CN106701900A - Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer - Google Patents
Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer Download PDFInfo
- Publication number
- CN106701900A CN106701900A CN201510787049.0A CN201510787049A CN106701900A CN 106701900 A CN106701900 A CN 106701900A CN 201510787049 A CN201510787049 A CN 201510787049A CN 106701900 A CN106701900 A CN 106701900A
- Authority
- CN
- China
- Prior art keywords
- lncrna
- herc2p3
- seq
- sequence shown
- gastric cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention discloses application of a long-chain noncoding RNA HERC2P3 gene in diagnosis and treatment of a gastric cancer. Specifically, the invention confirms that LncRNA-HERC2P3 gene expression in the gastric cancer tissue is significantly higher than the tissue beside the cancer, and the growth of gastric cancer cells can be remarkably inhibited through a silent LncRNA-HERC2P3 gene. Therefore, the LncRNA-HERC2P3 gene and an expression product thereof can be used as a marker for diagnosis of the gastric cancer and a drug target for treatment of the gastric cancer and make the diagnosis of the gastric cancer more accurate and faster. Therefore, the LncRNA-HERC2P3 gene and there purpose thereof provide a new therapeutic target and an effective new drug for gastric cancer prevention and treatment.
Description
Technical field
The invention belongs to gene therapy and diagnostic techniques field, the application in the diagnosis and treatment of gastric cancer of more particularly to a kind of long-chain non-coding RNA and its expression product.
Background technology
China is the High Risk For Gastric Cancer country, and its morbidity and mortality is in the 3rd and the 2nd of whole malignant tumours respectively.Stomach cancer 46.3 ten thousand is newly sent out by China within 2008, accounts for global 46.8%；The same year whole world death patients with gastric cancer about 73.7 ten thousand, wherein China dead 35.2 ten thousand, account for global 47.8%.Tumor stomach is seldom found or makes a definite diagnosis in preclinical phase, and particularly in China, the stomach cancer more than 80% has just been in progressive stage when making a definite diagnosis so as to cause prognosis generally poor.Gastroscope is the main examination means of early carcinoma of stomach, but gastrocopy is expensive, while also bringing many pains to patient, the current whole world only Japan implements Silent cerebral infarction examination.In order to overcome this difficult, existing many biomarkers are widely used in the diagnosis of tumor stomach at present, wherein mainly including oncogene, tumor suppressor gene, DNA Related to repair gene and the regulatory gene related to cell cycle and cell adherence and its expression product.But these biomarkers are not high for the sensitivity and specificity that early carcinoma of stomach is diagnosed.Thus, it is found that sensitivity and specificity new tumor markers higher, is the key for improving early gastric caacer diagnostic level.
In recent years, with the completion that mankind ENCODE plans, it has been found that non-coding RNA plays critical function in cell activities.Non-coding RNA is a class not coded protein but tool functional RNA molecule, and two major classes can be divided into according to its length：Short-movie section non-coding RNA (including siRNA, miRNA, piRNA etc.) and long segment non-coding RNA (LncRNA).MiRNAs is to study a more class in short-movie section non-coding RNA, they are a kind of single-stranded microRNAs of non-coding of about 22 bases of size, combined by the way that 3 ' the end noncoding regions with target gene mRNA are complementary, cause degraded or the Transcription inhibition of target gene mRNA, in the expression of post-transcriptional level controlling gene.LncRNA refers to RNA of the length more than 200nt, most of to have conservative secondary structure, shear pattern and Subcellular Localization in nucleus or in endochylema.LncRNA is widely present and adjusts intracellular signal transducting system, can be in the expression of many levels controlling gene, and the mechanism of action being currently known adjusts (such as Pre-mRNA processing) after including chromatin modification, transcriptional regulatory, transcription.
LncRNA equally exists close relationship with the generation development of cancer, and as miRNA, lncRNA also represent another important molecular origin in medical diagnosis on disease and treatment.Current research shows that the expression of difference or some cancer types Idiotypes lncRNA on lncRNA expressions can be used as recruit's mark of tumor diagnosis and therapy.
Therefore, this area is in the urgent need to finding contacting between more LncRNA and stomach cancer, so as to develop new diagnosis and/or the method for treating stomach cancer.
The content of the invention
Current inventor provides a kind of purposes of LncRNA-HERC2P3 in diagnosing gastric cancer and treatment.
First aspect present invention, there is provided a kind of lncRNA-HERC2P3 of separation or the purposes of its detection reagent, chip, reagent or kit for preparing diagnosis of gastric cancer；Described lncRNA-HERC2P3 is selected from：
(a) such as SEQ ID NO.:Sequence shown in 1；
(b) and SEQ ID NO.:The complementary lncRNA-HERC2P3 of sequence shown in 1.
In another preference, described lncRNA-HERC2P3 is isolated from the blood and/or tissue of people or non-human mammal.
In another preference, described blood is blood plasma and/or serum.
In another preference, described blood does not include haemocyte.
In another preference, described non-human mammal is mouse, rat, rabbit, pig, ox, sheep etc..
In another preference, described tissue includes tumor tissues, especially stomach organization.
In another preference, described lncRNA-HERC2P3 is isolated from people.
In another preference, the chip includes：
Solid phase carrier；And the oligonucleotide probe on the solid phase carrier is fixed in order, described oligonucleotide probe specifically corresponds to SEQ ID NO:Sequence shown in 1.
A kind of second aspect present invention, there is provided kit, the kit contains the detection reagent of lncRNA-HERC2P3, and operation instructions,
Wherein, described lncRNA-HERC2P3 is selected from：
(a) such as SEQ ID NO.:Sequence shown in 1；
(b) and SEQ ID NO.:The complementary lncRNA-HERC2P3 of sequence shown in 1.
In another preference, also containing lncRNA-HERC2P3 as positive control in the kit.
In another preference, the detection reagent of the lncRNA-HERC2P3 includes specific amplification SEQ ID NO.:The primer pair of sequence shown in 1, probe, chip.
In another preference, the specific amplification SEQ ID NO.:The primer pair of sequence shown in 1 includes SEQ ID NO.:Sequence shown in 2-3.
A kind of third aspect present invention, there is provided inhibitor of the lncRNA-HERC2P3 of separation, specificity suppresses expression and/or the activity of lncRNA-HERC2P3 to the inhibitor in vitro and/or in vivo；
Wherein, described lncRNA-HERC2P3 is selected from：
(a) such as SEQ ID NO.:Sequence shown in 1；
(b) and SEQ ID NO.:The complementary lncRNA-HERC2P3 of sequence shown in 1.
In another preference, described inhibitor includes SEQ ID NO.:The antisensenucleic acids of sequence shown in 1, siRNA, miRNA, shRNA.
In another preference, described siRNA such as SEQ ID NO.:4-5 or SEQ ID NO.:Shown in 6-7.
In another preference, described shRNA such as SEQ ID NO.:Shown in 8-9.
Fourth aspect present invention, there is provided the purposes of the inhibitor of lncRNA-HERC2P3 described in third aspect present invention, the pharmaceutical composition for preparing treatment stomach cancer and/or Metastasis of Gastric Cancer.
In another preference, described pharmaceutical composition contains the inhibitor and pharmaceutically acceptable carrier of lncRNA-HERC2P3.
Fifth aspect present invention, there is provided a kind of pharmaceutical composition for treating stomach cancer and/or Metastasis of Gastric Cancer, described pharmaceutical composition contains the inhibitor and pharmaceutically acceptable carrier of lncRNA-HERC2P3 described in third aspect present invention.
Sixth aspect present invention, there is provided a kind of method of screening treatment stomach cancer and/or Metastasis of Gastric Cancer drug candidate compound, methods described includes：
In test group, in stomach cancer cell cultivating system, the candidate compound is added, and determine such as SEQ ID NO.:The expression of sequence shown in 1 and/or activity E1；In control group, to stomach cancer cell cultivating system in, be added without the candidate compound, and determine such as SEQ ID NO.:The expression of sequence shown in 1 and/or activity E0；
Wherein, when E1 is significantly higher than E0, then show that described candidate compound is the medicine that can treat stomach cancer and/or Metastasis of Gastric Cancer.
In another preference, described being significantly higher than refers to E1/E0 >=1.5, preferably E1/E0 >=2.
In another preference, methods described also includes the candidate compound that will be obtained in step (a), further tests the effect of its growth and/or migration to stomach cancer cell.
Seventh aspect present invention, a kind of method for having listened external non-therapeutic to suppress Growth of Gastric and/or migration, in the inhibitor described in third aspect present invention, and/or stomach cancer cell is cultivated in the presence of the pharmaceutical composition described in fifth aspect present invention, so as to suppress Growth of Gastric and/or migration.
Eighth aspect present invention, there is provided a kind of diagnosis of gastric cancer and/or the method for Metastasis of Gastric Cancer, in the sample of object origin needed for detection, the expression of lncRNA-HERC2P3 and/or activity, the expression of the lncRNA-HERC2P3 described in the sample and/or activity are significantly higher than control, then show that the object may suffer from stomach cancer and/or Metastasis of Gastric Cancer；
Wherein, described lncRNA-HERC2P3 is selected from：
(a) such as SEQ ID NO.:Sequence shown in 1；
(b) and SEQ ID NO.:The complementary lncRNA-HERC2P3 of sequence shown in 1..
Ninth aspect present invention, there is provided a kind of method for treating stomach cancer and/or Metastasis of Gastric Cancer, including step：The inhibitor described in the third aspect present invention of safe and effective amount and/or the pharmaceutical composition described in fifth aspect present invention are applied to the object for needing.
It should be understood that within the scope of the present invention, can be combined with each other between above-mentioned each technical characteristic of the invention and each technical characteristic for specifically describing in below (eg embodiment), so as to constitute new or preferred technical scheme.As space is limited, no longer tire out one by one herein and state.
Brief description of the drawings
Figure 1A shows in embodiment 1 that the expression quantity of the LncRNA-HERC2P3 of the stomach cancer cell after qPCR results display silence LncRNA-HERC2P3 genes is significantly reduced.
Figure 1B shows in embodiment 1 that the growing multiplication ability for targetting the siRNA group stomach cancer cells of LncRNA-HERC2P3 substantially weakens compared to negative control group.
Fig. 2A shows in embodiment 2 that the invasive ability for indicating the stomach cancer cell of silence LncRNA-HERC2P3 genes substantially weakens cell invasion laboratory qualitative.
Fig. 2 B show that the experimental group of silence LncRNA-HERC2P3 genes in embodiment 2 is significantly reduced than control group cell number.
Fig. 3 A show the transfection efficiency situation of (× 100) shHERC2P3 groups and shNC groups under white light and fluorescence microscope in embodiment 3, and Successful transfection knocks out the slow virus carrier of LncRNA-HERC2P3 genes in SGC-7901 stomach cancer cells.
Fig. 3 B show shHERC2P3 groups contrast shNC groups in embodiment 3, and the expression of LncRNA-HERC2P3 genes is significantly reduced.
Fig. 4 A show that the LncRNA-HERC2P3 genes of silence suppress the ability that stomach cancer cell SGC-7901 forms tumour in nude mice by subcutaneous.LncRNA-HERC2P3 silences group is small and light all than control group in volume and tumor weight, while two groups have statistical significance.
Fig. 4 B show that the visual tumors number of shHERC2P3 group mouse lungs is significantly reduced relative to control group.
Fig. 5 shows expression schematic diagram of the real-time quantitative PCR detection LncRNA-HERC2P3 genes in 30 Patients with Gastric Cancer cancerous tissues and cancer beside organism in embodiment 5, wherein, " N " refers to cancer beside organism, and " C " refers to stomach organization.LncRNA-HERC2P3 gene expression amounts are higher than corresponding cancer beside organism during result shows 13 cancerous tissues of (43.3%) patient.
Specific embodiment
The present inventor is by in-depth study extensively, one is have unexpectedly discovered that first with incidence gastric cancer and the closely related long-chain non-coding RNA of transfer, HERC2P3, its expression high in stomach organization, and the expression high in cancer beside organism and normal structure, therefore can be used as auxiliary stomach cancer or its detection mark for shifting.Additionally, the present inventor is further shown experimentally that, suppress the lncRNA, can effectively suppress stomach cancer or its transfer, so that for the drug target of curing gastric cancer.
Non-coding RNA (Non-coding RNAs)
As used herein, term " non-coding RNA " refers to the RNA of not coded protein.In human genome, major part is non-coding RNA.Only 2% transcript for producing is codified RNA in human genome, and remaining 98% is non-coding RNA, and they are the functional RNA molecules that can not translate into protein.These non-coding RNA wide participation Human Physiology, pathologic events, it is closely related with numerous tumours.
In non-coding RNA, according to the difference of size, the molecule with regulating and controlling effect is broadly divided into two classes：Short chain non-coding RNA (including siRNA, miRNA, piRNA) and long-chain non-coding RNA (Long non-coding RNA, LncRNA).These almost all of physiology of ncRNA wide participation human bodies, pathologic events, including participate in, regulate and control or mediate the generation of numerous tumours, evolution.
Long-chain non-coding RNA (LncRNA)
As used herein, term " LncRNA ", " long-chain non-coding RNA ", " Long non-coding RNA " implication are identical, used interchangeably, all referring to it is a kind of by rna plymerase ii transcription, not encoding proteins, general length more than 200bp RNA fragments.
In human genomic sequence, 4%~9% transcript for producing is long-chain non-coding RNA (lncRNA), many of which lncRNA only occurs in the specific stage of development, with tissue or cell-specific, lncRNA can adjust associated protein coding gene in different aspects in several ways, participate in the generation of induced disorders.
The invention provides a kind of long-chain non-coding RNA for from blood and/or tissue separate.
As used herein, term " blood " can be blood plasma, serum, but not include haemocyte.
As used herein, term " separation " refers to that material is separated (if crude, primal environment is natural surroundings) from its primal environment.Polynucleotide as the polynucleotide and polypeptide under the native state in active somatic cell are not isolated and purified but same or polypeptide with being separated in other materials for existing, are then isolated and purified such as from native state.
LncRNA can be processed from precursor LncRNA, and precursor LncRNA can be sheared the LncRNA of generation maturation, and the ripe LncRNA may be substantially complementary with least a portion sequence of the mRNA of encoding gene.
As used herein, it refers to that the sequence of nucleotides is complementary enough " to be substantially complementary ", can be interacted in a kind of foreseeable mode, such as forms secondary structure (such as loop-stem structure).Generally, two nucleotide sequences of " being substantially complementary " from each other at least 70% nucleotides be complementary；Preferably, at least 80% nucleotides is complementary；It is furthermore preferred that at least 90% nucleotides is complementary；It is further preferred that at least 95% nucleotides is complementary；Such as 98%, 99% or 100%.Usually, there can be most 40 unmatched nucleotides between two molecules complementary enough；Preferably, with most 30 unmatched nucleotides；It is furthermore preferred that having most 20 unmatched nucleotides；It is further preferred that having most 10 unmatched nucleotides, such as there are 1,2,3,4,5,8,11 unmatched nucleotides.
As used herein, " stem ring " structure is also referred to as " hair clip " structure, it refer to a kind of nucleic acid molecule, it can form a kind of secondary structure including double-stranded region (stem), described double-stranded region is formed by two regions (being located on same molecule) of the nucleic acid molecule, two both sides of region point row double stranded section；It also includes at least one " ring " structure, including incomplementarity nucleic acid molecule, i.e. single-stranded regions.Even if two regions of the nucleic acid molecule are not complete complementaries, the double stranded section of nucleotides can also keep double-stranded state.For example, insertion, missing, substitution etc. can cause the not complementary or zonule itself of zonule to form the secondary structure of loop-stem structure or other forms, however, two regions can still be substantially complementary, and interacted in foreseeable mode, form the double-stranded region of loop-stem structure.Loop-stem structure is well-known to those skilled in the art, and generally after a nucleic acid for the nucleotide sequence with primary structure is obtained, those skilled in the art can determine whether the nucleic acid can form loop-stem structure.
LncRNA of the present invention has such as SEQ ID NO.:Sequence shown in 1.
Long-chain non-coding RNA HERC2P3 genes
As used herein, term " lncRNA-HERC2P3 ", " long-chain non-coding RNA HERC2P3 genes " " long-chain RNA of the present invention " or " lncRNA of the present invention " are used interchangeably, and refer to such as SEQ ID NO.:The HERC2 pseudogenes 3 that sequence shown in 1 or its complementary series are represented, not encoding proteins.HERC2 is the huge albumen with HECT and RLD domains, with E3 ubiquitin ligase activities.It has been found that its mutation is related to self-closing disease, and so far without with cancer-related report.The gene has multiple pseudogene sequences, and HERC2P3 is exactly one of them.The function of HERC2P3 is not reported so far.
ASON
As used herein, term " ASON ", " antisense-oligonucleotides ", " AS-Ons " or " ASO " implication is identical.According to LncRNA sequences provided by the present invention, their ASON is can be designed that, described ASON can in vivo lower the expression of the amount or LncRNA of corresponding LncRNA.
In the present invention, described " ASON " is also including using the modified GEM 132 for such as being obtained based on nucleic acid lock or nucleic acid chains backbone modification technology means, described modification does not change the activity of ASON substantially, more preferably, the modification can improve stability, activity or the therapeutic effect of ASON.
After ASON of the present invention is transferred in people or non-human mammal body, they can substantially lower the expression of related LncRNA.
Polynucleotides construction
According to people LncRNA sequences provided by the present invention, the polynucleotides construction of the LncRNA that can be processed to that corresponding mRNA expression can be influenceed after being imported into can be designed, namely the polynucleotides construction can in vivo raise the amount of corresponding LncRNA.Therefore, the invention provides a kind of polynucleotides of separation (construction), described polynucleotides (construction) can be transcribed into LncRNA by people's cell.
Used as a kind of preferred embodiment of the invention, described polynucleotides construction contains the structure shown in Formulas I：
SeqIt is positive-X-SeqReverselyFormulas I,
In Formulas I,
SeqIt is positiveFor the nucleotide sequence of described LncRNA, Seq can be expressed as in cellReverselyIt is and SeqIt is positiveThe nucleotide sequence being substantially complementary；Or, SeqReverselyFor the nucleotide sequence of described LncRNA, Seq can be expressed as in cellIt is positiveIt is and SeqIt is positiveThe nucleotide sequence being substantially complementary；
X is positioned at SeqIt is positiveAnd SeqReverselyBetween intervening sequence, and the intervening sequence and SeqIt is positiveAnd SeqReverselyIt is not complementary；
Structure shown in Formulas I forms the secondary structure shown in Formula II after cell is transferred to：
Formula II,
In Formula II, SeqIt is positive、SeqReverselyIt is as defined above with X and is stated；
| | represent in SeqIt is positiveAnd SeqReverselyBetween formed base pair complementarity relation.
Generally, described polynucleotides construction is located on expression vector.Therefore, present invention additionally comprises a kind of carrier, it contains described LncRNA, or described polynucleotides construction.Described expression vector generally also contains promoter, replication orgin and/or marker gene etc..
The expression vector that method well-known to those having ordinary skill in the art can be used for needed for building the present invention.These methods are including recombinant DNA technology in vi, DNA synthetic technologys, In vivo recombination technology etc..Described expression vector preferably includes one or more selected markers, to provide the phenotypic character of the host cell for selecting conversion, such as kalamycin, gentamicin, hygromycin, amicillin resistance.
Chip
LncRNA chip of expression spectrum usually contains up to hundreds of probes, covers various RNA, the content of contained various RNA in detecting sample in full-length genome level using the principle of DNA double chain homologous complementary.Therefore, the transcriptional level of RNA that can be in the same time is to sample to be tested in the range of full-length genome is detected.
Using LncRNA sequences of the present invention, corresponding LncRNA chips can also be prepared, and then study the regulative mode of its express spectra and LncRNA.
On the other hand, the present invention also provides a kind of chip for analyzing LncRNA express spectras.Described LncRNA chips of the invention include：Solid phase carrier；And the oligonucleotide probe on the solid phase carrier is fixed in order, described oligonucleotide probe specifically corresponds to SEQ ID NO:Sequence shown in 1, additionally, lncRNA chips of the present invention can also contain the probe for other known stomach cancer mark of correlation thing.
Specifically, suitable probe can be designed according to LncRNA of the present invention, is fixed on solid phase carrier, formed " oligonucleotide arrays ".Described " oligonucleotide arrays " refer to the array with addressable point (i.e. with distinctive, the position that addressable address is characterized), and a coupled characteristic oligonucleotides is contained in each addressable point.As needed, oligonucleotide arrays can be divided into multiple Asia battle arrays.
The solid phase carrier can be using the various common used materials in genetic chip field, such as but not limited to nylon membrane, the slide modified through active group (such as aldehyde radical, amino) or silicon chip, unmodified slide, plastic sheet etc..
Preparing for described LncRNA chips can be using the common manufacturing method of biochip known in the art.For example, if solid phase carrier uses modification slide or silicon chip, gone here and there containing amido modified poly- dT at 5 ' ends of probe, oligonucleotide probe can be configured to solution, then use point sample instrument by its point on modification slide or silicon chip, predetermined sequence or array is arranged in, is then fixed by standing overnight, so that it may obtain miRNA chips of the invention.If nucleic acid, without amido modified, its preparation method can also refer to：Wang Shenwu chief editors'《Gene diagnosis technology-on-radiation operation manual》；J.L.erisi,V.R.Iyer,P.O.BROWN.Exploring the metabolic and genetic control of gene expression on a genomic scale.Science,1997；278:680 and Ma Li people, Jiang Zhonghua chief editor biochip Beijing：Chemical Industry Press, 2000,1-130.
Detection kit
Present invention also offers a kind of kit, chip of the invention is contained in described kit.Described kit can be used to detect the expression of LncRNA described in blood.
Preferably, the label for labeled RNA sample, and the substrate corresponding with the label are also contained in described kit.
Additionally, the various reagents required for extracting RNA, PCR, hybridization, colour developing etc. are may also include in described kit, including but not limited to：Extract, amplification liquid, hybridization solution, enzyme, comparison liquid, nitrite ion, washing lotion, antibody etc..
Additionally, may also include operation instructions and/or chip image analysis software in described kit.
LncRNA inhibitor
As used herein, term " active component of the invention ", " inhibitor of the invention ", " LncRNA inhibitor " are used interchangeably, and all refer to suppress or reduce the material of LNCRNA expression or activity.
Representational lncRNA inhibitor includes antisensenucleic acids, micromolecular compound, miRNA, shRNA or siRNA etc..
After obtaining the target spot of lncRNA of the present invention, the inhibitor of lncRNA can be prepared by routine techniques of the present invention and/or screened.Candidate's scope of screening lncRNA inhibitor of the present invention can include any conventional database known in the state of the art, such as compound database.
A kind of preferred lncRNA inhibitor of the present invention is SEQ ID NO.:The siRNA or shRNA of sequence shown in 1, it is preferred that described siRNA such as SEQ ID NO.:4-5 or SEQ ID NO.:Shown in 6-7；Described shRNA such as SEQ ID NO.:Shown in 8-9.
Pharmaceutical composition
Present invention also offers a kind of pharmaceutical composition, it contains the LNCRNA inhibitor and pharmaceutically acceptable carrier or excipient of safe and effective amount.This kind of carrier includes (but being not limited to)：Salt solution, buffer solution, glucose, water, glycerine, ethanol, and combinations thereof.Pharmaceutical preparation should match with administering mode.Pharmaceutical composition of the invention can be made into injection form, and such as aqueous solution with physiological saline or containing glucose and other assistant agents is prepared by conventional method.The pharmaceutical composition of such as tablet and capsule etc, can be prepared by conventional method.Pharmaceutical composition such as injection, solution, tablet and capsule are preferably aseptically manufactured.The dosage of active component is therapeutically effective amount, such as the daily mg/kg body weight of about 1 microgram/kg body weight-about 5.Additionally, LNCRNA inhibitor of the invention can also be used together with other therapeutic agents.
During using pharmaceutical composition, it is that the LNCRNA inhibitor of the present invention of safe and effective amount is applied to mammal, the wherein safe and effective amount typically at least about 10 micrograms/kg body weight, and 8 mg/kg body weight are in most cases no more than about, preferably the dosage is the mg/kg body weight of about 10 micrograms/kg body weight-about 1.Certainly, specific dosage is also contemplated that the factors such as method of administration, patient health situation, within the scope of these are all skilled practitioners technical ability.
Beneficial effect of the present invention
Present invention experiment confirms expression of the LncRNA-HERC2P3 genes in stomach organization apparently higher than cancer beside organism, and the growth of stomach cancer cell can be significantly inhibited by silence LncRNA-HERC2P3 genes, therefore LncRNA-HERC2P3 genes and its expression product can make diagnosing gastric cancer more accurate, quick as the mark of diagnosis of gastric cancer and the drug target for curing gastric cancer.In a word, LncRNA-HERC2P3 genes of the present invention and application thereof provide new therapy target and effective new drug to prevent and treat stomach cancer.
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are only illustrative of the invention and is not intended to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, generally according to normal condition, such as Sambrook et al., molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) described in condition, or according to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage and number are percentage by weight and parts by weight.
Universal method：
(1) acquisition of clinical tissue sample
Stomach cancer and cancer beside organism take from the patients with gastric cancer of operative treatment, and Informed Consent Form has been signed with patient before sample is obtained.The stomach organization of surgery excision is quick-frozen in input liquid nitrogen and move to -80 DEG C of Refrigerator stores once in vitro, the cancer beside organism beyond rapid excised tumor primary tumor and surrounding 5cm, is stored in liquid nitrogen during transport.Cancer makes last diagnostic with cancer beside organism by pathologist.Sample is divided into I-III grades according to Edmondson grade scales.
(2) tissue and cell RNA are extracted
Using TRIzol Reagent (Invitrogen) reagent extracting RNA, concrete operations are as follows：
1) vessel such as mortar, stone roller pestle and homogenizer are cleaned, and use ddH again respectively2O and DEPC H2O is rinsed, and is then dried in 180 DEG C of baking ovens about 4 hours, to remove RNase；
2) add appropriate liquid nitrogen to be allowed to precooling in mortar, tissue is taken out rapidly from liquid nitrogen, cut about 50-100mg sizes, the grind into powder in mortar；
3) in ground tissue powder completely being moved into the EP pipes without RNase as far as possible with curet, EP pipes are added in advance appropriate volume (1ml) TRIzol reagents, fully homogenate；
4) room temperature is placed 5 minutes, and in proportion to chloroform (200 μ l/1ml TRIzol) is added in centrifuge tube, rapid acutely vibration 15 seconds are stored at room temperature 2-3 minutes, 4 DEG C, are centrifuged 15 minutes under the conditions of 12000 × g；
5) upper strata aqueous phase is transferred to as much as possible in the new EP pipes without RNase, adds isometric isopropanol, overturned and mix 5 times, be stored at room temperature 10 minutes, 4 DEG C, be centrifuged 10 minutes under the conditions of 12000 × g, now visible RNA precipitate；
6) supernatant is outwelled, adds 75% ethanol (1ml/1ml TRIzol), mixed, wash RNA, be centrifuged 4 DEG C, be centrifuged 5 minutes under the conditions of 7500 × g；
7) abandon supernatant, residual ethanol is eliminated as far as possible, precipitation spontaneously dries 5-10min (attention is sure not to be completely dried)；Add 30-50 μ l DEPC H2O, pressure-vaccum several times, dissolves RNA precipitate；
8) ELIASA determines RNA concentration and purity OD 260/280 (1.8-2.0)；Gel electrophoresis observation whether there is degraded, -80 DEG C of preservations.
Cell line RNA is extracted, the cell in growth period of taking the logarithm, and draws nutrient solution, and the area according to culture dish adds TRIzol reagents (the 1ml TRIzol/10cm of respective amount2) cell lysis, piping and druming several times, the cell that will be cleaved is collected into the EP pipes without RNase, and remaining is according to above-mentioned steps 4) -8) complete chloroform-isopropanol method isolate and purify RNA.
(3) reverse transcription of RNA
With M-MLV Reverse Transcriptase (Promega) reverse transcription, operate as follows：
1) following components is added in the EP pipes of nuclease free：
It is placed in PCR instrument, 70 DEG C, 5 minutes, immediately after in cooled on ice 5min.
2) following components is added in above-mentioned system：
After gently mixing, it is placed in PCR instrument, 37 DEG C, 60min.
The cDNA that reverse is obtained is placed in 4 DEG C of preservations.
(4) real-time quantitative PCR
Real-time quantitative PCR reaction is usedPremix Ex TaqTMThe reaction system of (Perfect Real Time) kit (TaKaRa Biotechnology Co., Ltd. Dalian, China), using Thermal Cycler DiceTMReal Time System (TP800 real-time fluorescence quantitative PCR instrument, TaKaRa) are operated.The amplified production length of quantitative PCR is the most suitable (can extend to 300bp) with 80bp-150bp.
Reaction system is as follows：
Solubility curve analytical procedure：
95℃ 15sec
60℃ 30sec
95℃ 15sec
Dissociation time is 4sec.
The default value that autofluorescent background signal and threshold value are set using instrument, each PCR reactions can be automatically generated after terminating, and Ct values represent that the fluorescence signal in each reaction tube reaches the period experienced during given threshold (10 times of Baseline fluorescence intensity)；Genes of interest HERC2P3 each template does 3 multiple pipes, and the Ct values for obtaining are averaged；The Ct average values of HERC2P3 genes subtract the Ct average values of the reference gene (β-actin) of corresponding template, obtain Δ Ct.The Δ Ct of stomach cancer group subtracts the Δ Ct of corresponding adjacent tissues, obtains Δ Δ Ct values, and the multiple proportion of the HERC2P3 genes in stomach cancer group and cancer side group uses 2- ΔΔ CtRepresent.
(5) measure of cell growth curve
1) different types of HCC cells are pressed into 3-5 × 10 according to its growth characteristics3/ 100 μ l/ holes calculate cell total amount, after abundant vitellophag, are diluted to required concentration, are inoculated in 96 orifice plates.Daily every group of three wells, by 5-7 days inoculating cells；
2) observation of cell state and number after cell is substantially adherent.Chromogenic reaction is carried out with CCK-8 developers (Cell Counting Kit-8, DOJINDO, Japan), every 100 μ l nutrient solutions add 10 μ l CCK-8,37 DEG C, 5%CO2Incubator is placed and is incubated 1h, and ELIASA determines the absorbance at 450nm, and record determines the actual initial density of cell, used as growth relative zero.
3) half amount changes liquid daily or every other day, specific depending on requirement of experiment；
4) basis of microscopic observation cellular morphology, Fixed Time Interval measurement, records cell growth condition；
5) it is general to survey 5 to 7 days.After end to be determined, collect data and processed, chart is drawn with Excel.
(6) cell clonal formation experiment
1) transfect：Using LipofectamineTM2000 (Invitrogen) transfectional cells, the expression of HERC2P3 genes in overexpression or silenced cell；
2) cell after transfecting, counted with digestion after normal nutrient solution culture 24h in 6 orifice plates or 35mm culture dishes, 100mm culture dishes are seeded to by certain amount (different cell line numbers are different), continue to cultivate 24h, then the G418 (600-1000 μ g/ml) of debita spissitudo is added according to cell category, the cell clone positive to screen transfection；
3) cultivate 2-3 weeks, changed fresh medium every 3-5 days therebetween and add G418 screenings, until there is macroscopic cell clonal formation；
4) the training liquid in culture dish is sucked, 1 × PBS is washed twice, coomassie brilliant blue R_250 dyeing 2h, after gently being rinsed with water, then with coomassie brilliant blue staining destainer decolouring 30-60min；
5) Clone formation coloration result is taken pictures, and the cell clone on each culture dish is counted according to identical standard (cell clone size).
(7) tumor formation in nude mice
1) mouse used by is the 5-6 weeks male BLAB/c nu nude mice of size, is provided by Shanghai Slac Experimental Animal Co., Ltd., is raised in southern model animal Culture Center；
2) cell after treatment is taken, it is subcutaneous (different cell categories inoculation numbers different) to be inoculated in mouse with equal number, to avoid error caused by individual difference, allogenic cell different disposal from symmetrical being inoculated in same mouse；
3) after visual tumors to appear, every 3 days monitoring tumor sizes, slide measure reads tumour major diameter and minor axis, gross tumor volume is calculated as follows：Volume=0.5* major diameter x minor axis2；
4) after continuing to monitor about 7-8 times, disposal data, statistics.
Embodiment 1：The expression inhibiting Growth of Gastric of silence LncRNA-HERC2P3.
In order to further verify growth inhibition functions of the silence LncRNA-HERC2P3 to stomach cancer cell, the present inventor takes RNA to disturb mode of silence its expression to detect the change of cell growth status.SiRNA for disturbing LncRNA-HERC2P3 to express is synthesized by Shanghai Ji Ma pharmaceutical Co. Ltds, and sequence is si-1：Positive-sense strand 5-CACCAAGACUUUAUGCGGAdTdT-3 (SEQ ID NO.:4)；Antisense strand 5-UCCGCAUAAAGUCUUGGUGdTdT-3 (SEQ ID NO.:5).Si-2：Just with chain 5-CUCAUCAACAAGUACAUCAdTdT-3 (SEQ ID NO.:6), antisense strand 5-UGAUGUACUUGUUGAUGAGdTdT-3 (SEQ ID NO.:7).It is classified as the NC non-specificity nucleotides sequences of interference control：Positive-sense strand 5-UUCUCCGAACGUGUCACGUdTdT-3 (SEQ ID NO.:10)；Antisense strand 5-ACGUGACACGUUCGGAGAAdTdT-3 (SEQ ID NO.:11).Show through real-time quantitative PCR detection, artificial synthesized interference siRNA can effectively lower the expression (Figure 1A) of LncRNA-HERC2P3, downwards that growth curve experiment also demonstrates LncRNA-HERC2P3 can suppress the growth (Figure 1B) of stomach cancer cell SGC-7901, and strong support targets LncRNA-HERC2P3 can suppress the conclusion of growth of tumour cell.
Embodiment 2：The expression inhibiting stomach cancer cell invasion and attack of silence LncRNA-HERC2P3.
In order to further appreciate that the relation of LncRNA-HERC2P3 and stomach cancer cell invasion and attack, the present inventor transfects to AGS and SGC-7901 cells the siRNA for targetting LncRNA-HERC2P3, by the invasive ability of transwell experimental verification transfectional cells.Each 8 cell adds 3 × 104Individual cell, 48h poststainings simultaneously observe counting.The inventors discovered that the invasive ability of the stomach cancer cell of silence LncRNA-HERC2P3 genes substantially weakens (Fig. 2A).The experimental group that cell count quantitatively indicates silence LncRNA-HERC2P3 genes is significantly reduced (Fig. 2 B) than control group cell number.
Embodiment 3：The slow virus carrier of Successful transfection silence LncRNA-HERC2P3 is to SGC-7901 cells.
The slow virus carrier of silence LncRNA-HERC2P3 is transfected to SGC-7901 cells, the transfection efficiency experiment under white light and fluorescence microscope shows that positive control and the cell of negative control group are transfected well (Fig. 3 A).QPCR results further show the LncRNA-HERC2P3 expression quantity considerably less than shNC groups of shHERC2P3 groups.
Embodiment 4：LncRNA-HERC2P3 influences stomach cancer cell to transport transfer ability in the blood of nude mice.
Experiment in vitro has clearly indicated that Srrp35 suppresses the growth and invasion and attack of stomach cancer cell, and following the present inventor studies the influence that silence LncRNA-HERC2P3 shifts one-tenth knurl ability to stomach cancer cell nude mice using nude mice model.By 1.5 × 106The SGC-7901 cells and compared with control cells of individual silence LncRNA-HERC2P3 are symmetrically injected into nude mice tail vein.After 6 weeks, kill nude mice taking-up lung tissue and weigh.Result shows that silence LncRNA-HERC2P3 effectively inhibits transfer one-tenth knurl ability of the SGC-7901 cells in nude mouse no matter on the volume and weight of single knurl body (Fig. 4 A), or on the knurl body number of lung tissue (Fig. 4 B).
Embodiment 5：LncRNA-HERC2P3 expressions have the trend of obvious rise in stomach organization sample.
The present inventor's early stage finds that LncRNA-HERC2P3 is substantially raised in stomach organization by lot of experiments.In 30 pairs of clinical samples, the expression for finding there is LncRNA-HERC2P3 in 13 pairs of sample stomach organizations is detected apparently higher than corresponding cancer beside organism by real-time quantitative PCR, rise rate reaches 43.3%, and statistical analysis show p<0.01 (Fig. 5), illustrates the reliability of result.The primer sequence of the real-time quantitative PCR of detection LncRNA-HERC2P3 expression used is GCGATCAGGATAGGCCTCCT (SEQ ID NO. in experiment:And Seq2 2)：GTTCGGCTTCAGAGTCGTCC(SEQ ID NO.:3) it is CCTGGCACCCAGCACAATG (SEQ ID NO. as the primer sequence of the β-actin of internal reference:And Seq4 12)：GGGCCGGACTCGTCATACT(SEQ ID NO.:13).
The all documents referred in the present invention are all incorporated as reference in this application, are individually recited as with reference to such just as each document.In addition, it is to be understood that after above-mentioned instruction content of the invention has been read, those skilled in the art can make various changes or modifications to the present invention, these equivalent form of values equally fall within the application appended claims limited range.
Claims (10)
1. the purposes of a kind of lncRNA-HERC2P3 of separation or its detection reagent, it is characterised in that be used for
Prepare chip, reagent or the kit of diagnosis of gastric cancer；Described lncRNA-HERC2P3 is selected from：
(a) such as SEQ ID NO.:Sequence shown in 1；
(b) and SEQ ID NO.:The complementary lncRNA-HERC2P3 of sequence shown in 1.
2. purposes as claimed in claim 1, it is characterised in that the chip includes：
Solid phase carrier；And the oligonucleotide probe on the solid phase carrier, described few core are fixed in order
Thuja acid probe specificity ground corresponds to SEQ ID NO:Sequence shown in 1.
3. a kind of kit, it is characterised in that the kit contains the detection examination of lncRNA-HERC2P3
Agent, and operation instructions,
Wherein, described lncRNA-HERC2P3 is selected from：
(a) such as SEQ ID NO.:Sequence shown in 1；
(b) and SEQ ID NO.:The complementary lncRNA-HERC2P3 of sequence shown in 1.
4. kit as claimed in claim 3, it is characterised in that the detection of the lncRNA-HERC2P3
Reagent includes specific amplification SEQ ID NO.:The primer pair of sequence shown in 1, probe, chip.
5. a kind of inhibitor of the lncRNA-HERC2P3 of separation, it is characterised in that the inhibitor is in body
Outer and/or the lncRNA-HERC2P3 of specificity suppression in vivo expression and/or activity；
Wherein, described lncRNA-HERC2P3 is selected from：
(a) such as SEQ ID NO.:Sequence shown in 1；
(b) and SEQ ID NO.:The complementary lncRNA-HERC2P3 of sequence shown in 1.
6. inhibitor as claimed in claim 5, it is characterised in that described inhibitor includes SEQ ID NO.:
The antisensenucleic acids of sequence shown in 1, siRNA, miRNA, shRNA.
7. the purposes of the inhibitor of lncRNA-HERC2P3 described in claim 5, it is characterised in that be used for
Prepare the pharmaceutical composition for the treatment of stomach cancer and/or Metastasis of Gastric Cancer.
8. a kind of pharmaceutical composition for treating stomach cancer and/or Metastasis of Gastric Cancer, it is characterised in that the medicine group
Compound contains the inhibitor and pharmaceutically acceptable carrier of lncRNA-HERC2P3 described in claim 5.
It is 9. a kind of to screen the method for treating stomach cancer and/or Metastasis of Gastric Cancer drug candidate compound, it is characterised in that
Methods described includes：
In test group, in stomach cancer cell cultivating system, the candidate compound is added, and determine such as SEQ
ID NO.:The expression of sequence shown in 1 and/or activity E1；In control group, to stomach cancer cell cultivating system
In, the candidate compound is added without, and determine such as SEQ ID NO.:The expression of sequence shown in 1 and/or
Active E0；
Wherein, when E1 is significantly higher than E0, then show described candidate compound be can treat stomach cancer and
/ or Metastasis of Gastric Cancer medicine.
10. a kind of method that external non-therapeutic suppresses Growth of Gastric and/or migration, it is characterised in that
Trained in the inhibitor described in claim 5, and/or in the presence of pharmaceutical composition described in claim 8
Nourishing the stomach cancer cell, so as to suppress Growth of Gastric and/or migration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510787049.0A CN106701900B (en) | 2015-11-16 | 2015-11-16 | Long-chain non-coding RNA HERC2P3 gene and application thereof in gastric cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510787049.0A CN106701900B (en) | 2015-11-16 | 2015-11-16 | Long-chain non-coding RNA HERC2P3 gene and application thereof in gastric cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106701900A true CN106701900A (en) | 2017-05-24 |
| CN106701900B CN106701900B (en) | 2020-03-20 |
Family
ID=58930570
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510787049.0A Active CN106701900B (en) | 2015-11-16 | 2015-11-16 | Long-chain non-coding RNA HERC2P3 gene and application thereof in gastric cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701900B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107236817A (en) * | 2017-07-19 | 2017-10-10 | 广州医科大学附属第五医院 | The application of LncRNA ENST00000424523.1 and its gene in diagnosis and medicine |
| CN107727859A (en) * | 2017-10-06 | 2018-02-23 | 南京普氟生物检测技术有限公司 | A kind of serum I FN γ and LncRNAs composition is used for the purposes for preparing cancer diagnosis reagent box |
| CN108034722A (en) * | 2017-12-13 | 2018-05-15 | 广州医科大学附属肿瘤医院 | A kind of lncRNA SGOL1-AS1 are in the application as diagnosing gastric cancer marker |
| CN108559779A (en) * | 2018-06-13 | 2018-09-21 | 中国医学科学院北京协和医院 | Diagnosis and treatment marker of the long-chain non-coding RNA as gastric cancer |
| CN110387372A (en) * | 2019-07-31 | 2019-10-29 | 宜春莲泽生物科技发展有限公司 | LncRNA is inhibited to express the application in curing gastric cancer |
| CN110951884A (en) * | 2019-12-31 | 2020-04-03 | 北京泱深生物信息技术有限公司 | New application of LINC02166 in diagnosis and treatment of gastric cancer |
| US10851376B2 (en) | 2018-12-28 | 2020-12-01 | The Florida International University Board Of Trustees | Long noncoding RNAs in pulmonary airway inflammation |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006013561A2 (en) * | 2004-08-02 | 2006-02-09 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Compositions and methods for diagnosing and treating post traumatic stress disorder |
| WO2012173809A2 (en) * | 2011-06-02 | 2012-12-20 | Ehli Erik | Method of identifying de novo copy number variants (cnv) using mz twins discordant for attention problems/disorders |
| CN102998459A (en) * | 2011-09-12 | 2013-03-27 | 香港中文大学 | Biomarker for gastric cancer |
| CN103146688A (en) * | 2012-09-12 | 2013-06-12 | 上海长海医院 | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis |
| CN103937872A (en) * | 2013-01-23 | 2014-07-23 | 上海市东方医院 | Application of Crm1 to stomach cancer diagnosis and treatment |
| WO2015117204A1 (en) * | 2014-02-06 | 2015-08-13 | Immunexpress Pty Ltd | Biomarker signature method, and apparatus and kits therefor |
-
2015
- 2015-11-16 CN CN201510787049.0A patent/CN106701900B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006013561A2 (en) * | 2004-08-02 | 2006-02-09 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Compositions and methods for diagnosing and treating post traumatic stress disorder |
| WO2012173809A2 (en) * | 2011-06-02 | 2012-12-20 | Ehli Erik | Method of identifying de novo copy number variants (cnv) using mz twins discordant for attention problems/disorders |
| CN102998459A (en) * | 2011-09-12 | 2013-03-27 | 香港中文大学 | Biomarker for gastric cancer |
| CN103146688A (en) * | 2012-09-12 | 2013-06-12 | 上海长海医院 | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis |
| CN103937872A (en) * | 2013-01-23 | 2014-07-23 | 上海市东方医院 | Application of Crm1 to stomach cancer diagnosis and treatment |
| WO2015117204A1 (en) * | 2014-02-06 | 2015-08-13 | Immunexpress Pty Ltd | Biomarker signature method, and apparatus and kits therefor |
Non-Patent Citations (1)
| Title |
|---|
| NCBI REFERENCE SEQUENCE: NR_036432.1: "Homo sapiens hect domain and RLD 2 pseudogene 3 (HERC2P3), non-coding RNA", 《GENBANK》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107236817A (en) * | 2017-07-19 | 2017-10-10 | 广州医科大学附属第五医院 | The application of LncRNA ENST00000424523.1 and its gene in diagnosis and medicine |
| CN107236817B (en) * | 2017-07-19 | 2020-12-25 | 广州医科大学附属第五医院 | LncRNA ENST00000424523.1 and application of LncRNA ENST00000424523.1 gene in diagnostic and therapeutic drugs |
| CN107727859A (en) * | 2017-10-06 | 2018-02-23 | 南京普氟生物检测技术有限公司 | A kind of serum I FN γ and LncRNAs composition is used for the purposes for preparing cancer diagnosis reagent box |
| CN108034722A (en) * | 2017-12-13 | 2018-05-15 | 广州医科大学附属肿瘤医院 | A kind of lncRNA SGOL1-AS1 are in the application as diagnosing gastric cancer marker |
| CN108559779A (en) * | 2018-06-13 | 2018-09-21 | 中国医学科学院北京协和医院 | Diagnosis and treatment marker of the long-chain non-coding RNA as gastric cancer |
| CN108559779B (en) * | 2018-06-13 | 2020-01-14 | 中国医学科学院北京协和医院 | Long-chain non-coding RNA as diagnosis and treatment marker of gastric cancer |
| US10851376B2 (en) | 2018-12-28 | 2020-12-01 | The Florida International University Board Of Trustees | Long noncoding RNAs in pulmonary airway inflammation |
| CN110387372A (en) * | 2019-07-31 | 2019-10-29 | 宜春莲泽生物科技发展有限公司 | LncRNA is inhibited to express the application in curing gastric cancer |
| CN110387372B (en) * | 2019-07-31 | 2022-12-13 | 济南爱新卓尔医学检验有限公司 | Application of lncRNA (long non-coding ribonucleic acid) expression inhibition in gastric cancer treatment |
| CN110951884A (en) * | 2019-12-31 | 2020-04-03 | 北京泱深生物信息技术有限公司 | New application of LINC02166 in diagnosis and treatment of gastric cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106701900B (en) | 2020-03-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106701900A (en) | Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer | |
| CN102985558B (en) | For composition and the method for the micro-RNA expression spectrum analysis of hepatocellular carcinoma | |
| CN103146688A (en) | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis | |
| CN107447033A (en) | A kind of diagnosis of colorectal carcinoma biomarker and its application | |
| CN102892898B (en) | For the diagnostic kit containing microRNA biomarker and the method for diagnosis of hepatoma | |
| CN107760784B (en) | Application of circular RNA circ-FOXP1 | |
| CN104818334B (en) | Relevant Microrna is shifted with adenocarcinoma of lung | |
| CN107630092A (en) | The 3p of miR 505 are applied to diagnosis, prognosis and the treatment of prostate cancer with osseous metastasis | |
| CN109468382A (en) | Application of the lncRNA in adenocarcinoma of lung diagnosis and treatment | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| CN107475386B (en) | Long-chain non-coding RNA marker for diagnosis and treatment osteosarcoma | |
| CN107058480B (en) | Long-chain non-coding RNA marker for diagnosing adenocarcinoma of lung | |
| CN108841955A (en) | Application of the C22orf41 as Pancreatic Cancer Tumor Markers object | |
| CN114517204B (en) | CircPOLK for tumor treatment target and diagnosis biomarker and application thereof | |
| CN104774966B (en) | Adenocarcinoma of lung miRNA labels | |
| CN105907757A (en) | Application and related drug of LINC00052 gene | |
| CN108998532A (en) | A kind of diagnosis and treatment marker of rectal adenocarcinoma | |
| CN105624325A (en) | Marker for diagnosing and treating lung adenocarcinoma | |
| CN106701902A (en) | FOXR2 gene and application of expression product to diagnosis and treatment of liver cancer | |
| CN105603117B (en) | MiR-3613 is used to distinguish lung squamous cancer transfer and non-diverting miRNA marker | |
| CN109224076B (en) | Gene miR-140-3P related to lung cancer diagnosis and treatment, and mimics and application thereof | |
| CN109486817A (en) | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnoses and treatment cholangiocarcinoma | |
| CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
| CN107184983B (en) | Diagnosis and treatment target for lung adenocarcinoma | |
| CN105603115B (en) | Lung squamous cancer shifts diagnosis and treatment marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |