CN111455058A

CN111455058A - Tumor marker related to breast cancer tumor, application and kit

Info

Publication number: CN111455058A
Application number: CN202010463667.0A
Authority: CN
Inventors: 王明军; 赵蔚
Original assignee: Shenzhen Innovation Immunotechnology Co ltd; Shenzhen Innovation Conversion Medical Science Research Institute
Current assignee: Shenzhen Innovation Immunotechnology Co ltd; Shenzhen Innovation Conversion Medical Science Research Institute
Priority date: 2020-05-27
Filing date: 2020-05-27
Publication date: 2020-07-28

Abstract

The invention discloses a tumor marker related to breast cancer tumor, application and a kit, and relates to the technical field of tumor molecular diagnosis. The inventor researches and discovers that the plant homeodomain zinc finger protein 20(PHF20) is highly expressed in breast cancer. After the shRNA gene silencing method is used for down-regulating the gene, the gene has obvious inhibiting effect on the tumor formation of the breast cancer cells. This suggests that PHF20 can be a target for drug regulation in addition to being a breast cancer marker. The invention provides a new biomarker for treating and diagnosing breast cancer. The PHF20 serving as a tumor marker of the breast cancer can be used for preparing a kit for auxiliary diagnosis, curative effect prediction and prognosis judgment of the breast cancer, and has important clinical application value.

Description

Tumor marker related to breast cancer tumor, application and kit

Technical Field

The invention relates to the technical field of tumor molecular diagnosis, in particular to a tumor marker related to breast cancer tumor, application and a kit.

Background

Breast cancer is one of the common malignancies in women, with about 11% of women in western countries such as the united states suffering from breast cancer. In China, with the expansion of urbanization and the change of life style, breast cancer patients are rapidly increased at a speed of 160 ten thousand per year, and the number of the patients dying from breast cancer is up to 120 thousand per year.

The main cause of death of breast cancer patients after treatment is drug resistance and metastasis of the tumor, while cancer stem cells have the characteristics of resistance to radiotherapy and chemotherapy and are therefore considered to be the root cause of failure of the treatment regimen due to drug resistance and metastasis of the tumor. Traditional radiotherapy and treatment approaches have been shown to result in the enrichment of breast cancer stem cells in tumors. The new treatment regimens are: according to the marker characteristics of the tumor stem cells, the cancer stem cells are eliminated in a targeted mode, and the signal transduction pathway of the canceration of the breast stem cells is inhibited. However, the existing targeted therapy aiming at markers and signal paths related to breast cancer stem cells has problems: no specific breast cancer stem cell marker with therapeutic value is found at present; signal transduction pathways are also expressed in normal cells, and drugs that inhibit the pathways have also been reported to have serious side effects.

Therefore, it is valuable to find more specific molecular events, and thus provide new strategies for the treatment of breast cancer.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of the prior art, provides a tumor marker related to breast cancer tumor, and provides a new target for treating breast cancer tumor.

The invention also aims to use the tumor marker in preparing a preparation or a kit for auxiliary diagnosis, curative effect prediction and prognosis judgment of breast cancer tumors.

In order to solve the above problems, the present invention proposes the following technical solutions:

the invention provides application of a tumor marker PHF20 as a tumor marker related to breast cancer tumor. The sequence of PHF20 is shown in SEQ ID NO. 5.

In one aspect, the tumor marker associated with breast cancer tumor provided by the invention is PHF20, is one of the constituent proteins of MOF complex, and can identify the dimethylated histone lysine site through Tudor region.

The inventor creatively discovers the relationship between the PHF20 gene and breast cancer through analysis and verification of experimental data, and the PHF20 is expected to be a marker for diagnosis and prognosis judgment of breast cancer tumors, thereby providing a new target for treatment of the breast cancer tumors. Therefore, the PHF20 can be used for preparing auxiliary diagnosis, curative effect prediction and prognosis judgment preparations for breast cancer tumors, and can also be used for preparing auxiliary diagnosis, curative effect prediction and prognosis judgment kits for breast cancer tumors.

The invention also provides a kit for auxiliary diagnosis, curative effect prediction and prognosis judgment of breast cancer, which comprises a specific primer of PHF20 and a specific primer of a reference gene GAPDH. The sequence of the specific upstream primer of PHF20 is shown as SEQ ID NO.1, the sequence of the specific downstream primer of PHF20 is shown as SEQ ID NO.2, the sequence of the specific upstream primer of GAPDH is shown as SEQ ID NO.3, and the sequence of the specific downstream primer of GAPDH is shown as SEQ ID NO. 4.

The kit for auxiliary diagnosis, curative effect prediction and prognosis judgment of breast cancer provided by the invention is a real-time fluorescence quantitative PCR detection kit. Specific primers of PHF20 and reference gene GAPDH are suitable for detecting SYBR Green. In addition, the kit also comprises a standard DNA template and a PCR reaction system, wherein the PCR reaction solution in the PCR reaction system is real-time fluorescent quantitative PCR reaction solution and further comprises fluorescent dye. The real-time fluorescent quantitative PCR reaction solution comprises dNTP, Mg2+, Taq enzyme and buffer solution, wherein the fluorescent dye is SYBR Green II, and the Taq enzyme is hot-start enzyme.

The invention also provides a method for detecting PHF20 by using the kit, which comprises the following steps:

1) extracting total RNA of the sample;

2) preparing sample cDNA;

3) PHF20 was quantitatively amplified.

The invention is further illustrated below:

PHF20 is located on chromosome 20 chr20:35771974-35950381, and can be applied to a kit for assisting breast cancer tumor diagnosis.

The real-time fluorescent quantitative PCR detection kit provided by the invention is used for detecting the PHF20 expression levels in the breast cancer tumor of a randomly extracted breast cancer tumor patient and the paired normal breast tissue, and the PHF20 is found to have differential expression in the breast cancer tumor tissue and the paired normal breast tissue and has high expression in the breast cancer tumor tissue. The above results indicate that PHF20 may be a novel diagnostic marker for breast cancer tumors.

The kit for auxiliary diagnosis, curative effect prediction and prognosis judgment of the breast cancer tumor comprises:

(1) extracting total RNA from breast cancer tumor tissue with Trizol reagent, chloroform, isopropanol, 75% ethanol, and enzyme-free water;

(2) reagents for reverse transcription of total RNA into cDNA, including reverse transcription buffer, magnesium chloride, deoxynucleotide triphosphate base, RNase inhibitor, MM L V reverse transcriptase and random primer;

(3) the reagents required by the real-time fluorescence quantitative PCR of cDNA comprise PHF20 real-time fluorescence quantitative PCR specific primers, GAPDH internal reference specific PCR primers, real-time fluorescence quantitative SYBR dye and no enzyme water, wherein the PHF20 specific PCR primers comprise ① PHF20 upstream primer (SEQ ID NO.1) ② PHF 20-downstream primer (SEQ ID NO.2), and the GAPDH internal reference specific PCR primers comprise ① GAPDH upstream primer (SEQ ID NO.3) ② GAPDH downstream primer (SEQ ID NO. 4).

The invention discovers and proves that the PHF20 gene has high expression in histiocyte of breast cancer tumor, and can be used as a novel breast cancer tumor diagnosis marker or a drug target. The invention provides a powerful molecular biology tool for the auxiliary diagnosis of breast cancer tumors, and has profound clinical significance and important popularization and application prospects.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 shows the effect of PHF20 expression on patient survival time;

FIG. 2 shows the expression difference of PHF20 in normal breast tissue, breast cancer tissue and invasive breast cancer;

FIG. 3 shows the difference in expression of PHF20 in breast cancer cell lines MCF-7, HTB21, MDA231, HTB23, HTB25, HTB27, HTB123, MDA-MB-436, HTB123, MDA-MB-453, HTB123, MDA-MB-468 versus PBMC cells, MCF-10A cells;

FIG. 4 shows the effect of the knockout of PHF20 gene on breast cancer HTB21 cells and MDA-MB-231 cells (A) and on in vitro neoplasia (B).

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments. It is apparent that the embodiments to be described below are only a part of the embodiments of the present invention, and not all of them. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1: comparison of the relationship between PHF20 Gene expression and survival Rate in Breast cancer patients

In order to understand the expression of PHF20 in the tumor tissue of breast cancer patients and the correlation between the expression level and survival time, we analyzed the expression level of PHF20mRNA in the tumor samples of 302 breast cancer patients in the TCTA database, and we divided the patients into patients with high expression of PHF20 (42) and patients with low expression of PHF20 (260) according to the mean value of the expression level of PHF20 of all the patients as the demarcation point, and found that the higher the expression level of PHF20 is, the shorter the survival time of the patients is, both are negative correlation (FIG. 1) in combination with the follow-up data of the patients, and the above results suggest that PHF20 can be used as an index for evaluating the prognosis of the patients.

Example 2: the kit for auxiliary diagnosis, curative effect prediction and prognosis of breast cancer tumors provided by the invention is used for detecting the expression of the PHF20 gene in normal breast tissues, breast cancer tissues and invasive breast cancers.

Wherein, the kit for auxiliary diagnosis, curative effect prediction and prognosis judgment of the breast cancer tumor comprises:

(1) the reagent for extracting total RNA from breast cancer tumor comprises Trizol reagent, chloroform, isopropanol and DEPC water.

(2) Reagents for reverse transcription of total RNA into cDNA: a promega reverse transcription kit (GoScript TMReverse Transcriptase, A5003) comprises GoScript TM5X Reaction Buffer, MgCl2, PCR NucleotideMix, Recombinant Ribonuclense Inhibitor, GoScript TMReverse Transcriptase, Nuclear-Free Water.

(3) The reagents used for real-time fluorescence quantitative PCR of cDNA comprise PHF 20-specific primers for real-time fluorescence quantitative PCR, specific primers for GAPDH internal reference, real-time fluorescence quantitative SYBR dye (Roche 4887352001L htCycler480SYBRGreen I Master) and DEPC water, wherein the sequences of the primers for fluorescence quantitative PCR are shown in Table 1.

TABLE 1 primer sequences for real-time fluorescent quantitative PCR of cDNA

Numbering	Primer name	Sequence of
			SEQ ID NO 1	PHF20 Forward Primer	GAATCAGCTTTGAAGTGGGAGC
SEQ ID NO 2	PHF20 Reverse Primer	GTTCCAACGCTTGAAATGGATG
			SEQ ID NO 3	GAPDH Forward Primer	GGAGCGAGATCCCTCCAAAAT
SEQ ID NO 4	GAPDH Reverse Primer	GGCTGTTGTCATACTTCTCATGG

The specific detection method comprises the following steps:

1: extracting total RNA of breast cancer tumor and matched normal breast tissue.

(1) Fresh or frozen at-80 deg.C about 20mg, adding 1ml Trizol ice, grinding, cutting tissue with scissors, adding 400ul Trizol to prevent overflow, grinding thoroughly, and filling to 1 ml. Standing at room temperature for 5-10 min.

(2) Trizol and trichloromethane according to the volume ratio of 5: 1, adding Trizol into trichloromethane, carrying out vortex oscillation for 30s, standing at room temperature for 5min, and centrifuging at 12000g and 4 ℃ for 15 min.

(3) Sucking about 400ul of supernatant, taking care to avoid sucking intermediate solid layer, adding 400ul of isopropanol, mixing up and down, standing at room temperature for 10min without vigorous shaking, and centrifuging at 12000g speed at 4 deg.C for 10 min.

(4) The supernatant was aspirated, 1ml of 75% strength ethanol prepared with DEPC was added, the precipitate was gently knocked off on a laboratory bench, and centrifuged at 7500g at 4 ℃ for 5 min.

(5) Absorbing supernatant, standing at room temperature for 5-10min, adding PEPC water of about 70 deg.C to dissolve RNA, and storing at-80 deg.C.

(6) Mixing with 1% agarose gel, adding 1ul 6X L loading Buffer into 1ug RNA, performing electrophoresis for about 20min, storing by gel electrophoresis imaging system, and analyzing.

(7) And (3) detecting the concentration and purity of the RNA by using the Nano Drop, adjusting zero by using DEPC water, fully and uniformly mixing the RNA sample, dripping 2ul of the sample on a Nano Drop detection probe, placing a measuring arm, measuring the concentration of the RNA, and recording the ratio of 260/280.

2: the total RNA extracted in step 1 is reversely transcribed into cDNA, and the expression level of PHF20 is detected by real-time fluorescent quantitative PCR.

(1) Reverse transcription of total RNA to cDNA Promega reverse transcription kit was used.

The following system is configured:

system I: 2ug of RNA was dissolved in DEPC water, and 1ul of random primer was added to make up to 10 ul. The mixture was placed on a PCR instrument at 70 ℃ for 5 minutes and immediately ice-cooled for 5 minutes.

The components in system II are shown in table 2:

table 2:

system I and system II were mixed, centrifuged instantaneously and placed in a PCR instrument with the program parameters shown in Table 3.

TABLE 3

	Step1	Step2	Step3	Step4
					Temperature of	25℃	42℃	75℃	4℃
Time of day	5min	1h	15min	∞

(2) Real-time fluorescent quantitative PCR was performed using the Roche L ightCycler480SYBRGreenI Master kit.

The reaction system is shown in the following table 4:

table 4:

name (R)	Volume of
		cDNA	1ul
DEPCE water	1ul
		Upstream primer	1ul
Downstream primer	1ul
		SYBR GREEN	10ul

The instrument adopts Roche 480, and the real-time fluorescent quantitative PCR program is as follows: pre-denaturation at 95 ℃ for 10min, followed by 40 cycles: 95 ℃ for 10s, 60 ℃ for 20s and 72 ℃ for 30 s.

The experimental data adopts a relatively quantitative analysis method, GAPDH is used as an internal reference gene, and the calculation formula is as follows:

ΔCT＝ΔCT-ΔCTGAPDH

Δ Δ CT ═ Δ C cancer tissue- Δ C normal tissue

Relative expression quantity log 2-delta CT

The relative expression of real-time fluorescent quantitative PCR PHF20 was analyzed by software SPSS 18.0.

As a result: the PHF20 expression was significantly increased in breast cancer tumor tissues compared to paired normal tissues, as shown in fig. 2.

Example 3: the kit for auxiliary diagnosis, curative effect prediction and prognosis of breast cancer tumors provided by the invention is used for detecting the expression of the PHF20 gene in different breast cancer cell lines.

Detecting the expression state of PHF20 in different cells, wherein the breast cancer cells are MCF-7, HTB21, MDA231, HTB23, HTB25, HTB27, HTB123, MDA-MB-436, HTB123, MDA-MB-453, HTB123 and MDA-MB-468; the normal cells are: PBMC and MCF-10A.

The procedure was as in example 2.

And (3) detection results: referring to fig. 3, it can be seen that 12 breast cancer cells all showed high expression of PHF20 compared to normal cells, and this expression difference can be used as a reference for judging breast cancer tumors.

Example 4: analysis of PHF20 expression in relation to clinical characteristics of cases

The total cases were ranked from low to high according to the relative expression value 2- Δ Δ CT of PHF20 in breast cancer and paired normal tissues, and 32 cases before and after the ranking were divided into low expression group and high expression group. Based on the above grouping, the relationship between the expression level of the target PHF20 and the sex, age, lesion site, tumor size, differentiation grade, lymph node metastasis and TNM stage of the case was analyzed. From the P values, PHF20 high expression in breast cancer was statistically not different from breast tumor age, sex, lesion site, tumor size, N grade, TNM grade, lymph node invasion, distant metastasis, but closely related to tumor differentiation degree, T grade, see table 5.

TABLE 5PHF20 clinical information Table

Example 5

The effect of the PHF20 gene on the growth of breast cancer HTB21 cells and MDA-MB-231 cells and on in vitro neoplasia was examined.

Experimental method to study the effect of PHF20 on tumorigenicity of breast cancer, we first constructed HTB21 cells and MDA-MB-231 cells with PHF20 gene silencing (PHF20 KD). by culturing HTB21 cells or MDA-MB-231 cells in T25 culture flasks, 5m L virus solution and 5 mu L polybrene capable of expressing PHF20shRNA were added when the cell density was 50% -60%, and the mixture was placed at 37 ℃ and 5% CO₂Culturing in constant temperature incubator for 6 hr, discarding culture solution mixed with virus solution, changing into complete culture medium, placing at 37 deg.C and 5% CO₂Culturing in a constant temperature incubator. HTB21 cells and MDA-MB-231 cells with PHF20 gene silenced (PHF20KD) are obtained by puromycin screening.

Next, we cultured wild-type (control) and PHF20KD cells in mmospere serum-free suspension medium and in low adhesion 96-well plates for suspension spheronization, observed under a microscope and photographed 7 days later (panel a of fig. 4), counted and statistically shown to significantly inhibit the tumorigenic capacity of breast cancer cells after down-regulating their expression by PHF20 silencing.

Finally, we placed 5-week-old female Balb/c nude mice in individually ventilated SPF-grade micro-isolator cages each mouse was injected subcutaneously on the right side with 10 μ L in PBS⁶After that, the size of the tumor was measured periodically with a caliper every 2 days by measuring the length and width of the tumor, the tumor volume was calculated as volume (mm3) ═ length × width × width/2 after the mice were sacrificed, the transplanted tumor was taken out for photographing and weighing, and as a result, it was found that the tumorigenic ability of PHF20KD MDA-MB-231 cells in the immunodeficient mice was significantly weaker than that of the control group (part B of fig. 4).

The results of the experiment are shown in FIG. 4.

The results show that PHF20 can be used as a novel molecular marker for assisting breast cancer tumor diagnosis. Provides a powerful molecular biology tool for the auxiliary diagnosis of the breast cancer, and has profound clinical significance and important popularization and application prospects.

In the above embodiments, the descriptions of the respective embodiments have respective emphasis, and for parts that are not described in detail in a certain embodiment, reference may be made to related descriptions of other embodiments.

While the invention has been described with reference to specific embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.

Sequence listing

<110> Shenzhen Shennuo Shineno Hospital, Shenzhen Shennuo Immunity Co., Ltd

<120> tumor marker related to breast cancer tumor, application and kit

<130>0429

<141>2020-05-27

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>22

<212>DNA

<213> Artificial sequence (artificial)

<400>1

gaatcagctt tgaagtggga gc 22

<210>2

<211>22

<212>DNA

<213> Artificial sequence (artificial)

<400>2

gttccaacgc ttgaaatgga tg 22

<210>3

<211>21

<212>DNA

<213> Artificial sequence (artificial)

<400>3

ggagcgagat ccctccaaaa t 21

<210>4

<211>23

<212>DNA

<213> Artificial sequence (artificial)

<400>4

ggctgttgtc atacttctca tgg 23

<210>5

<211>3039

<212>DNA

<213> human (Homo sapiens)

<400>5

atgacaaagc atccacctaa cagacgagga atcagctttg aagtgggagc ccagttggaa 60

gcccgggacc gtttaaaaaa ctggtatcca gctcacatag aagacattga ctacgaggaa 120

ggaaaagtac tcatccattt caagcgttgg aaccatcgtt atgatgagtg gttctgctgg 180

gacagtcctt atttacgccc tttagagaaa atacagctga ggaaagaggg cttgcatgaa 240

gaggatggat cttctgaatt tcaaataaat gagcaggtcc ttgcttgctg gtctgattgt 300

cgtttttacc cggccaaagt cactgctgtt aacaaggatg gtacttacac tgtgaaattt 360

tatgatggag tagttcagac tgtcaaacat attcatgtca aagctttttc caaagatcag 420

aatattgtgg gtaatgctag gcctaaagaa acagatcaca aaagtctttc atcatctcct 480

gataaacgag agaagtttaa agaacagaga aaagcaacag tgaatgtgaa gaaagacaaa 540

gaagataaac ccttaaagac agaaaagcga cccaagcagc ctgataaaga aggaaagtta 600

atctgttctg aaaaggggaa agtgtcagag aaaagtcttc ccaagaacga gaaggaagac 660

aaggaaaaca tttccgaaaa tgacagagag tattctggag atgcccaagt ggataagaaa 720

cctgaaaatg acattgtgaa gagtccacaa gaaaacttga gggaacccaa aagaaaacga 780

ggcagacccc cttccatagc tcctactgct gtggattcaa actctcaaac tttgcaacca 840

ataacattgg aactgagaag aaggaaaata tcaaaaggat gtgaagtccc attaaaacgt 900

cctcggcttg acaaaaattc atcccaggaa aagtcaaaaa actactcgga aaacactgac 960

aaagacttat cgaggagacg ttcctccagg ctgtccacta atgggaccca tgagatccta 1020

gatcctgact tggttgtatc agatttggtt gatacggatc ctttgcaaga cacgttgtct 1080

agtaccaagg aatctgaaga aggtcagttg aagtctgctt tggaagctgg ccaggtctca 1140

tctgcactga cttgccactc ctttggggat ggatccgggg ctgcaggctt ggagttgaac 1200

tgcccatcaa tgggagaaaa cacgatgaaa acagaaccga cttctcccct tgtggaatta 1260

caagagattt cgactgtgga agtaacaaat acttttaaga aaacagatga ttttgggtca 1320

tctaatgcac cagctgtcga cctagaccat aagtttagat gcaaagttgt ggactgttta 1380

aaatttttcc gcaaagccaa actgttgcac tatcacatga agtatttcca tggaatggag 1440

aagtcactgg agccagaaga gagcccggga aagaggcatg tccaaaccag gggcccttca 1500

gcttcagaca agcccagcca ggagaccctg accaggaagc gggtctctgc cagttcccca 1560

actacaaaag acaaggaaaa gaataaagag aagaaattca aggagtttgt gagagtgaag 1620

ccaaagaaga aaaagaaaaa gaaaaagaaa accaaacctg aatgcccctg cagtgaggag1680

atcagtgaca cctcccagga accttctcca cccaaggcat ttgctgttac caggtgtggg 1740

tcctcacaca agccaggggt ccatatgagc ccgcagcttc atggcccaga atctggacac 1800

cacaaaggga aagtgaaagc attggaggag gataatttga gtgagtcctc ttctgagagc 1860

tttctctgga gtgatgatga gtatggccaa gatgtggatg tgaccaccaa cccagatgag 1920

gaacttgatg gggatgaccg ctatgacttc gaggtggtcc gctgcatctg tgaggtccag 1980

gaggaaaatg acttcatgat tcagtgtgaa gagtgccagt gctggcagca tggggtctgc 2040

atgggattac tggaagaaaa tgtgcccgag aaatacacct gttatgtttg ccaagaccct 2100

ccaggtcaga ggcctggctt caagtactgg tatgacaagg agtggctgag caggggacat 2160

atgcatggcc tggcatttct agaagagaac tactcccatc agaatgccaa gaagatcgtg 2220

gccacccacc agcttcttgg tgatgtgcag agagtgattg aggttctgca tggcctgcag 2280

ctcaagatga gcatcttgca aagccgggag catcctgatc tgccgctgtg gtgccagcct 2340

tggaaacagc actcagggga ggggagatct catttcagaa acatccctgt cactgacacc 2400

aggagcaagg aggaagctcc aagctataga actttgaacg gggcagtgga gaagcccagg 2460

cccctggccc tgcccctgcc gcgttctgtg gaggaatcct atatcaccag tgagcattgc 2520

taccagaagc cccgcgccta ttaccctgcc gtggagcaga agctggtggt ggagacgagg 2580

ggctctgccc tcgacgatgc ggtcaacccc ctccatgaga acggcgatga ttccctttcc 2640

ccgcgcctgg gctggcctct agaccaagac aggagcaagg gggacagtga ccccaaaccc 2700

ggctccccaa aggtgaagga atatgtctcc aaaaaggccc taccagaaga agcccctgct 2760

cggaagctgc tggacagagg tggagagggg ctgctgagct cccagcacca gtggcagttt 2820

aacctgctga cccatgtgga atctcttcag gatgaagtta cgcacaggat ggactccatt 2880

gagaaggagt tggatgtgtt ggagagctgg ctggactaca ctggggaact ggagccccct 2940

gagccgctgg ccaggcttcc gcagctcaag cattgtatca agcagctgct gatggacctg 3000

ggcaaggtgc agcagatcgc cctctgctgc tcaacatga 3039

Claims

1. Use of a tumor marker PHF20 as a tumor marker associated with a breast cancer tumor.

2. A tumor marker associated with a breast cancer tumor, wherein the tumor marker is PHF20, and recognizes a dimethylated histone lysine site through its Tudor region.

3. The use of the tumor marker associated with breast cancer tumor of claim 2 in the preparation of a preparation for the auxiliary diagnosis, prediction of therapeutic effect and prognosis of breast cancer.

4. The use of the tumor marker associated with breast cancer tumor of claim 2 in the preparation of a kit for the auxiliary diagnosis, efficacy prediction and prognosis of breast cancer.

5. A kit for auxiliary diagnosis, curative effect prediction and prognosis judgment of breast cancer is characterized by comprising specific primers of PHF 20.

6. The kit of claim 5, wherein the sequence of the specific upstream primer of PHF20 is shown as SEQ ID No.1, and the sequence of the specific downstream primer of PHF20 is shown as SEQ ID No. 2.

7. The kit of claim 5, further comprising primers specific for the reference gene GAPDH.

8. The kit of claim 7, wherein the sequence of the specific upstream primer of the reference gene GAPDH is shown as SEQ ID NO.3, and the sequence of the specific downstream primer of the reference gene GAPDH is shown as SEQ ID NO. 4.

9. The kit of claim 7, wherein the kit is a real-time fluorescent quantitative PCR detection kit.

10. The use of PHF20 as defined in claim 1 as a drug target for breast cancer.