CN108841955B - Application of C22orf41 as pancreatic cancer tumor marker - Google Patents
Application of C22orf41 as pancreatic cancer tumor marker Download PDFInfo
- Publication number
- CN108841955B CN108841955B CN201810710524.8A CN201810710524A CN108841955B CN 108841955 B CN108841955 B CN 108841955B CN 201810710524 A CN201810710524 A CN 201810710524A CN 108841955 B CN108841955 B CN 108841955B
- Authority
- CN
- China
- Prior art keywords
- pancreatic cancer
- c22orf41
- seq
- tumor marker
- artificial sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention discloses a pancreatic cancer-related tumor marker C22orf41, and confirms that the C22orf41gene is highly expressed in tissue cells of pancreatic cancer canceration. The invention also provides application of the kit for detecting the expression level of C22orf41 in pancreatic cancer detection diagnosis or prognosis. The invention utilizes RNAi technology to interfere C22orf41gene to inhibit pancreatic cancer cell proliferation, proves that C22orf41 can be used as a molecular target for targeted therapy, and provides a medicament and a pharmaceutical composition for inhibiting pancreatic cancer cell proliferation. The pancreatic cancer related tumor marker C22orf41 has potential values as diagnostic detection, prognostic evaluation and therapeutic targets, and has profound clinical significance and important popularization and application prospects.
Description
Technical Field
The invention relates to the field of genetic engineering, in particular to application of C22orf41 as a pancreatic cancer tumor marker.
Background
Pancreatic cancer is one of the most fatal cancers in the world, with a 5-year survival rate of less than 5%. The reasons for poor prognosis of pancreatic cancer mainly include the occult onset of pancreatic cancer, delayed diagnosis, early distant metastasis, strong local invasiveness and lack of effective therapeutic drugs. Currently, surgical resection is considered the only definitive and effective treatment. Since pancreatic cancer is frequently found with metastasis, radical surgical treatment has not been achieved in most cases. To date, only about 20% of pancreatic cancer patients can undergo radical resection, and even among these patients, their 5-year survival rate is low due to early metastasis or recurrence. The methods currently available for diagnosing symptomatic pancreatic cancer are mainly imaging: computed Tomography (CT), Endoscopic Ultrasound (EUS), Endoscopic Retrograde Cholangiopancreatography (ERCP), but early diagnosis remains difficult. The noninvasive diagnosis method for pancreatic cancer with high sensitivity and specificity is expected to improve the early diagnosis rate and the prognosis survival rate of pancreatic cancer, improve the possibility of surgical resection and reduce the death rate of pancreatic cancer.
Disclosure of Invention
In order to realize early diagnosis of pancreatic cancer, improve prognosis survival rate and reduce mortality, the invention aims to provide a novel pancreatic cancer related tumor marker and application of the tumor marker. The tumor marker is C22orf 41. C22orf41 is expected to become a marker for pancreatic cancer diagnosis and prognosis judgment, and provides a new target for pancreatic cancer treatment.
The Cancer Genome Atlas (TCGA) database contains multiple levels of data information for multiple tumor types, including: miRNA, mRNA, protein profiles, mutation profiles, clinical diagnostic information, etc. These data provide a rich resource for tumor data analysis. Therefore, the inventors of the present invention first analyzed the correlation of the C22orf41gene with pancreatic cancer by means of the TCGA database.
The C22orf41gene of the present invention is a known gene prior to the present invention, and its basic information is as follows:
genbank accession No.: c22orf41GeneID:644186, derived from the human genome.
C22orf41 (also known as SYCE3, synthetic complex Central element protein 3, recombinant human synaptonemal Complex Central element protein 3) is a protein-encoding gene. The synaptonemal complex is a complex structure formed between two homologous chromosomes in pairing in the episodic phase of meiosis I, and the SYCE3 protein is essential for starting synapses between homologous chromosomes and is closely related to chromosome pairing, exchange and separation.
The research of the inventor of the invention finds that the C22orf41 is highly expressed in a pancreatic cancer sample, the expression level has obvious correlation with the adverse survival prognosis of a patient, and the reduction of the C22orf41 has obvious inhibition effect on the growth of pancreatic cancer cells, which indicates that the C22orf41 is possibly very important in the occurrence and development process of pancreatic cancer. The C22orf41 can be used for preparing preparations for auxiliary diagnosis, curative effect prediction and prognosis judgment of pancreatic cancer, can also be used for preparing kits for auxiliary diagnosis, curative effect prediction and prognosis judgment, and even can be used as an emerging therapeutic target for preparing medicines for treating pancreatic cancer.
The kit is a real-time fluorescence quantitative PCR detection kit and an immunological detection kit. The specific primer of the real-time fluorescent quantitative PCR detection kit is suitable for detecting SYBR Green. In addition, the kit also comprises a standard DNA template and a PCR reaction system, wherein the PCR reaction solution in the PCR reaction system is real-time fluorescent quantitative PCR reaction solution and further comprises fluorescent dye. The real-time fluorescent quantitative PCR reaction solution comprises dNTP, Mg2+, Taq enzyme and buffer solution, wherein the fluorescent dye is SYBR Green, and the Taq enzyme is hot-start enzyme. The C22orf41 antibody used in the immunological detection kit is suitable for immunohistochemical detection. The kit comprises a standard slice positive control and an immunohistochemical detection related reagent.
The pancreatic cancer C22orf41 detection diagnosis kit comprises the following applications: detecting the expression of the C22orf41gene in a test cell of the subject, i.e., a pancreatic cancer cell; comparing the value to the reference value, a significant simultaneous increase in the C22orf41gene above the reference value indicates that the subject has pancreatic cancer. The reference value level is the expression level of the C22orf41gene in normal cells, i.e., normal human pancreatic tissue cells, which are the same line as the test cells and have no canceration. The assay cell is known or suspected to comprise a tumor cell.
To verify the effectiveness of the invention in targeted therapy, the invention was verified by the following method: constructing RNAi lentivirus recombinant plasmid, transfecting pancreatic cancer cells BxPC-3, knocking down C22orf41gene expression, establishing C22orf41 over-expressed pancreatic cancer cell strains, and detecting the proliferation conditions of different groups of cells. The results showed that cell proliferation was significantly inhibited when C22orf41gene expression was knocked out.
The invention proves that the C22orf41gene is highly expressed in the cancerated tissue of the pancreatic cancer and can be used as a pancreatic cancer detection index and a molecular target of targeted therapy. The invention provides a powerful molecular biology tool for the auxiliary diagnosis of pancreatic cancer, and has profound clinical significance and important popularization and application prospects.
Therefore, the invention provides an application of the tumor biomarker C22orf41 as a pancreatic cancer-related tumor marker. The tumor marker C22orf41 was highly expressed in pancreatic cancer.
The invention also provides application of the tumor marker C22orf41 in preparation of a kit for auxiliary diagnosis, therapeutic effect prediction and prognosis judgment of pancreatic cancer.
A kit for detecting a tumor biomarker C22orf41, which comprises a probe or primer for specifically amplifying C22orf41mRNA, or an antibody specifically binding to C22orf 41. The method adopts quantitative PCR, gene chip or immunology method to detect the expression of C22orf41gene, and the primer for specific amplification of C22orf41mRNA is shown in SEQ ID NO.1 and SEQ ID NO. 2. The reagent kit also comprises an internal reference specific primer, wherein the internal reference specific primer is a GAPDH RNA primer, the sequence of an upstream primer is shown as SEQ ID NO.3, and the sequence of a downstream primer of GAPDH is shown as SEQ ID NO. 4. The kit can further comprise reagents for extracting total RNA, such as Trizol reagent, chloroform, isopropanol and DEPC water, and the kit can further comprise a real-time fluorescence quantitative SYBR dye.
The kit may further comprise reagents for reverse transcription of total RNA into cDNA. Reagents for reverse transcription of Total RNA into cDNA also include commercially available reverse transcription reagent cassettes such as the promega reverse transcription kit (GoScript reverse Transcriptase, A5003) including GoScript 5X Reaction Buffer, MgCl2, PCR Nucleotide Mix, Recombinant viral Inhibitor, GoScript reverse Transcriptase, nucleic-Free Water.
The kit may be a kit for quantitative detection by immunological methods, which detects the expression level of C22orf41 by detecting the expression product of C22orf41, including an antibody specifically binding to C22orf 41. The expression level of C22orf41 is detected by an immunological method, for example, at least one of immunoblotting, immunohistochemistry, and enzyme-linked immunosorbent assay, for example, a kit for detection by immunoblotting (Western Blot) comprising reagents related to the immunoblotting (Western Blot). Further, reagents for extracting total protein from cells may be included, including, for example, RIPA lysate, protease inhibitors, or antibodies that specifically bind C22orf 41.
The invention also provides application of the tumor marker C22orf41 as a pancreatic cancer drug target.
The invention provides a medicament for inhibiting pancreatic cancer cell proliferation, which comprises a C22orf41gene expression inhibitor, wherein the inhibitor is selected from antisense nucleic acid which takes C22orf41 protein or a transcript thereof as a target sequence and can inhibit protein expression or gene transcription of the antisense nucleic acid; or a construct capable of expressing or forming the antisense nucleic acid.
Preferably, the inhibitor is shRNA molecule, and the coding sequence of the shRNA molecule is shown as SEQ ID NO.11 and SEQ ID NO. 12; SEQ ID NO.13 and SEQ ID NO. 14; and/or one or more of SEQ ID NO.15 and SEQ ID NO. 16.
Preferably, the inhibitor is shRNA molecule, and the coding sequence of the shRNA molecule is shown as SEQ ID NO.15 and SEQ ID NO. 16.
The present invention also provides a pharmaceutical composition comprising an inhibitor of C22orf41gene expression as an active ingredient, and a pharmaceutically acceptable carrier.
The invention has the following beneficial effects:
the invention discloses a pancreatic cancer related tumor marker C22orf41 and confirms that C22orf41gene is highly expressed in pancreatic cancer cancerated tissue cells and can be used as a pancreatic cancer detection index and a molecular target for targeted therapy. The invention provides a powerful molecular biological tool for the auxiliary diagnosis of pancreatic cancer, and the pancreatic cancer related tumor marker C22orf41 has potential values as a diagnosis, detection, prognosis evaluation and treatment target point, and has profound clinical significance and important popularization and application prospects.
Drawings
FIG. 1 shows PCR-verified high expression of C22orf41 in pancreatic cancer tissues;
FIG. 2 shows PCR detection of shRNA silencing C22orf41 gene;
FIG. 3 is a graph of the effect of C22orf41 on cell proliferation; proliferation experiments show that C22orf41 knockdown (C22orf41-shRNA) can inhibit cell proliferation; b: proliferation experiments showed that increased expression of C22orf41 (C22orf41-plasmid) promoted cell proliferation.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the reagents used are commercially available.
The experimental procedures, for which specific conditions are not indicated in the examples, are generally conventional in the art, e.g. according to conventional conditions such as those described in Sambrook et al, molecular cloning, A laboratory Manual (third edition) (scientific Press, 2002), or according to conditions recommended by the reagent manufacturers.
Example 1 screening of genes related to survival analysis of pancreatic cancer based on TCGA database information
1. Clinical information screening
Clinical information of pancreatic cancer patients in the TCGA database was searched, and as of 12-10 days by 2015, a total of 185 clinical cases of pancreatic cancer were described in the TCGA database. These data were screened for a total of 160 patients to be included in the study. Patients with a history of other malignancies who had received radiotherapy or chemotherapy were excluded from the screening and included in the study with clinical information and mRNA data.
2. Survival study sample statistics
The statistics of survival time for 160 pancreatic cancer patients are shown in the following table:
TABLE 1160 statistics of survival time for pancreatic cancer patients
3. mRNA expression data survival analysis study protocol
(1) High-throughput mRNA transcriptome data retrieval, data download, and sample selection and classification for pancreatic cancer. The mRNA correlated with pancreatic cancer survival time was screened by bioinformatics analysis from the downloaded transcriptome data.
(2) A bioinformation network consisting of mRNAs is constructed by using Cytoscape software, and GO analysis and Pathway analysis are carried out on mRNA related to pancreatic cancer survival time in the bioinformation network by DAVID.
4. Survival analysis of pancreatic cancer mRNA expression data
After the transcriptome data of pancreatic cancer tissues was downloaded, read count 0 less than 20% of mrnas were removed for further analysis, including 17100 mrnas. mRNA gene expression quantity and pancreatic cancer TCGA database survival time data are extracted, a coxph function of a survivval package is adopted to complete the extraction, and 580 mRNAs with p values less than 0.05 in single-factor Cox regression are obtained through screening by single-factor Cox regression, wherein the mRNAs comprise 328 risk mRNAs and 252 protective mRNAs.
To better study the function of mRNA associated with survival, we performed GO function enrichment and KEGG pathway enrichment on mRNA associated with pancreatic cancer survival by golilla and GeneCodis software, with the screening criteria all being FDR < 0.05. The survival rate of the patients in the high expression group of the gene C22orf41 is obviously reduced, and the difference of the survival rate has statistical significance (HR >1 is risk mRNA).
Example 2 RT-PCR detection of Gene C22orf41 expression in pancreatic cancer and paracarcinoma tissues
1. Material
1.1 histopathological specimens
Tissue from 20 patients with pancreatic cancer, surgically removed and confirmed by pathological examination, and corresponding paracancerous tissue specimens were collected, the paracancerous tissue being defined as pancreatic tissue located 3cm from the tumor margin. Sampling was from patients diagnosed with pancreatic cancer and receiving surgical resection during the period from 10 months to 2016 months 12 in Beijing cooperative Hospital 2014. After pancreatic cancer tissues are surgically excised, pancreatic cancer and tissues beside the cancer are immediately taken out and put into liquid nitrogen under the guidance of a pathologist, numbered and then stored in a low-temperature refrigerator at minus 80 ℃.
1.2 inclusion criteria are as follows:
(1) cases receiving surgical resection;
(2) post-operative pathology was confirmed as pancreatic cancer with corresponding para-cancerous tissue defined as pancreatic tissue 3cm beyond the tumor margin.
(3) The patients do not receive the new adjuvant therapy before the operation.
2. Test method
2.1 RNA extraction of tissue samples
RNA extraction is respectively carried out on pancreatic cancer tissues and corresponding tissues beside cancer according to the serial numbers, the pancreatic cancer tissues and the corresponding tissues beside cancer of each patient are compiled into a group, the pancreatic cancer tissues are used as experimental samples, the corresponding tissues beside cancer are used as control samples, and 20 patients are compiled into 20 groups.
By using
Reagent (invitrogen, cat # 15596-:
collecting a sample, freezing the sample in liquid nitrogen, taking out the sample, putting the tissue sample into a precooled mortar for grinding, and after the tissue sample is powdery:
(1) adding 1ml of tirizol, and storing for 5 minutes at room temperature;
(2) adding 0.2mL of chloroform, forcibly oscillating the centrifuge tube, fully and uniformly mixing, and standing for 5-10 minutes at room temperature;
(3) after centrifugation at 12000rpm for 15 minutes, the upper aqueous phase was aspirated (70% aspiration) into another new centrifuge tube, taking care not to aspirate protein material between the two aqueous phases. Moving into a new tube, adding equal volume of pre-cooled isopropanol at-20 ℃, fully reversing and uniformly mixing, and placing on ice for 10 minutes;
(4) centrifuging at 12000rpm for 15 min, carefully discarding supernatant, adding 75% DEPC ethanol washing paint precipitate (stored at 4 deg.C) according to the proportion of 1mL/mL Trizol, shaking and mixing, centrifuging at 12000rpm at 4 deg.C for 5 min;
(5) discarding the ethanol liquid, standing at room temperature for 5min to sufficiently air-dry the precipitate, and adding DEPC treated water to dissolve the precipitate;
(6) the RNA purity and concentration were measured with a Nanodrop2000 ultraviolet spectrophotometer and stored frozen at-80 ℃. RNA quality determination criteria: the OD260/OD280 value of the RNA sample is between 1.7 and 2.2; the total RNA electrophoresis pattern has clear 28S and 18S bands; the electrophoretogram spectrum after the water bath heat preservation for 1 hour at 70 ℃ has no obvious difference with the spectrum before the water bath heat preservation.
2.2 Mass analysis of RNA samples
The quality of the extracted RNA sample can be preliminarily judged whether to be qualified or not from the electrophoresis result after the RNA extraction, and whether the RNA sample can be used for further transcriptome analysis or not can be judged. And further detecting the extraction condition of the RNA sample by a NanoDrop1000 spectrophotometer, wherein the sample for RNA-seq sequencing requires: OD260/OD280 was 1.8-2.2.
2.3 Synthesis of cDNA by reverse transcription
By using
III Reverse transcription of cDNA by Reverse transcription of Transcriptase (Invitrogen, cat # 18080-044), the experimental procedures were performed according to the product instructions, and the specific procedures were as follows:
using a reverse transcription kit, cDNA was synthesized by reverse transcription of l. mu.g of total RNA with reverse transcription buffer. Using a 25. mu.L reaction system, 1. mu.g of total RNA was taken for each sample as template RNA. The obtained cDNA was stored in a refrigerator at-20 ℃ for further use.
2.4 Real-Time PCR
(1) ABI 7500 type fluorescent quantitative PCR instrument for primer design, adopting
The method carries out relative quantitative analysis of data.
In-line primer design software was used, the gene sequence was referenced to NM-001123225.2 and GAPDH was internally referenced, and the primers were synthesized by Invitrogen. The specific primer sequences are shown in table 2:
TABLE 2 primer sequences
(2) Reaction system: by using
Green PCR MasterMix (invitrogen, cat # 4367659) was amplified and the experimental procedures were performed according to the product instructions. The amplification procedure was: pre-denaturation at 95 ℃ for 5min, (denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 45sec, extension at 72 ℃ for 35sec) x 40 cycles.
(3) Sample RealTime-PCR detection
SYBR Green is used as a fluorescent marker, PCR reaction is carried out on an ABI 7500 type fluorescent quantitative PCR instrument, a target band is determined through melting curve analysis and electrophoresis, and the method adopts
The method performs relative quantitative analysis of the data.
3. Data processing and experimental results
The inflection point of the real-time quantitative PCR amplification curve is clear, the overall parallelism of the amplification curve is good, the amplification efficiency of each reaction tube is similar, the limit is flat without raising, the slope of the exponential phase of the curve is larger, and the amplification efficiency is higher; the dissolution curves of the sample amplification products are all unimodal, which indicates that only one amplification product is specifically amplified; according to the relative quantitative formula of qRT-PCR: 2-ΔΔCtX 100%, the expression levels of the genes in pancreatic cancer tissue and paracancerous tissue were compared.
Statistical significance differences were defined as P <0.05 using statistical software SPSS 17.0. The Mann-Whitney U test was used to compare the difference in gene expression in pancreatic cancer tissues versus paracancerous normal pancreatic tissues. The overall expression level in pancreatic cancer tissues is higher than that in paracarcinoma tissues (as shown in figure 1), and p is less than 0.001, so that the pancreatic cancer auxiliary diagnosis value is possibly good.
Example 3 Effect of silencing C22orf41 expression on pancreatic cancer cell proliferation
1. Design of shRNA sequences
Aiming at a target gene sequence, a plurality of RNA interference target sequences are designed by utilizing an RNA interference sequence design principle provided in a Pubmed website, evaluation and determination are carried out according to related design experience and design software, 3 siRNA interfering the target sequences are provided, and simultaneously, a recognized scramble sequence in RNAi design is selected as a reference, and the sequence is shown in a table 3: the scramble sequence is shown as SEQ ID NO.5, the target sequence of the interference 1 is shown as SEQ ID NO.6, the target sequence of the interference 2 is shown as SEQ ID NO.7, and the target sequence of the interference 3 is shown as SEQ ID NO. 8. According to the characteristics of the pLKO.1-TRC cloning vector, a DNA sequence of the siRNA and a corresponding complementary sequence thereof are connected by a loop sequence to form a sense strand and an antisense strand, linker sequences are introduced at two ends, and shRNA is formed by annealing, wherein the specific sequences are shown in Table 4. The sequence was synthesized by Chiman Biotech, Inc. in Shanghai. TABLE 3 siRNA sequences
| Name (R) | NO. | Target sequence |
| NC | SEQ ID NO.5 | |
| Interference | ||
| 1 | SEQ ID NO.6 | |
| Interference | ||
| 2 | SEQ ID NO.7 | |
| Interference | ||
| 3 | SEQ ID NO.8 | CACTGTACTTGTTTCTTAATAAA |
TABLE 4 shRNA sequences
2. Construction of RNAi lentivirus recombinant plasmids
And (3) carrying out enzyme digestion on the pGMLV-SC5RNAi lentiviral vector by using BamHI and EcoRI double enzymes at 37 ℃ for 0.5-1h, carrying out agarose gel electrophoresis on the product of enzyme digestion, cutting gel, recovering a purified vector, and carrying out electrophoresis detection on the target fragment of the recovered vector. And (3) incubating the recovered vector and the shRNA sequence formed by annealing in a water bath at 25 ℃ for 30 min for connection, converting the connection product into DH5 alpha competent bacteria, selecting positive clone bacteria, and carrying out bacterial liquid sequencing identification after bacteria shaking.
3. Interference plasmid transfected pancreatic cancer BxPC-3 cell
BxPC-3 cells (human pancreatic cancer cells BxPC-3 are purchased from a national experimental cell resource sharing service platform) are placed in a 12-hole cell culture plate for culture, the cells are inoculated into a 6cm culture dish at a proper cell density 24 hours before transfection, and the cells are transfected when the cell fusion degree reaches 90%; selecting the optimal concentration of the puromycin by using untransfected pancreatic cancer cells BxPC-3, inoculating the pancreatic cancer cells into a 24-well plate, when the cell density of the next day reaches 50-70%, replacing a culture medium, adding puromycin with the concentration of 0.5 mu g/ml, 1 mu g/ml, 1.5 mu g/ml, 2 mu g/ml, 2.5 mu g/ml and 3 mu g/ml respectively, starting screening, and determining the lowest concentration of all cell deaths within 10-14 days as the optimal screening concentration. The screening result confirms that the optimal dosage concentration of BxPC-3 is 2 mu g/ml.
The sequencing result shows that the successfully constructed positive clone bacteria are subjected to mass extraction of plasmids by a large amount of shake bacteria according to a plasmid extraction kit, and the extracted plasmids are subjected to mass extractionDissolving 8 μ g of the plasmid in 500 μ l of opti-MEM reduced serum culture medium, dissolving 20 μ l of liposome (lipofectamine 2000) in 500 μ l of opti-MEM reduced serum culture medium, adding the plasmid mixture into the liposome mixture, mixing well, and standing at room temperature for 20 min; the serum-free medium replaced before transfection was discarded, and the plasmid-liposome mixture was added dropwise to each well at 37 ℃ with 5% CO2The cultivation was continued for 6 hours in the incubator, and the complete medium containing the purotoxin (concentration 2. mu.g/ml) was replaced and the cultivation was continued for 48 hours, and the transfection level was observed under a fluorescent microscope.
4. Application of ReaL-time PCR method to detection of transcription level of C22orf41 in BxPC-3 of pancreatic cancer cells before and after transfection
Extracting total RNA of pancreatic cancer BxPC-3 cells before and after transfection by using an RNA small-amount extraction kit (AXYGEN), carrying out reverse transcription on the obtained RNA into cDNA by ReverTraace qPCR RT Master Mix with gDNA Remover, respectively adding a C22orf41 primer and a primer of an internal reference gene GAPDH after 2-fold dilution, amplifying a gene C22orf41 by adopting SYBR Green I fluorescent quantitative PCR (ABI 7300), and carrying out 3 times of repeated reactions on each sample. The result shows that the transfected 3C 22orf41-shRNA groups play a certain inhibition role in C22orf41 expression in pancreatic cancer cells, the inhibition rate of C22orf41-shRNA1 is 45%, the inhibition rate of C22orf41-shRNA2 is 58%, the inhibition effect of C22orf41-shRNA3 is most obvious, and the inhibition rate reaches 76%.
5. Effect of C22orf41 on pancreatic cancer cell proliferation
Interfering pancreatic cancer cells BxPC-3 by using C22orf41-shRNA3 to establish a C22orf41-shRNA cell strain with C22orf41 knockdown expression, wherein a Control experiment group is a normal group (the BxPC-3 cell strain without transfection) and a Control group with idling equal amount of lentiviral particles; meanwhile, a C22orf41 plasmid is synthesized to be inoculated with lentivirus to transfect BxPC-3 cells (the method refers to the construction of Yuanyue. TRADD gene overexpression lentivirus and the experimental research on selective inhibition of hypertrophic scar fibroblasts [ D ]. third university of medical research, 2012.), a C22orf41 overexpression C22orf41-plasmid cell strain is established, and a control experimental group is a normal group (BxPC-3 cell strain which is not transfected) and a Vector group of idle and equally-inoculated lentiviral particles with empty plasmids; the cell proliferation rate was measured by the CCK-8 method, the absorbance of OD450nm was measured at 24h, 48h, 72h and 96h using a microplate reader (Bio-Rad, USA), 10ul of CCK-8 reagent (Beyotime, product No. C0038) was added to each well before each time point measurement, and the cells were returned to the cell incubator for further incubation for 2 hours. The result shows that the pancreatic cancer cells BxPC-3 can obviously inhibit the proliferation of pancreatic cancer after knocking down C22ofr41, as shown in figure 3.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Beijing coordination hospital of Chinese academy of medical sciences
Application of <120> C22orf41 as pancreatic cancer tumor marker
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gagcggcctt gttcctcaag 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtcataggcc atccaggtcg 20
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggagcgagat ccctccaaaa t 21
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggctgttgtc atacttctca tgg 23
<210> 5
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ttctccgaac gtgtcacgt 19
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gacttggaaa agctattaga aga 23
<210> 7
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tagaagagat ggagaaaatc tca 23
<210> 8
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
cactgtactt gtttcttaat aaa 23
<210> 9
<211> 60
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gatctgttct ccgaacgtgt cacgtttcaa gagaacgtga cacgttcgga gaattttttc 60
<210> 10
<211> 60
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
aattgaaaaa attctccgaa cgtgtcacgt tctcttgaaa cgtgacacgt tcggagaaca 60
<210> 11
<211> 67
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gatccgactt ggaaaagcta ttagaagatt caagagatct tctaatagct tttccaagtc 60
ttttttg 67
<210> 12
<211> 67
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
aattcaaaaa agacttggaa aagctattag aagatctctt gaatcttcta atagcttttc 60
caagtcg 67
<210> 13
<211> 67
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gatcctagaa gagatggaga aaatctcatt caagagatga gattttctcc atctcttcta 60
ttttttg 67
<210> 14
<211> 67
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
aattcaaaaa atagaagaga tggagaaaat ctcatctctt gaatgagatt ttctccatct 60
cttctag 67
<210> 15
<211> 67
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
gatcccactg tacttgtttc ttaataaatt caagagattt attaagaaac aagtacagtg 60
ttttttg 67
<210> 16
<211> 67
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
aattcaaaaa acactgtact tgtttcttaa taaatctctt gaatttatta agaaacaagt 60
acagtgg 67
Claims (4)
1. The tumor marker C22orf41 is applied to preparation of a kit for auxiliary diagnosis, curative effect prediction and prognosis judgment of pancreatic cancer.
2. Use of the tumor marker C22orf41 for the preparation of a medicament for inhibiting pancreatic cancer cell proliferation, wherein the medicament comprises an inhibitor of C22orf41gene expression, the inhibitor being selected from antisense nucleic acids that target C22orf41 protein or its transcript and are capable of inhibiting its protein expression or gene transcription; or a construct capable of expressing or forming the antisense nucleic acid.
3. The use of claim 2, wherein the inhibitor is an shRNA molecule encoding a nucleic acid sequence as set forth in SEQ ID No.11 and SEQ ID No. 12; SEQ ID NO.13 and SEQ ID NO. 14; and/or one or more of SEQ ID NO.15 and SEQ ID NO. 16.
4. The use of claim 3, wherein the inhibitor is an shRNA molecule having the coding sequence shown in SEQ ID No.15 and SEQ ID No. 16.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810710524.8A CN108841955B (en) | 2018-07-02 | 2018-07-02 | Application of C22orf41 as pancreatic cancer tumor marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810710524.8A CN108841955B (en) | 2018-07-02 | 2018-07-02 | Application of C22orf41 as pancreatic cancer tumor marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108841955A CN108841955A (en) | 2018-11-20 |
| CN108841955B true CN108841955B (en) | 2021-03-05 |
Family
ID=64200129
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810710524.8A Active CN108841955B (en) | 2018-07-02 | 2018-07-02 | Application of C22orf41 as pancreatic cancer tumor marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108841955B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109913548A (en) * | 2019-03-05 | 2019-06-21 | 中国医学科学院北京协和医院 | Application of the PCSK2 in the product that preparation is detected and treated for Pancreatic Neuroendocrine Tumors |
| CN109762904A (en) * | 2019-03-05 | 2019-05-17 | 中国医学科学院北京协和医院 | Molecular marked compound relevant to Pancreatic Neuroendocrine Tumors and its application |
| CN111304250A (en) * | 2020-02-28 | 2020-06-19 | 中国人民解放军总医院第三医学中心 | Screening method of pancreatic cancer tumorigenic gene and application of screened gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148556A (en) * | 2016-09-14 | 2016-11-23 | 北京致成生物医学科技有限公司 | Application in prostate cancer diagnosis mark for the C22orf41 |
| CN107130028A (en) * | 2017-05-15 | 2017-09-05 | 新疆医科大学第四附属医院 | Applications of the SYCE3 in diagnosis of colorectal carcinoma and treatment effectiveness evaluation |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140329704A1 (en) * | 2013-03-28 | 2014-11-06 | President And Fellows Of Harvard College | Markers for mature beta-cells and methods of using the same |
-
2018
- 2018-07-02 CN CN201810710524.8A patent/CN108841955B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148556A (en) * | 2016-09-14 | 2016-11-23 | 北京致成生物医学科技有限公司 | Application in prostate cancer diagnosis mark for the C22orf41 |
| CN107130028A (en) * | 2017-05-15 | 2017-09-05 | 新疆医科大学第四附属医院 | Applications of the SYCE3 in diagnosis of colorectal carcinoma and treatment effectiveness evaluation |
Non-Patent Citations (3)
| Title |
|---|
| Homo sapiens synaptonemal complex central element protein 3 (SYCE3), mRNA;Schramm S等;《Genbank database》;20170626;Accession ID NO. NM_001123225 * |
| protein markers of synaptic behavior and chromatin remodeling of the neo-XY body in phyllostomid bats;Rahn Monica L等;《chromosoma》;20160930;第125卷(第4期);第701-708页 * |
| 肿瘤相关分子网络的生物信息学挖掘;曾庆堂;《万方》;20160330;http://d.wanfangdata.com.cn/thesis/Y2877469 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108841955A (en) | 2018-11-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111778338B (en) | Application of circular RNA biomarker | |
| CN107881241B (en) | Application of gene marker in diagnosis and treatment of breast cancer | |
| CN108841955B (en) | Application of C22orf41 as pancreatic cancer tumor marker | |
| CN106701900B (en) | Long-chain non-coding RNA HERC2P3 gene and application thereof in gastric cancer | |
| CN114921551B (en) | Application of human Circ-FIRE in esophageal squamous carcinoma and kit | |
| CN108220446B (en) | Application of LINC01356 as molecular marker in gastric cancer | |
| CN110317878B (en) | Long-chain non-coding RNA for diagnosis and treatment monitoring of bladder cancer and application thereof | |
| Chen et al. | The elevated circ_0067835 could accelerate cell proliferation and metastasis via miR-1236-3p/Twist2 axis in hepatocellular carcinoma | |
| CN109371130B (en) | Application of RIPOR3 in preparation of biological products for breast cancer detection and treatment | |
| CN108192977B (en) | Molecular marker related to occurrence and development of gastric cancer | |
| CN106729756B (en) | Application of biomarker as target in diagnosis and treatment of lung adenocarcinoma | |
| CN112641797B (en) | Target and diagnostic marker for inhibiting colorectal cancer growth and metastasis and application thereof | |
| CN111172161B (en) | Long non-coding RNA and application thereof in diagnosis/treatment of preeclampsia | |
| CN111088357B (en) | Tumor marker for ESCC and application thereof | |
| CN110468134B (en) | tRF related to NSCLC and application thereof | |
| CN110577952B (en) | Application of siRNA interfering long non-coding RNA in preparation of medicine for treating breast cancer | |
| CN107184983B (en) | Diagnosis and treatment target for lung adenocarcinoma | |
| CN112501304A (en) | Application of miRNA-424 as pituitary tumor diagnosis marker | |
| CN111534587A (en) | Molecular marker 5-tRF-His, breast cancer detection kit and application thereof | |
| CN106924758B (en) | Biomarker for multiple myeloma | |
| CN113403306A (en) | lncRNA molecule and application thereof | |
| CN111635941A (en) | Detection kit for SDPR gene expression and/or SDPR gene methylation level and application | |
| CN111763735B (en) | Tumor differential expression gene and application thereof | |
| CN111808954B (en) | lncRNA and application thereof in diseases | |
| CN111518904B (en) | Reagent for detecting and targeting CTD-3060P21.1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |