CN114438207B

CN114438207B - Annular RNA biomarker for breast cancer and application thereof

Info

Publication number: CN114438207B
Application number: CN202210030335.2A
Authority: CN
Inventors: 王婷; 龙方懿; 肖洪涛; 张晞倩; 林红
Original assignee: Sichuan Cancer Hospital
Current assignee: Sichuan Cancer Hospital
Priority date: 2022-01-12
Filing date: 2022-01-12
Publication date: 2023-06-20
Anticipated expiration: 2042-01-12
Also published as: CN114438207A

Abstract

The invention discloses a circular RNA biomarker circ-GLIS1 of breast cancer and application thereof, wherein the structure of the circular RNA circ-GLIS1 is a circular structure formed by reverse splicing of a nucleotide sequence shown in SEQ No.1, wherein a 3 'end and a 5' end are connected end to end, and the kit comprises a reagent for quantitatively detecting the biomarker. The invention discovers that the expression level of circ-GLIS1 in breast tumor cells is obviously increased, and proliferation and invasion of breast tumors can be obviously increased after the expression is over-expressed; therefore, the circ-GLIS1 can be used as a molecular marker for diagnosing breast cancer, so that the breast cancer diagnosis is more accurate and rapid, and a new theoretical basis and a new marker are provided for the diagnosis and prognosis analysis of the circ-GLIS1 for the breast cancer.

Description

Annular RNA biomarker for breast cancer and application thereof

Technical Field

The invention relates to the technical field of breast cancer diagnosis, in particular to application of a circular RNA circ-GLIS1 biomarker in preparation of a breast cancer diagnosis reagent.

Background

Breast cancer is the most common malignancy in women and is the leading cause of cancer death in women worldwide. At present, the incidence rate of breast cancer rises year by year, and the comprehensive treatment means (including operation, chemotherapy and radiotherapy) have larger individual difference and toxic and side effects, and have great influence on the survival quality of patients. Therefore, searching for new breast cancer biomarkers, targeting and individualizing treatments are of great clinical significance.

Circular RNA (circRNA) is a novel non-coding RNA which has stable structure and obvious tissue and disease specificity, and researches show that the circRNA participates in the occurrence, development, invasion and metastasis of various tumors, and is an ideal candidate tumor biomarker and tumor treatment target. Mechanically, the function of circRNA includes sponge-regulated gene expression as microRNA (miRNA), binding to RNA Binding Proteins (RBPs) or translation into proteins. The circRNA is rich in miRNA binding sites, plays a role of miRNA sponge in cells, further relieves the inhibition effect of miRNA on target genes of the miRNA, and increases the expression level of the target genes, and the action mechanism is called competitive endogenous RNA (ceRNA) mechanism.

With the development of bioinformatics, research on the action mechanism of the circRNA in the development of gastric cancer and lung cancer tumorigenesis has also been greatly advanced, but the action mechanism of the circRNA in breast cancer is still to be further explored. Currently, there is still a lack of specific circRNA biomarkers to efficiently detect breast cancer.

Disclosure of Invention

In view of the above, the present invention aims to provide a rapid, sensitive and specific diagnostic index for breast cancer and a corresponding diagnostic kit.

In order to achieve the above purpose, the technical scheme adopted by the patent comprises the following aspects:

in a first aspect, the invention provides a circular RNA circ-GLIS1 (hsa_circ_ 0002079), wherein the circular RNA has a structure that a nucleotide sequence shown in SEQ No.1 forms a 3 '-end and a 5' -end connected in an end-to-end manner through reverse splicing. It should be noted that, the inventors of the present application found for the first time that the circular RNA circ-GLIS1 was located at chr1:54059780-54065951 in the genome, and that the corresponding linear gene was GLIS1 (NM-147193.4); the circular RNA is cyclized from the 2 nd and 3 rd exons of the gene GLIS1, and is 1061 bases long; there is no report of the functional application of circ-GLIS1 in breast cancer.

In a second aspect, the invention provides a molecular marker for breast cancer, which is circular RNA circ-GLIS1. Experiments of the inventor of the application show that the expression quantity of the circ-GLIS1 in breast cancer is obviously up-regulated, and the overexpression of the circ-GLIS1 can promote proliferation and metastasis of the breast cancer, so that the circ-GLIS1 can be used as a novel molecular marker for diagnosing the breast cancer.

In a third aspect, the invention provides the use of a detection reagent for the content of circular RNA circ-GLIS1 in the preparation of a diagnostic kit for breast cancer, wherein the detection reagent is a primer pair capable of amplifying circ-GLIS1, and the base sequence of the primer pair is selected from the sequences shown in any two of SEQ No. 2-5.

Preferably, the primer pair comprises an upstream primer and a downstream primer, wherein the base sequence of the upstream primer is selected from the sequences shown in any one of SEQ No.2-3, and the base sequence of the downstream primer is selected from the sequences shown in any one of SEQ No. 4-5.

In a fourth aspect, the invention provides a diagnostic kit for breast cancer, the kit comprising a primer pair for amplifying the circular RNA circ-GLIS1, wherein the circular RNA circ-GLIS1 has a structure in which the nucleotide sequence shown in SEQ No.1 is formed by reverse splicing, the 3 '-end and the 5' -end are connected end to end, and the base sequence of the primer pair is selected from the sequences shown in any two of SEQ No. 2-5.

The diagnostic kit of the present invention includes, in addition to the primer pair capable of amplifying circ-GLIS1, other reagents required for PCR amplification, such as reverse transcriptase, RNA polymerase, buffer, and the like.

In a fifth aspect, the invention provides the use of the cyclic RNA circ-GLIS1 for the preparation of an anti-breast cancer pharmaceutical composition. The structure of the circular RNA circ-GLIS1 is a circular structure formed by reverse splicing of a nucleotide sequence shown in SEQ No.1, wherein the 3 'end and the 5' end are connected end to end. After the circular RNA is over-expressed, the proliferation of breast cancer cells can be obviously increased, and invasion and growth of breast transplantation tumor can be promoted. The drug aiming at the circular RNA target can inhibit the expression of circ-GLIS1 in breast cancer cells.

Preferably, the target point sequence of the drug is a circular RNA formed by reverse splicing of SEQ No.1, and the drug is an oligonucleotide, an oligonucleotide expression vector or a small molecule compound.

In summary, the beneficial effects of the invention are as follows:

the present invention discovers and demonstrates for the first time the role of circular RNA (circ-GLIS 1) as a carcinomatous factor in breast cancer.

The invention reveals the key effect of circ-GLIS1 in the occurrence and development of breast cancer, and lays a foundation for the diagnosis of breast cancer and the research and development of related target medicaments. The discovery of the new target spot provides a powerful means for the accurate treatment of breast cancer patients and the screening and prevention of high-risk groups, and has great social significance for improving the life quality of the patients.

The kit for diagnosing and screening the breast cancer developed based on the target spot circ-GLIS1 discovered by the invention is stable in structure and has tissue specificity, is beneficial to improving the diagnosis efficiency of the breast cancer and establishing an early diagnosis, prevention and intervention system of the breast cancer, and can greatly reduce the family economic burden of patients and improve the utilization efficiency of medical resources.

Drawings

FIG. 1 is a schematic diagram of the circ-GLIS1 structure of the present invention;

FIG. 2 is a generation of a sequencing result graph; it identifies the reverse splice site of circ-GLIS 1;

FIG. 3 shows the differential expression of circ-GLIS1 of the invention in normal breast cells MCF-10A and breast tumor cells MCF-7 (n=3;. P < 0.01);

FIG. 4 is a map of the structure of pCD5-ciR vector overexpressing circ-GLIS 1;

FIG. 5 is a graph showing the use of qPCR to verify that MCF-7 cells overexpress circ-GLIS1 (n=3;. P < 0.01);

FIG. 6 shows the results of detecting the proliferation of MCF-7 cells by using a flow cytometer;

FIG. 7 is a statistical plot of the results of the circ-GLIS1 overexpression versus MCF-7 cell proliferation of the present invention;

FIG. 8 shows the results of cell staining of invasive tests over-expressing circ-GLIS1 and control (control);

FIG. 9 is a statistical chart of the results of an invasion assay examining the invasion of MCF-7 cells by overexpressing circ-GLIS 1;

FIG. 10 shows the qPCR method for examining the expression of circ-GLIS1 in nude mouse tumor tissues over-expressing circ-GLIS1 group and control group (control);

FIG. 11 photographs of tumor tissues after nude mice overexpressing circ-GLIS1 group and control group (control) were inoculated with the transplanted tumors;

FIG. 12 shows the growth of tumor tissue after nude mice were inoculated with the engrafted tumor, and the level of circ-GLIS1 in the engrafted tumor overexpressing circ-GLIS1 was significantly higher than that in the control group (control).

Detailed Description

The invention provides application of circ-GLIS1 in diagnosing breast cancer according to research on expression of circular RNA circ-GLIS1 in breast cancer and regulation of biological functions of human breast cancer cells.

For a better description of the objects, technical solutions and advantages of the present invention, the present invention will be further described with reference to the accompanying drawings and specific embodiments.

Example 1 preparation method and Structure verification of circular RNA circ-GLIS1

Circ-GLIS1 (hsa_circ_0002079, chr1:54059780-54065951) is formed by reverse cleavage of the 2 nd and 3 rd exons of gene GLIS1 (1p32.3), 1061 bases in length. The structural characteristics and sequence information of the Circ-GLIS1 are shown in FIG. 1 and SEQ No. 1.

Quantitative detection method of circular RNA circ-GLIS1:

1. RNA extraction: and extracting total RNA of breast tumor cells MCF-7 by using a total RNA extraction kit, and detecting the purity and concentration of the total RNA by using a Nanodrop3000 micro nucleic acid determinator.

2. Reverse transcription: performing reverse transcription to obtain a cDNA template, wherein the reverse transcription reaction comprises the following steps: 500ng of template RNA, 1. Mu.L of random hexamer primer, and RNase (RNase) water to a total volume of 12. Mu.L, were mixed and incubated at 70℃for 5 minutes; then, 4. Mu.L of 5 Xreaction buffer, 20U RNase inhibitor, 2. Mu.L of 10mM dNTP Mix and 1. Mu.L of reverse transcriptase were added in this order. After being evenly mixed, the mixture is reacted for 5min at 25 ℃, then reacted for 60min at 42 ℃ and finally reacted for 10min at 70 ℃ to obtain the cDNA template.

3. Recovery of circular RNA circ-GLIS1: specific divergent primers were designed for the reverse splice site of circ-GLIS1, the primer sequences were as follows:

a Polymerase Chain (PCR) reaction was performed using a PCR amplification kit to amplify the reverse splice fragment of circ-GLIS1. The experimental steps are as follows: 10 XPCR Buffer 2. Mu.L, 25mM MgCl ₂ 1.2. Mu.L, dNTP mix 1.6. Mu.L, 500ng cDNA template, primer-F1. Mu. L, primer-R1. Mu.L, deionized water 12.1. Mu.L and amplification enzyme 0.1. Mu.L were mixed and amplified, primer-F used in this example was SEQ No.3, primer-R was SEQ No.5, PCR amplification procedure: (1) denaturation at 95℃for 5min; (2) denaturation at 95℃for 30s, (3) annealing at 60℃for 30s, (4) extension at 72℃for 1min, (2) repetition of 40 cycles to (4) final treatment at 72℃for 10min. And (3) carrying out agarose gel electrophoresis on the amplified product, recovering the size of the product fragment, and then carrying out Sanger sequencing on the amplified product by using a primer pair 1, and verifying the circular structure of the circ-GLIS1. The sequencing results are shown in FIG. 2.

EXAMPLE 2 detection of expression of circular RNA Circ-GLIS1 in breast tumor cells and breast Normal cells

The expression condition of the circ-GLIS1 in breast tumor cells MCF-7 and breast normal cells MCF-10A (purchased from a cell bank of China academy of sciences, shanghai) is detected by adopting fluorescence quantitative PCR (qPCR), and the expression of the circ-GLIS1 in the breast tumor cells is found to be significantly higher than that of the normal cells, so that the circ-GLIS1 can be used as a cancer-promoting factor and a potential treatment target of breast cancer.

Method for detecting circular RNA circ-GLIS1: and extracting total RNA of breast tumor cells MCF-7 and normal breast cells MCF-10A by using a total RNA extraction kit, and detecting the purity and concentration of the total RNA by using a Nanodrop3000 micro nucleic acid tester. Then, reverse transcription is carried out by adopting the method to obtain a cDNA template for qPCR detection, and the experimental steps are as follows: 2 XqPCR Mix 10. Mu.L, 500ng cDNA template, primer-F1. Mu. L, primer-R1. Mu.L and 7.4. Mu.L of deionized water were mixed and subjected to qPCR reaction, amplification procedure: (1) pretreating at 50 ℃ for 2min; (2) enzyme activation at 95℃for 2min, (3) denaturation at 95℃for 15s, (4) annealing/extension at 60℃for 20s, (3) to (4) steps were repeated for 40 cycles, and (5) dissolution profile. The detection results are shown in fig. 3, and the results show that: the expression of the circular RNA circ-GLIS1 circ-GLIS1 in MCF-7 was approximately 3.11 times that in MCF-10A, indicating that circ-GLIS1 was significantly upregulated in tumor cells.

Example 3 construction of Circ-GLIS1 overexpression vector and its role in promoting proliferation and invasion of breast cancer cells

The pCD5-ciR vector (Gicemetery Biotechnology Co., ltd., guangzhou) was constructed to overexpress circ-GLIS1, and the full-length 1061bp sequence of hsa_circ_0002079 was amplified by PCR, and EcoRI and BamHI were ligated into pCD 5-ciR. The structure of the pCD5-ciR vector is shown in FIG. 4.

The pCD5-ciR vector which overexpresses circ-GLIS1 is used for transfecting breast tumor cells, and the influence of the overexpression of circ-GLIS1 on proliferation and invasion capacity of the breast tumor cells is observed. The test steps are as follows: (1) MCF-7 cells are inoculated into a 12-well plate and transfected when the MCF-7 cells grow to 70% fusion; (2) 1. Mu.g of circ-GLIS1 pCD5-ciR carrier and 2. Mu. L P3000 reagent are added into 50. Mu.L of serum-free culture medium and mixed evenly; (3) 2. Mu.L Lipofectamine 3000 was added to 50. Mu.L serum-free medium; (4) mixing the diluted overexpression vector and Lipofectamine reagent, and standing at room temperature for 20min to form a complex; (5) 100. Mu.L of the overexpression vector-Lipofectamine complex was added to the wells containing 900. Mu.L of serum-free medium, and the cells were cultured in a 5% CO2 incubator at 37℃for 6 hours, and the transfection medium was aspirated and the complete medium was changed. After 48h of transfection, the overexpression of the circ-GLIS1 is detected by adopting the qPCR method, and the test result shows that compared with a pCD5-ciR blank vector control group, the overexpression multiple of the circ-GLIS1 pCD5-ciR group is about 1608 times, and the expression of corresponding linear GLIS1 mRNA is not affected, so that the construction of the overexpression vector is successful, and the specificity is better, and the result is shown in figure 5.

MCF-7 cells were transfected with the circ-GLIS1 pCD5-ciR over-expression vector using the method described above, and the control group with pCD5-ciR blank vector was then subjected to the EdU cell proliferation assay as follows: cell culture media containing 10. Mu.M EdU were prepared, the transfected cell culture media was replaced with EdU media, cells were collected by digestion centrifugation after incubation for 2 hours, fixed with 1mL of 4% paraformaldehyde for 30min, neutralized with 3mL of 2mg/mL glycine for 5min, washed with PBS, incubated at room temperature for 10min with 1mL of 0.5% Triton X-100 penetrant, washed with PBS, stained with 200. Mu.L of Apollo staining reaction solution for 10min, collected by centrifugation and washed with 0.5% Triton X-100 penetrant for 3 times, resuspended with 0.5mL of PBS, and subjected to flow assay. The test results are shown in fig. 6 and 7, and the results show that: the number of EdU-labeled proliferating cells after the overexpression of circ-GLIS1 was about 1.9 times that of the control group (control), suggesting that the overexpression of circ-GLIS1 significantly increased the proliferation of MCF-7 cells.

The effect of over-expression of circ-GLIS1 on MCF-7 cell invasion was further examined. The test steps are as follows: precooling a Transwell plate, spreading gel by a thin gel forming method, and using a precooled pipetting head to carry out 50 mu L/cm on a Matrigel matrix ² Adding onto the upper side of the membrane, standing at 37deg.C for 30min to solidify; after digestion and centrifugation of MCF-7 cells, the cells were inoculated on the upper side of the membrane by blowing off with a DMEM medium containing 1% serum, and 10% serum medium was added to the lower side of the membrane; placing the Transwell plate into a cell incubator for continuous culture for 12 hours, taking out the cell, wiping out cells and matrigel remained on the upper side of the membrane by using a cotton ball, cleaning by using PBS, soaking the lower surface of the Transwell into 4% paraformaldehyde solution, and fixing for 30 minutes; staining with crystal violet solution, photographing using microscopic observation, and counting the number of cells invading to the underside of the membrane. The number of cells affected after the overexpression of circ-GLIS1 was found to be about 5.3 times that of the control group (control), indicating that the overexpression of circ-GLIS1 promoted the invasion of MCF-7 cells, as shown in FIGS. 8 and 9.

Example 4 Circ-GLIS1 promotes the growth of nude mice breast cancer transplants

Experiments were performed using 4-6 week old BALB/c female nude mice. After the MCF-7 cells transfected by the circ-GLIS1 over-expression transfection or blank vector are digested by pancreatin, preparing cell suspension by a culture medium, and regulating the cell concentrationIs 5 multiplied by 10 ⁶ mu.L of the cells were injected under the second breast pad on the right side of the nude mice, and 6 nude mice were inoculated with each cell, and the growth of tumor was measured. The longest diameter and the shortest diameter of the transplanted tumor are measured by a vernier caliper, and the formula is as follows: volume = longest diameter x shortest diameter ² Tumor volume was calculated. Nude mice were sacrificed at week 3 of the experiment, tumor sizes were measured and volumes were calculated, and total RNA from tumor tissues was extracted to verify the circ-GLIS1 expression. As shown in fig. 10-12, the level of circ-GLIS1 in the engraftment tumor over-expressing circ-GLIS1 was found to be significantly higher than that of the control group (control), and the expression level was about 40.8 times that of the control group; and the over-expression of circ-GLIS1 can promote the growth of transplanted tumors, and the tumor formation volume is about 4.1 times of that of a control group (control) after three weeks.

The foregoing examples merely illustrate specific embodiments of the invention, which are described in greater detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention.

SEQ ID NO.1

TGAATGGGAGCTACGGACACCGTACCCCGGGCTCAGAGAAGAGCCTGCTGGACCTGGACCTTGCTGAGGGCCCTGGCCCCACCTGCTGCCAGGGCCTGTTTCTCCCTGCAGGAAGCCCACCGCCCCGGGCTCACCCCCAAGCTTGTGAGAGGCTGCTGCATTTCCCCCACCCTGACAGGTCACCTAGACCCCAGGCCACGTATGTGAACGGCAGCCTCCCAACCACACAACACATCAAACAGGAGTCCTTGCCCGACTACCAAGCCATGGCAGAGGCCCGCACATCCCTGTCTGCCCACTGTCGGGGCCCGCTGGCCACTGGCCTGCACCCAGACCTGGACCTCCCGGGCCGAAGCCTCGCCACCCCTGCGCCTTCCTGCTACCTTCTGGGCAGCGAACCCAGCTCTGGCCTGGGCCTCCAGCCCGAGACCCACCTCCCCGAGGGCAGCCTGAAGCGGTGCTGCGTCTTGGGCCTACCCCCCACCTCCCCAGCCTCCTCCTCACCCTGTGCCTCCTCCGACGTCACCTCCATCATCCGCTCCTCCCAGACGTCTCTGGTCACCTGTGTAAATGGACTCCGGAGCCCCCCTCTGACGGGAGATCTGGGGGGCCCTTCCAAGCGGGCCCGGCCTGGCCCTGC

ATCGACGGACAGCCATGAGGGCAGCTTGCAACTTGAAGCCTGCCGGAAGGCGAGCTTCCTGAAGCAGGAACCCGCGGATGAGTTTTCAGAGCTCTTTGGGCCTCACCAGCAGGGCCTGCCGCCCCCCTATCCCCTGTCTCAGTTGCCGCCTGGCCCAAGCCTTGGAGGCCTGGGGCTGGGCCTGGCAGGCAGGGTGGTGGCCGGGCGGCAGGCGTGCCGCTGGGTGGACTGCTGTGCAGCCTATGAGCAGCAGGAGGAGCTGGTGCGGCACATCGAGAAGAGCCACATCGACCAGCGCAAGGGCGAGGACTTCACCTGCTTCTGGGCTGGCTGCGTGCGCCGCTACAAGCCCTTCAACGCCCGCTACAAGCTGCTCATCCACATGCGAGTGCACTCGGGCGAGAAGCCCAACAAGTGCATG

SEQ ID NO.2

GAGGACTTCACCTGCTTCTG

SEQ ID NO.3

GCCCAACAAGTGCATGTGAA

SEQ ID NO.4

TACGGTGTCCGTAGCTCCCA

SEQ ID NO.5

ATGCAGCAGCCTCTCACAAG

Claims

1. Application of a detection reagent for the content of cyclic RNA circ-GLIS1 in preparing a diagnosis kit for breast cancer, wherein the structure of the cyclic RNA circ-GLIS1 is a cyclic structure formed by reverse splicing of a nucleotide sequence shown in SEQ No.1, wherein the 3 'end and the 5' end are connected end to end; the detection reagent comprises a primer pair capable of amplifying the circular RNA circ-GLIS1, wherein the primer pair comprises an upstream primer and a downstream primer, the base sequence of the upstream primer is selected from the sequences shown in any one of SEQ No.2-3, and the base sequence of the downstream primer is selected from the sequences shown in any one of SEQ No. 4-5.

2. The kit is characterized by comprising a primer pair capable of amplifying the circular RNA circ-GLIS1, wherein the circular RNA circ-GLIS1 has a structure formed by reverse splicing a nucleotide sequence shown in SEQ No.1, the 3 '-end and the 5' -end are connected end to end, the primer pair comprises an upstream primer and a downstream primer, the base sequence of the upstream primer is selected from a sequence shown in any one of SEQ No.2-3, and the base sequence of the downstream primer is selected from a sequence shown in any one of SEQ No. 4-5.