CN108841955A - Application of the C22orf41 as Pancreatic Cancer Tumor Markers object - Google Patents
Application of the C22orf41 as Pancreatic Cancer Tumor Markers object Download PDFInfo
- Publication number
- CN108841955A CN108841955A CN201810710524.8A CN201810710524A CN108841955A CN 108841955 A CN108841955 A CN 108841955A CN 201810710524 A CN201810710524 A CN 201810710524A CN 108841955 A CN108841955 A CN 108841955A
- Authority
- CN
- China
- Prior art keywords
- c22orf41
- cancer
- pancreas
- seq
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Cell Biology (AREA)
- Hospice & Palliative Care (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Oncology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Physics & Mathematics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Food Science & Technology (AREA)
- Zoology (AREA)
- Animal Behavior & Ethology (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of relevant tumor marker C22orf41 of cancer of pancreas, and confirm the high expression in the histocyte of cancer of pancreas canceration of C22orf41 gene.The present invention also provides application of the kit of the expression for detecting C22orf41 in cancer of pancreas checkout and diagnosis or prognosis.The present invention inhibits Cell Proliferation of Pancreatic Cancer Cell using RNAi technology interference C22orf41 gene, it was confirmed that C22orf41 can be used as the molecular target of targeted therapy, and provide a kind of drug and pharmaceutical composition for inhibiting Cell Proliferation of Pancreatic Cancer Cell.Cancer of pancreas related neoplasms marker C22orf41 of the present invention has the potential value as diagnosis detection, prognosis evaluation and therapy target, there is far-reaching clinical meaning and important popularization and application foreground.
Description
Technical field
The present invention relates to genetic engineering fields, and in particular to application of the C22orf41 as Pancreatic Cancer Tumor Markers object.
Background technique
Cancer of pancreas is one of cancer most fatal in the world, and survival rate is lower than 5% within 5 years.Cause cancer of pancreas prognosis poor
Reason is mainly cancer of pancreas incidence of occult, and diagnosis lag, DISTANT METASTASES IN lacks effective medicine compared with early, local challenge is strong
Object.Currently, operation excision is considered as uniquely determining effective treatment method.Mostly with transfer, hand when due to cancer of pancreas discovery
Art radical cure cannot achieve in most cases.Up to the present, about only 20% Pancreas cancer patients can be eradicated
Property excision, even if in these patients, it is still very low due to shifting or recurring its 5 years survival rates in early days.It is presently available for diagnosing
The method of Symptomatic cancer of pancreas is mainly iconography：CT Scan (CT), endoscopic ultrasonic (EUS), scope subinverse
Row cholangiopancreatography (ERCP), but early diagnose still very difficult.The cancer of pancreas non-invasive diagnosis method of hypersensitivity and specificity
A possibility that being expected to improve cancer of pancreas early diagnostic rate and prognosis survival rate, improving operation excision, reduces pancreas mortality of carcinoma.
Summary of the invention
In order to realize the early diagnosis of cancer of pancreas, raising prognosis survival rate reduces the death rate, it is an object of the invention to
The application of a kind of new cancer of pancreas related neoplasms marker and the tumor marker is provided.The tumor marker is
C22orf41.C22orf41 is expected to the marker as diagnosis of pancreatic cancer and Index for diagnosis, while providing for the treatment of cancer of pancreas
New target spot.
The Cancer Genome Atlas (TCGA) database contains the data of a variety of levels of kinds of tumors type
Information, including：MiRNA, mRNA, protein spectrum, the spectrum of mutation, clinical diagnosis information etc..These data are that the analysis of tumour data mentions
Resource abundant is supplied.Therefore, the present inventor is first by TCGA database to C22orf41 gene and cancer of pancreas
Correlation is analyzed.
C22orf41 gene of the invention is known before making the present invention, and essential information is as follows：
Genbank accession number：C22orf41GeneID:644186, derive from human genome.
C22orf41 (also known as SYCE3, synaptonemal complex central elementprotein 3, weight
Group people's synaptonemal complex center element albumen 3), it is a protein coding gene.Synaptonemal complex is the idol of meiosis I
Line is interim, a kind of composite construction formed between two homologues of pairing, and SYCE3 albumen is starting homologue
Between cynapse it is essential, the pairing with chromosome is exchanged and is separated and is closely related.
The inventors of the present invention discovered through researches that C22orf41 high expression in pancreatic cancer samples, expression and patient are not
There are significant correlations for good survival region, and striking low C22orf41 has apparent inhibiting effect for pancreatic cancer cell growth, prompt
C22orf41 may be particularly significant during the occurrence and development of cancer of pancreas.C22orf41 can be used for preparing cancer of pancreas auxiliary and examine
Disconnected, outcome prediction and Index for diagnosis preparation can be also used for preparation auxiliary diagnosis, outcome prediction and Index for diagnosis kit, very
To can be used as emerging therapeutic target spot, it is used to prepare the drug for the treatment of cancer of pancreas.
The kit is real-time fluorescence quantitative PCR detection kit and immunological detecting kit.Real time fluorescent quantitative
Specific primer described in PCR detection kit is suitable for the detection of SYBR Green.In addition, further including standard DNA in kit
Template and PCR reaction system, the PCR reaction solution in PCR reaction system is real-time fluorescence quantitative PCR reaction solution, and is further wrapped
Containing fluorescent dye.The real-time fluorescence quantitative PCR reaction solution includes dNTP, Mg2+, Taq enzyme and buffer, the fluorescent dye
For SYBR Green, Taq enzyme is thermal starting enzyme.C22orf41 antibody used in immunological detecting kit is suitable for immunohistochemistry
Detection.Kit includes standard slice positive control and immunohistochemistry detection related reagent.
The cancer of pancreas C22orf41 checkout and diagnosis kit purposes includes：C22orf41 gene is detected subject's
Measure the expression in cell, that is, pancreatic cancer cell；Described value is compared with reference value, C22orf41 gene obviously simultaneously above
Reference value shows subject with cancer of pancreas.The reference value level is C22orf41 gene in normal cell i.e. normal person's pancreas
Expression in glandular tissue cell, the normal cell is with the same strain of measurement cell and without canceration.The measurement cell is
Know or under a cloud comprising tumour cell.
In order to verify the validity on targeted therapy of invention, the present invention verifies by the following method：It is sick slowly to construct RNAi
Malicious recombinant plasmid, transfection pancreatic cancer cell BxPC-3 strikes low C22orf41 gene expression, and establishes the pancreas of C22orf41 overexpression
Adenocarcinoma cell strain detects different groups of cell proliferative conditions.Cell Proliferation is bright when C22orf41 gene expression is knocked as the result is shown
It is aobvious to be suppressed.
The high expression in the tissue of cancer of pancreas canceration that present invention demonstrates C22orf41 genes, can be used as cancer of pancreas detection
The molecular target of index and targeted therapy.The present invention provides strong molecular biology for the auxiliary diagnosis of cancer of pancreas
Tool has far-reaching clinical meaning and important popularization and application foreground.
Therefore, the present invention provides a kind of tumor biomarker C22orf41 as cancer of pancreas related neoplasms marker
Application.The tumor marker C22orf41 high expression in cancer of pancreas.
The present invention also provides the tumor marker C22orf41 in preparation cancer of pancreas auxiliary diagnosis, outcome prediction
And the application in Index for diagnosis kit.
A kind of tumor biomarker C22orf41 detection kit, the spy including specific amplification C22orf41mRNA
Needle or primer, or the antibody of specific binding C22orf41.It uses quantitative PCR, genetic chip or immunological method inspection
Survey the expression of C22orf41 gene, the primer of the specific amplification C22orf41mRNA such as SEQ ID NO:1 and SEQ ID
NO:Shown in 2.The kit further includes internal reference specific primer, and the internal reference specific primer is GAPDH RNA primer, on
The sequence of primer is swum as shown in SEQ ID NO.3, the sequence of the downstream primer of GAPDH is as shown in SEQ ID NO.4.The examination
Agent box can also further include extracted total RNA agents useful for same, for example, comprising Trizol reagent, chloroform, isopropanol,
Kit described in DEPC water may further include real time fluorescent quantitative SYBR dyestuff.
It is cDNA agents useful for same that the kit, which can also be further included total serum IgE reverse transcription,.Total serum IgE reverse transcription is
CDNA agents useful for same also selects commercially available Reverse Transcriptase kit, such as promega Reverse Transcriptase kit
(GoScriptTMReverse Transcriptase, A5003), including:GoScriptTM5X Reaction Buffer,
MgCl2、PCR Nucleotide Mix、Recombinant Ribonuclease Inhibitor、Go
ScriptTMReverse Transcriptase、Nuclease-Free Water。
The kit can be the kit that quantitative detection is carried out by immunological method, pass through detection
The expression of the expression product detection C22orf41 of C22orf41 comprising specifically bind the antibody of C22orf41.Pass through
The detection of at least one of immunological method, such as Western blot, Immunohistochemical Method and enzyme-linked immunosorbent assay
The expression of C22orf41, for example, the kit detected by Western blot (Western Blot), wherein including
Western blot (Western Blot) related reagent.It can also further be tried used in total protein comprising being extracted from cell
Agent either specifically binds the antibody of C22orf41 for example including RIPA lysate, protease inhibitors.
Application the present invention also provides tumor marker C22orf41 as pancreatic cancer drug target spot.
The present invention provides a kind of drug for inhibiting Cell Proliferation of Pancreatic Cancer Cell, the drug includes C22orf41 gene table
Up to inhibitor, the inhibitor, which is selected from, as target sequence and is able to suppress its albumen table using C22orf41 albumen or its transcript
It reaches or the antisense nucleic acid of genetic transcription；Or it can express or be formed the construction of the antisense nucleic acid.
Preferably, the inhibitor is a kind of shRNA molecule, coded sequence such as SEQ ID NO.11 and SEQ ID
NO.12；SEQ ID NO.13 and SEQ ID NO.14；And/or a pair or more in SEQ ID NO.15 and SEQ ID NO.16
To shown.
Preferably, the inhibitor is a kind of shRNA molecule, coded sequence such as SEQ ID NO.15 and SEQ ID
Shown in NO.16.
The present invention also provides a kind of pharmaceutical composition, described pharmaceutical composition includes C22orf41 gene expression inhibition
Agent is as active constituent and pharmaceutically acceptable carrier.
Beneficial effects of the present invention are as follows：
The invention discloses a kind of cancer of pancreas related neoplasms marker C22orf41 and confirm C22orf41 gene in pancreas
High expression, can be used as the molecular target of cancer of pancreas Testing index and targeted therapy in the histocyte of gland cancer canceration.The present invention
Strong biology tool, cancer of pancreas related neoplasms marker C22orf41 are provided for the auxiliary diagnosis of cancer of pancreas
With the potential value as diagnosis detection, prognosis evaluation and therapy target, there are far-reaching clinical meaning and important popularization to answer
Use prospect.
Detailed description of the invention
Fig. 1 is that PCR verifies C22orf41 high expression in Pancreatic Adenocarcinoma；
Fig. 2 is the case where PCR detects shRNA silencing C22orf41 gene；
Fig. 3 is the influence of C22orf41 cell proliferation；a:Proliferation experiment shows that C22orf41 strikes low (C22orf41-
ShRNA) proliferation capable of inhibiting cell；b：Proliferation experiment shows that C22orf41 expression is increased rear (C22orf41-plasmid) and can be promoted
Into cell Proliferation.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, implementing
The conventional means that technological means used in example is well known to those skilled in the art, reagent used commercially available can obtain
It arrives.
Test method without specific conditions in embodiment, usually conventional method in that art, such as according to normal conditions
Such as Sambrook et al., molecular cloning, the condition in laboratory manual (third edition) (Science Press, 2002), or according to
Condition proposed by reagent manufacturing firm.
Embodiment 1 screens related gene based on the survival analysis that TCGA database information carries out cancer of pancreas
1, clinical information screens
The Pancreas cancer patients clinical information in TCGA database is retrieved, by December 10th, 2015, in TCGA database
185 cancer of pancreas clinical cases are described in total.These data are screened, 160 patients is shared and is included in research.Screening
When exclude there are other malignant tumour medical histories, the patient that once received the patient of radiotherapy or chemotherapy, while being included in research need to contain and face
Bed information and mRNA data.
2, life cycle studies sample statistics
The statistical result of 160 Pancreas cancer patients life spans is as shown in the table:
1 160 Pancreas cancer patients life span statistics of table
3, mRNA expresses data survival analysis research approach
(1) to cancer of pancreas high throughput mRNA transcript profile data retrieval, data downloading and sample selection and classification.By downloading
Transcript profile data by bioinformatic analysis screening obtain mRNA relevant to cancer of pancreas life span.
(2) the biological information network being made of with Cytoscape software building mRNAs, by DAVID to biological information
MRNA relevant to cancer of pancreas life span carries out GO analysis and Pathway analysis in network.
4, cancer of pancreas mRNA expresses the survival analysis result of data
After the transcript profile data of Pancreatic Adenocarcinoma are downloaded, it is used as after removing mRNA of the read count=0 less than 20%
It analyzes in next step, including 17100 mRNA.MRNA gene expression amount and cancer of pancreas TCGA database lifetime data are extracted,
It is completed using the coxph function of survival packet, through single factor test Cox regression analysis, screening obtains p value in single factor test Cox recurrence
<0.05 mRNA has 580, including 328 risk mRNA and 252 protectiveness mRNA.
In order to preferably study the function of mRNA relevant to life span, we pass through GORILLA and GeneCodis
Software mRNA relevant to cancer of pancreas life span carries out the enrichment of GO function and closes the enrichment of KEGG access, and screening criteria is all FDR<
0.05.Wherein Gene C2 2orf41 high expression group patient's survival rate significantly reduces, and there are statistical significance (HR for survival rate difference>
1 is risk mRNA).
2 RT-PCR of embodiment detects the expression of Gene C2 2orf41 in cancer of pancreas and cancer beside organism
1, material
1.1 histopathology samples
It collects and surgically cuts off and by the 20 Pancreas cancer patients tissues made a definite diagnosis through pathological examination and corresponding cancer
Tissue specimen, cancer beside organism are defined as away from the pancreatic tissue other than borderline tumor 3cm.Sampling derives from BJ Union Hospital
In October, 2014 is to being diagnosed as cancer of pancreas during in December, 2016 and receive the patient of surgical resection.Operation excision pancreas
Cancer of pancreas and cancer beside organism is taken to be put into liquid nitrogen, -80 DEG C of low temperature of number postposition after cancerous tissue immediately under the guidance of Pathologis
Refrigerator saves.
1.2 to be included in standard as follows：
(1) receive the case of surgical resection；
(2) postoperative pathological is diagnosed as cancer of pancreas and has corresponding cancer beside organism, and cancer beside organism is defined as away from borderline tumor
Pancreatic tissue other than 3cm.
(3) patient did not received preoperative neoadjuvant treatment.
2, test method
2.1 pairs of tissue samples carry out RNA extraction
RNA extraction, the cancer of pancreas of every patient are carried out to Pancreatic Adenocarcinoma and corresponding cancer beside organism respectively according to number
It is one group that tissue and corresponding cancer beside organism, which compile, and Pancreatic Adenocarcinoma is as experiment sample, and corresponding cancer beside organism is as control sample
This, it is 20 groups that 20 patients, which compile,.
UsingReagent (invitrogen, article No. 15596-018) carries out RNA extraction to 20 groups of samples,
Experimental implementation is carried out by product description, and the concrete operations of every group of experiment are as follows：
It freezes to be put into the mortar being pre-chilled tissue samples after liquid nitrogen, taking-up after collection sample and be ground, to group
Sample is knitted at after powdered：
(1) addition 1mLTrizol, room temperature preservation 5 minutes；
(2) chlorination is imitated 0.2mL and is mixed well with forced oscillation centrifuge tube, is placed at room temperature for 5-10 minutes；
(3) upper strata aqueous phase (inhaling 70%) is drawn after 12000rpm high speed centrifugation 15 minutes into another new centrifuge tube pipe, note
Meaning not be drawn onto the protein substance between two layers of water phase.New pipe is moved into, the pre- cold isopropanol of isometric -20 DEG C is added, is sufficiently run
It mixes, is placed in 10 minutes on ice；
(4) supernatant is carefully discarded after 12000rpm high speed was from 15 minutes, is added in the ratio of 1mL/mL Trizol
75%DEPC ethyl alcohol washes paint precipitating (4 DEG C of preservations), washes paint sediment, oscillation mixes, and 12000rpm high speed centrifugation 5 divides at 4 DEG C
Clock；
(5) ethanol liquid is discarded, places 5 minutes at room temperature sufficiently to dry precipitating, the processed water dissolution of DEPC is added
Precipitating；
(6) it with Nanodrop2000 ultraviolet specrophotometer measurement RNA purity and concentration, freezes in -80 DEG C.RNA mass
Criterion：The OD260/OD280 value of RNA sample is between 1.7-2.2；Total serum IgE electrophorogram has clearly 28S, 18S item
Band；70 DEG C of water-baths keep the temperature 1 hour after electrophorogram and the map no significant difference before water-bath heat preservation.
The quality analysis of 2.2RNA sample
Agarose gel electrophoresis after RNA is extracted, the RNA sample that can be extracted from electrophoresis result with preliminary judgement are up-to-standard
Whether, if it can be used for further transcriptome analysis.And then RNA sample is detected by NanoDrop1000 spectrophotometer
The extraction situation of product, the sample requirement of RNA-seq sequencing：OD260/OD280 is 1.8-2.2.
2.3 reverse transcriptions synthesize cDNA
UsingIII Reverse Transcriptase (invitrogen, article No. 18080-044)
CDNA reverse transcription is carried out, experimental implementation is carried out by product description, and concrete operations are as follows：
Using Reverse Transcriptase kit, converse record is carried out to l μ g total serum IgE with RT Buffer and synthesizes cDNA.Using 25 μ L
Reaction system, each sample take 1 μ g total serum IgE as template ribonucleic acid.It is spare that -20 DEG C of refrigerators are put in the cDNA preservation of acquisition.
2.4 Real-Time PCR
(1) design of primers 7500 type fluorescence quantitative PCR instrument of ABI usesMethod carries out data relative quantification point
Analysis.
Using online primer-design software, gene order is referring to NM_001123225.2, interior participation in the election GAPDH, design of primers
It is synthesized afterwards by invitrogen company.Specific primer sequence is as shown in table 2：
2 primer sequence of table
(2) reaction system：WithGreen PCR MasterMix (invitrogen, article No.
4367659) it is expanded, experimental implementation is carried out by product description.Amplification program is：95 DEG C of initial denaturation 5min, (95 DEG C of changes
Property 15sec, 60 DEG C of annealing 45sec, 72 DEG C of extension 35sec) × 40 circulation.
(3) sample RealTime-PCR is detected
Using SYBR Green as fluorescent marker, PCR reaction is carried out on 7500 type fluorescence quantitative PCR instrument of ABI, is led to
It crosses melt curve analysis analysis and electrophoresis determines purpose band, useThe relative quantitative assay of method progress data.
3, data processing and experimental result
Real-time quantitative PCR amplification curve inflection point understands that amplification curve entirety collimation is good, shows the amplification of each reaction tube
Similar efficiency, the limit is flat and present without raising up, and exponent phase slope is larger, illustrates that amplification efficiency is higher；Sample amplified production
Solubility curve be all it is unimodal, illustrate that amplified production only has one, be specific amplification；It is public according to the relative quantification of qRT-PCR
Formula：2-ΔΔCt× 100%, expression of the icp gene in Pancreatic Adenocarcinoma and cancer beside organism.
Using statistics software SPSS 17.0, statistical significant difference is defined as P < 0.05.Using Mann-
The difference that Whitney U examines icp gene to be expressed by Pancreatic Adenocarcinoma and the cancer in normal pancreatic tissue.In Pancreatic Adenocarcinoma
In overall expression level be above cancer beside organism (as shown in Figure 1), p < 0.001, prompt may have good cancer of pancreas
Additive diagnostic value.
3 silencing C22orf41 of embodiment expresses the influence to Cell Proliferation of Pancreatic Cancer Cell
1, the design of shRNA sequence
For target gene target-gene sequence, using the RNA interference sequence design principle provided in the website Pubmed, if
Multiple RNA interfered target sequences are counted, assessment measurement, 3 RNA disturbance target points are carried out according to relevant design experience and design software
The siRNA of sequence, while generally acknowledged scramble sequence when RNAi being selected to design, as control, sequence is shown in Table 3：scramble
For sequence as shown in SEQ ID NO.5, the target sequence of disturbed one interferes 2 target sequence such as SEQ as shown in SEQ ID NO.6
Shown in ID NO.7, interfere 3 target sequence as shown in SEQ ID NO.8.It, will according to pLKO.1-TRC cloning vector characteristic
Its corresponding complementary series of the DNA sequence dna of siRNA connects to form positive-sense strand and antisense strand with loop sequence, and draws at both ends
Enter joint sequence, shRNA is formed by annealing, particular sequence is as shown in table 4.Sequence expires the limited public affairs of biotechnology by Shanghai Ji
Department's synthesis.3 siRNA sequence of table
| Title | NO. | Target sequence |
| NC | SEQ ID NO.5 | TTCTCCGAACGTGTCACGT |
| Disturbed one | SEQ ID NO.6 | GACTTGGAAAAGCTATTAGAAGA |
| Interference 2 | SEQ ID NO.7 | TAGAAGAGATGGAGAAAATCTCA |
| Interference 3 | SEQ ID NO.8 | CACTGTACTTGTTTCTTAATAAA |
4 shRNA sequence of table
2, the building of RNAi slow virus recombinant plasmid
Using the bis- enzyme digestion pGMLV-SC5RNAi slow virus carriers of BamHI and EcoRI, in 37 DEG C of digestion 0.5-1h, enzyme
After cutting product agarose gel electrophoresis, gel extraction cmy vector recycles the target fragment electrophoresis detection of carrier.Recycle carrier
30 min being incubated in the 25 DEG C of water-baths of shRNA sequence formed with annealing to be attached, connection product converts DH5 α competent bacteria,
Positive colony bacterium is selected, bacterium solution sequencing identification after bacterium is shaken.
3, interference plasmid transfects cancer of pancreas BxPC-3 cell
First BxPC-3 cell (human pancreatic cancer cell BxPC-3 is purchased from National Laboratory cellular resources sharing service platform) is set
It is cultivated in 12 porocyte culture plates, is inoculated into 6cm culture dish with suitable cell density before transfection, is reached to cell for 24 hours
It is transfected again when 90% degrees of fusion；With the pancreatic cancer cell BxPC-3 without transfection to puro optimum allowable concentration
It is screened, pancreatic cancer cell is inoculated in 24 orifice plates, when next day cell density is up to 50%~70%, replacement culture medium is simultaneously
It is respectively 0.5 μ g/ml that concentration, which is added, 1 μ g/ml, 1.5 μ g/ml, and 2 μ g/ml, 2.5 μ g/ml, the puro of 3 μ g/ml start
Screening is set to best screening concentration with the whole dead minimum concentrations of 10~14 days inner cells.The selection result determines BxPC-3
Optimum allowable concentration is 2 μ g/ml.
Sequencing result display is constructed into successful positive colony bacterium, bacterium is largely shaken by plasmid extraction kit and carries out plasmid
Middle amount is extracted, and is taken 8 μ g to be dissolved in 500 μ l opti-MEM the plasmid of extraction and is subtracted in blood serum medium, separately take 20 μ l liposomes
(lipofectimane2000) it is dissolved in 500 μ l opti-MEM to subtract in blood serum medium, plasmid mixed liquor addition liposome is mixed
It closes and is mixed well in liquid, the underlying 20min of room temperature；The serum free medium replaced before abandoning transfection is inhaled, plasmid is mixed with liposome
Drop is added in each hole, 37 DEG C of 5%CO2Continue to cultivate 6h in incubator, replacement contains puro (concentration is 2 μ g/ml)
Complete medium continue culture to 48h, fluorescence microscopy microscopic observation transfection level.
4, the transcription of C22orf41 in the pancreatic cancer cell BxPC-3 of transfection front and back is detected using ReaL-time PCR method
It is horizontal
It is preceding total with the cancer of pancreas BxPC-3 cell after transfection that transfection is extracted using a small amount of extraction agent boxes of RNA (AXYGEN)
RNA, the RNA of acquisition are cDNA through ReverTraAce qPCR RT Master Mix with gDNA Remover reverse transcription, 2
After diluting again, it is separately added into the primer of C22orf41 primer and reference gene GAPDH, using SYBR Green I fluorescent quantitation
PCR (ABI 7300) amplification gene C22orf41, each sample do 3 repetitions.3 C22orf41- transfected as the result is shown
ShRNA group plays certain inhibiting effect to C22orf41 expression in pancreatic cancer cell, and C22orf41-shRNA1 inhibiting rate is
45%, C22orf41-shRNA2 inhibiting rate are that 58%, C22orf41-shRNA3 inhibitory effect is most obvious, and inhibiting rate is up to 76%.
5, influence of the C22orf41 to Cell Proliferation of Pancreatic Cancer Cell
C22orf41, which is established, using C22orf41-shRNA3 intervention pancreatic cancer cell BxPC-3 strikes low expression
C22orf41-shRNA cell strain, control experiment group is normal group (the BxPC-3 cell strain for not doing to transfect) and idle running equivalent is slow
The Control group of virion；Slow-virus transfection BxPC-3 cell (method reference is connect by synthesizing C22orf41 plasmid simultaneously
《The building of Yuan Yue .TRADD gene overexpression slow virus and its experiment to fibroblasts from hyperplastic scar selective depression
Research [D] Third Military Medical University, 2012.》), establish the C22orf41-plasmid cell strain of C22orf41 overexpression, control
Experimental group is normal group (the BxPC-3 cell strain for not doing to transfect) and the equivalent that dallies is connected to the lentiviral particle of empty plasmid
Vector group；Through CCK-8 method detect cell proliferation rate, respectively using microplate reader (Bio-Rad, the U.S.) detection inoculation for 24 hours,
The absorbance of OD450nm when 48h, 72h and 96h, before each time point detection, 10ul CCK-8 reagent is added in every hole
(Beyotime, product number C0038) puts back in cell incubator and continues to be incubated for 2 hours.The result shows that pancreatic cancer cell
BxPC-3 strikes the proliferation that cancer of pancreas can be significantly inhibited after low C22ofr41, as shown in Figure 3.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, belong to claimed model without departing from theon the basis of the spirit of the present invention
It encloses.
Sequence table
<110>Chinese Academy of Medical Sciences Beijing Union Medical College Hospital
<120>Application of the C22orf41 as Pancreatic Cancer Tumor Markers object
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gagcggcctt gttcctcaag 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gtcataggcc atccaggtcg 20
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ggagcgagat ccctccaaaa t 21
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
ggctgttgtc atacttctca tgg 23
<210> 5
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ttctccgaac gtgtcacgt 19
<210> 6
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
gacttggaaa agctattaga aga 23
<210> 7
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
tagaagagat ggagaaaatc tca 23
<210> 8
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
cactgtactt gtttcttaat aaa 23
<210> 9
<211> 60
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
gatctgttct ccgaacgtgt cacgtttcaa gagaacgtga cacgttcgga gaattttttc 60
<210> 10
<211> 60
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
aattgaaaaa attctccgaa cgtgtcacgt tctcttgaaa cgtgacacgt tcggagaaca 60
<210> 11
<211> 67
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
gatccgactt ggaaaagcta ttagaagatt caagagatct tctaatagct tttccaagtc 60
ttttttg 67
<210> 12
<211> 67
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
aattcaaaaa agacttggaa aagctattag aagatctctt gaatcttcta atagcttttc 60
caagtcg 67
<210> 13
<211> 67
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
gatcctagaa gagatggaga aaatctcatt caagagatga gattttctcc atctcttcta 60
ttttttg 67
<210> 14
<211> 67
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
aattcaaaaa atagaagaga tggagaaaat ctcatctctt gaatgagatt ttctccatct 60
cttctag 67
<210> 15
<211> 67
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
gatcccactg tacttgtttc ttaataaatt caagagattt attaagaaac aagtacagtg 60
ttttttg 67
<210> 16
<211> 67
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
aattcaaaaa acactgtact tgtttcttaa taaatctctt gaatttatta agaaacaagt 60
acagtgg 67
Claims (10)
1. a kind of application of tumor biomarker C22orf41 as cancer of pancreas related neoplasms marker.
2. application as shown in claim 1, which is characterized in that the tumor marker C22orf41 high table in cancer of pancreas
It reaches.
3. tumor marker C22orf41 as claimed in claim 1 or 2 is in preparation cancer of pancreas auxiliary diagnosis, outcome prediction and pre-
The application in kit is judged afterwards.
4. a kind of tumor biomarker C22orf41 detection kit, which is characterized in that the kit includes that specificity expands
Increase the probe or primer of C22orf41mRNA, or the antibody of specific binding C22orf41.
5. detection kit according to claim 4, which is characterized in that the primer such as SEQ ID NO:1 and SEQ ID
NO:Shown in 2.
6. application of the tumor marker C22orf41 as claimed in claim 1 or 2 as pancreatic cancer drug target spot.
7. a kind of drug for inhibiting Cell Proliferation of Pancreatic Cancer Cell, which is characterized in that the drug presses down comprising C22orf41 gene expression
Preparation, the inhibitor be selected from using C22orf41 albumen or its transcript as target sequence and be able to suppress its protein expression or
The antisense nucleic acid of genetic transcription；Or it can express or be formed the construction of the antisense nucleic acid.
8. drug as claimed in claim 7, which is characterized in that the inhibitor is a kind of shRNA molecule, and coded sequence is such as
SEQ ID NO.11 and SEQ ID NO.12；SEQ ID NO.13 and SEQ ID NO.14；And/or SEQ ID NO.15 and SEQ
It is one or more pairs of shown in ID NO.16.
9. drug as claimed in claim 7, which is characterized in that the inhibitor is a kind of shRNA molecule, and coded sequence is such as
Shown in SEQ ID NO.15 and SEQ ID NO.16.
10. a kind of pharmaceutical composition, which is characterized in that described pharmaceutical composition includes C22orf41 gene expression inhibitor conduct
Active constituent and pharmaceutically acceptable carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810710524.8A CN108841955B (en) | 2018-07-02 | 2018-07-02 | Application of C22orf41 as pancreatic cancer tumor marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810710524.8A CN108841955B (en) | 2018-07-02 | 2018-07-02 | Application of C22orf41 as pancreatic cancer tumor marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108841955A true CN108841955A (en) | 2018-11-20 |
| CN108841955B CN108841955B (en) | 2021-03-05 |
Family
ID=64200129
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810710524.8A Active CN108841955B (en) | 2018-07-02 | 2018-07-02 | Application of C22orf41 as pancreatic cancer tumor marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108841955B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762904A (en) * | 2019-03-05 | 2019-05-17 | 中国医学科学院北京协和医院 | Molecular marked compound relevant to Pancreatic Neuroendocrine Tumors and its application |
| CN109913548A (en) * | 2019-03-05 | 2019-06-21 | 中国医学科学院北京协和医院 | Application of the PCSK2 in the product that preparation is detected and treated for Pancreatic Neuroendocrine Tumors |
| CN111304250A (en) * | 2020-02-28 | 2020-06-19 | 中国人民解放军总医院第三医学中心 | Screening method of pancreatic cancer tumorigenic gene and application of screened gene |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140329704A1 (en) * | 2013-03-28 | 2014-11-06 | President And Fellows Of Harvard College | Markers for mature beta-cells and methods of using the same |
| CN106148556A (en) * | 2016-09-14 | 2016-11-23 | 北京致成生物医学科技有限公司 | Application in prostate cancer diagnosis mark for the C22orf41 |
| CN107130028A (en) * | 2017-05-15 | 2017-09-05 | 新疆医科大学第四附属医院 | Applications of the SYCE3 in diagnosis of colorectal carcinoma and treatment effectiveness evaluation |
-
2018
- 2018-07-02 CN CN201810710524.8A patent/CN108841955B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140329704A1 (en) * | 2013-03-28 | 2014-11-06 | President And Fellows Of Harvard College | Markers for mature beta-cells and methods of using the same |
| CN106148556A (en) * | 2016-09-14 | 2016-11-23 | 北京致成生物医学科技有限公司 | Application in prostate cancer diagnosis mark for the C22orf41 |
| CN107130028A (en) * | 2017-05-15 | 2017-09-05 | 新疆医科大学第四附属医院 | Applications of the SYCE3 in diagnosis of colorectal carcinoma and treatment effectiveness evaluation |
Non-Patent Citations (3)
| Title |
|---|
| RAHN MONICA L等: "protein markers of synaptic behavior and chromatin remodeling of the neo-XY body in phyllostomid bats", 《CHROMOSOMA》 * |
| SCHRAMM S等: "Homo sapiens synaptonemal complex central element protein 3 (SYCE3), mRNA", 《GENBANK DATABASE》 * |
| 曾庆堂: "肿瘤相关分子网络的生物信息学挖掘", 《万方》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762904A (en) * | 2019-03-05 | 2019-05-17 | 中国医学科学院北京协和医院 | Molecular marked compound relevant to Pancreatic Neuroendocrine Tumors and its application |
| CN109913548A (en) * | 2019-03-05 | 2019-06-21 | 中国医学科学院北京协和医院 | Application of the PCSK2 in the product that preparation is detected and treated for Pancreatic Neuroendocrine Tumors |
| CN111304250A (en) * | 2020-02-28 | 2020-06-19 | 中国人民解放军总医院第三医学中心 | Screening method of pancreatic cancer tumorigenic gene and application of screened gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108841955B (en) | 2021-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103907022A (en) | Methods and compositions for the treatment and diagnosis of colorectal cancer | |
| CN109423517B (en) | Use of exosomes in tumor diagnosis, treatment and prognosis evaluation | |
| CN109593848B (en) | Tumor-associated sequence, long-chain non-coding RNA and application thereof | |
| CN108841955A (en) | Application of the C22orf41 as Pancreatic Cancer Tumor Markers object | |
| CN106701900A (en) | Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer | |
| CN112522394A (en) | Novel exosome release related target and application thereof in tumor monitoring and inhibition | |
| CN108660212B (en) | Application of WDR1 gene in preparation of non-small cell lung cancer treatment and detection products | |
| CN107312855B (en) | Gene related to laryngeal squamous cell carcinoma and application thereof | |
| CN106244688B (en) | A kind of marker for assessing adenocarcinoma of colon risk | |
| CN112961916A (en) | AKR1C3 as biological marker for liver cancer prognosis and application thereof | |
| Chen et al. | The elevated circ_0067835 could accelerate cell proliferation and metastasis via miR-1236-3p/Twist2 axis in hepatocellular carcinoma | |
| CN110951873A (en) | Bone and sarcoma marker, application thereof and kit | |
| CN106729756B (en) | Application of biomarker as target in diagnosis and treatment of lung adenocarcinoma | |
| CA2932910A1 (en) | Methods for diagnosing and treating metastatic cancer | |
| CN108192977B (en) | Molecular marker related to occurrence and development of gastric cancer | |
| EP4335920A2 (en) | Use of rhoa in cancer diagnosis and inhibitor screening | |
| CN109666674A (en) | CircCDYL2 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation | |
| CN109486817A (en) | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnoses and treatment cholangiocarcinoma | |
| CN107496923A (en) | A kind of biomarker related to clear cell carcinoma of kidney | |
| Fang et al. | MIIP inhibits malignant progression of hepatocellular carcinoma through regulating AKT. | |
| CN110577952B (en) | Application of siRNA interfering long non-coding RNA in preparation of medicine for treating breast cancer | |
| CN107184983B (en) | Diagnosis and treatment target for lung adenocarcinoma | |
| CN112029866A (en) | Application of WWP1 in pancreatic cancer | |
| CN105385781B (en) | Application of the LCE3E in diagnosis and treatment carcinoma of mouth | |
| CN111635941A (en) | Detection kit for SDPR gene expression and/or SDPR gene methylation level and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |