg
50 55 60
Ile Val Asp Val Glu Lys Val Glu Lys Lys Phe Leu Gly Lys Pro Ile
65 70 75 80
Thr Val Trp Lys Leu Tyr Leu Glu His Pro Gln Asp Val Pro Thr Ile
85 90 95
Arg Glu Lys Val Arg Glu His Pro Ala Val Val Asp Ile Phe Glu Tyr
100 105 110
Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro
115 120 125
Met Glu Gly Glu Glu Glu Leu Lys Ile Leu Ala Phe Asp Ile Glu Thr
130 135 140
Leu Tyr His Glu Gly Glu Glu Phe Gly Lys Gly Pro Ile Ile Met Ile
145 150 155 160
Ser Tyr Ala Asp Glu Asn Glu Ala Lys Val Ile Thr Trp Lys Asn Ile
165 170 175
Asp Leu Pro Tyr Val Glu Val Val Ser Ser Glu Arg Glu Met Ile Lys
180 185 190
Arg Phe Leu Arg Ile Ile Arg Glu Lys Asp Pro Asp Ile Ile Val Thr
195 200 205
Tyr Asn Gly Asp Ser Phe Asp Phe Pro Tyr Leu Ala Lys Arg Ala Glu
210 215 220
Lys Leu Gly Ile Lys Leu Thr Ile Gly Arg Asp Gly Ser Glu Pro Lys
225 230 235 240
Met Gln Arg Ile Gly Asp Met Thr Ala Val Glu Val Lys Gly Arg Ile
245 250 255
His Phe Asp Leu Tyr His Val Ile Thr Arg Thr Ile Asn Leu Pro Thr
260 265 270
Tyr Thr Leu Glu Ala Val Tyr Glu Ala Ile Phe Gly Lys Pro Lys Glu
275 280 285
Lys Val Tyr Ala Asp Glu Ile Ala Lys Ala Trp Glu Ser Gly Glu Asn
290 295 300
Leu Glu Arg Val Ala Lys Tyr Ser Met Glu Asp Ala Lys Ala Thr Tyr
305 310 315 320
Glu Leu Gly Lys Glu Phe Leu Pro Met Glu Ile Gln Leu Ser Arg Leu
325 330 335
Val Gly Gln Pro Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu
340 345 350
Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Val Ala
355 360 365
Pro Asn Lys Pro Ser Glu Glu Glu Tyr Gln Arg Arg Leu Arg Glu Ser
370 375 380
Tyr Thr Gly Gly Phe Val Lys Glu Pro Glu Lys Gly Leu Trp Glu Asn
385 390 395 400
Ile Val Tyr Leu Asp Phe Arg Ala Leu Tyr Pro Ser Ile Ile Ile Thr
405 410 415
His Asn Val Ser Pro Asp Thr Leu Asn Leu Glu Gly Cys Lys Asn Tyr
420 425 430
Asp Ile Ala Pro Gln Val Gly His Lys Phe Cys Lys Asp Ile Pro Gly
435 440 445
Phe Ile Pro Ser Leu Leu Gly His Leu Leu Glu Glu Arg Gln Lys Ile
450 455 460
Lys Thr Lys Met Lys Glu Thr Gln Asp Pro Ile Glu Lys Ile Leu Leu
465 470 475 480
Asp Tyr Arg Gln Lys Ala Ile Lys Leu Leu Ala Asn Ser Phe Tyr Gly
485 490 495
Tyr Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu
500 505 510
Ser Val Thr Ala Trp Gly Arg Lys Tyr Ile Glu Leu Val Trp Lys Glu
515 520 525
Leu Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ile Asp Thr Asp Gly
530 535 540
Leu Tyr Ala Thr Ile Pro Gly Gly Glu Ser Glu Glu Ile Lys Lys Lys
545 550 555 560
Ala Leu Glu Phe Val Lys Tyr Ile Asn Ser Lys Leu Pro Gly Leu Leu
565 570 575
Glu Leu Glu Tyr Glu Gly Phe Tyr Lys Arg Gly Phe Phe Val Thr Lys
580 585 590
Lys Arg Tyr Ala Val Ile Asp Glu Glu Gly Lys Val Ile Thr Arg Gly
595 600 605
Leu Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln
610 615 620
Ala Arg Val Leu Glu Thr Ile Leu Lys His Gly Asp Val Glu Glu Ala
625 630 635 640
Val Arg Ile Val Lys Glu Val Ile Gln Lys Leu Ala Asn Tyr Glu Ile
645 650 655
Pro Pro Glu Lys Leu Ala Ile Tyr Glu Gln Ile Thr Arg Pro Leu His
660 665 670
Glu Tyr Lys Ala Ile Gly Pro His Val Ala Val Ala Lys Lys Leu Ala
675 680 685
Ala Lys Gly Val Lys Ile Lys Pro Gly Met Val Ile Gly Tyr Ile Val
690 695 700
Leu Arg Gly Asp Gly Pro Ile Ser Asn Arg Ala Ile Leu Ala Glu Glu
705 710 715 720
Tyr Asp Pro Lys Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn
725 730 735
Gln Val Leu Pro Ala Val Leu Arg Ile Leu Glu Gly Phe Gly Tyr Arg
740 745 750
Lys Glu Asp Leu Arg Tyr Gln Lys Thr Arg Gln Val Gly Leu Thr Ser
755 760 765
Trp Leu Asn Ile Lys Lys Ser
770 775
<210> 4
<211> 27
<212> DNA
<213> Artificial sequence
<400> 4
cctgtatcat gaagcggagg aattcgg 27
<210> 5
<211> 27
<212> DNA
<213> Artificial sequence
<400> 5
ccgaattcct ccgcttcatg atacagg 27
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence
<400> 6
caaagttacc ggcgttgctt gaac 24
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence
<400> 7
gttcaagcaa cgccggtaac tttg 24
<210> 8
<211> 18
<212> DNA
<213> Artificial sequence
<400> 8
caggaaacag ctatgacc 18
<210> 9
<211> 18
<212> DNA
<213> Artificial sequence
<400> 9
tgtaaaacga cggccagt 18
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence
<400> 10
taatacgact cactataggg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence
<400> 11
acatccactt tgcctttctc 20
<210> 12
<211> 22
<212> DNA
<213> Artificial sequence
<400> 12
gcatctactc gtcgcgaacc gc 22
<210> 13
<211> 21
<212> DNA
<213> Artificial sequence
<400> 13
caatgattct tatcagaaac c 21
<210> 14
<211> 22
<212> DNA
<213> Artificial sequence
<400> 14
ccataattgc atctactcgt cg 22
<210> 15
<211> 22
<212> DNA
<213> Artificial sequence
<400> 15
cagctgcgtc gtttgacatc ag 22

Claims (10)

1. The high-fidelity DNA polymerase mutant is characterized in that the amino acid sequence of the high-fidelity DNA polymerase mutant is shown as SEQ ID NO. 1.
2. The high-fidelity DNA polymerase mutant of claim 1, wherein the nucleotide sequence of the high-fidelity DNA polymerase mutant is shown as SEQ ID No. 2.
3. Use of the high fidelity DNA polymerase mutant of claim 1 or 2 in the preparation of nucleic acid amplification products.
4. A nucleic acid amplification product comprising the high fidelity DNA polymerase mutant of claim 1 or 2.
5. A gene encoding the high fidelity DNA polymerase mutant of claim 1 or 2.
6. The gene of claim 5, which has the nucleotide sequence shown in SEQ ID No. 2.
7. A recombinant plasmid comprising a vector and the gene of claim 5 or 6.
8. The recombinant plasmid of claim 7, wherein the vector comprises a pET-24a (+) plasmid.
9. A genetically engineered bacterium comprising the recombinant plasmid according to claim 7 or 8.
10. The genetically engineered bacterium of claim 9, wherein the genetically engineered bacterium comprises escherichia coli.
CN202210478070.2A 2022-05-05 2022-05-05 High-fidelity DNA polymerase mutant and application thereof Active CN114574464B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210478070.2A CN114574464B (en) 2022-05-05 2022-05-05 High-fidelity DNA polymerase mutant and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210478070.2A CN114574464B (en) 2022-05-05 2022-05-05 High-fidelity DNA polymerase mutant and application thereof

Publications (2)

Publication Number Publication Date
CN114574464A true CN114574464A (en) 2022-06-03
CN114574464B CN114574464B (en) 2022-10-14

Family

ID=81777950

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210478070.2A Active CN114574464B (en) 2022-05-05 2022-05-05 High-fidelity DNA polymerase mutant and application thereof

Country Status (1)

Country Link
CN (1) CN114574464B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060223157A1 (en) * 2005-01-06 2006-10-05 Martin Patrick K Polypeptides having nucleic acid binding activity
CN109022387A (en) * 2018-08-29 2018-12-18 华南理工大学 A kind of saltant type Pfu archaeal dna polymerase and its preparation method and application
CN111518873A (en) * 2020-05-11 2020-08-11 南京君华基因科技有限公司 Optimized method for amplifying target nucleic acid and application
CN113604450A (en) * 2021-08-18 2021-11-05 华南理工大学 KOD DNA polymerase mutant and preparation method and application thereof
CN114262697A (en) * 2021-12-30 2022-04-01 南京巨匠生物科技有限公司 Bsu DNA polymerase and Bsu DNA polymerase mutant as well as gene, plasmid and genetic engineering bacteria thereof
CN114369586A (en) * 2022-03-21 2022-04-19 南京巨匠生物科技有限公司 Taq DNA polymerase mutant and application thereof, product, gene, plasmid and genetic engineering bacteria

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060223157A1 (en) * 2005-01-06 2006-10-05 Martin Patrick K Polypeptides having nucleic acid binding activity
CN109022387A (en) * 2018-08-29 2018-12-18 华南理工大学 A kind of saltant type Pfu archaeal dna polymerase and its preparation method and application
CN111518873A (en) * 2020-05-11 2020-08-11 南京君华基因科技有限公司 Optimized method for amplifying target nucleic acid and application
CN113604450A (en) * 2021-08-18 2021-11-05 华南理工大学 KOD DNA polymerase mutant and preparation method and application thereof
CN114262697A (en) * 2021-12-30 2022-04-01 南京巨匠生物科技有限公司 Bsu DNA polymerase and Bsu DNA polymerase mutant as well as gene, plasmid and genetic engineering bacteria thereof
CN114369586A (en) * 2022-03-21 2022-04-19 南京巨匠生物科技有限公司 Taq DNA polymerase mutant and application thereof, product, gene, plasmid and genetic engineering bacteria

Also Published As

Publication number Publication date
CN114574464B (en) 2022-10-14

Similar Documents

Publication Publication Date Title
Ostermeier et al. A combinatorial approach to hybrid enzymes independent of DNA homology
Erauso et al. Sequence of plasmid pGT5 from the archaeon Pyrococcus abyssi: evidence for rolling-circle replication in a hyperthermophile
EP1918370B1 (en) Mutant pcna
JP2020505004A (en) Novel polypeptide and method for producing IMP using the same
WO1999006538A1 (en) Thermococcus barosii dna polymerase mutants
EP1817413A1 (en) Ladder assembly and system for generating diversity
JPH10503381A (en) Purified Thermococcus barossi DNA polymerase
CN107475216A (en) Recombinant type hot resistant DNA polymerase and its application
CN108949719B (en) Coding error-prone DNA polymerase and preparation method thereof
WO2018076980A1 (en) Dna polymerase with improved catalytic dna synthesis extension capability
JP7014256B2 (en) Nucleic acid amplification reagent
JP2017178804A (en) Fusion protein
CN109868271B (en) Method for de novo synthesis of DNA shuffling libraries using on-chip synthetic oligonucleotide libraries
CN114561372B (en) Bst DNA polymerase mutant and application thereof, product, gene, recombinant plasmid and genetic engineering bacterium
CN114574464B (en) High-fidelity DNA polymerase mutant and application thereof
CN112029744A (en) DNA polymerase and its coding gene, preparation method and PCR application
KR100777230B1 (en) Mutant dna polymerases and their genes from themococcus
CN114990080B (en) Lysine mutant thermostable nucleic acid ligase
US20050053989A1 (en) Libraries of recombinant chimeric proteins
CN114250206B (en) Methyltransferase mutant, recombinant vector, recombinant engineering bacterium and application thereof
CN114480345B (en) MazF mutant, recombinant vector, recombinant engineering bacterium and application thereof
WO2023082266A1 (en) Chimeric dna polymerase and use thereof
JP5935382B2 (en) RrhJ1II nuclease and its gene
JP3880173B2 (en) DNA synthase
KR100969477B1 (en) Thermococcus guaymasensis DNA polymerase and Polymerase Chain Reaction method using it

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant