CN110616229A - Fusion gene of FGFR1 translocation blood disease and detection primer and application thereof - Google Patents
Fusion gene of FGFR1 translocation blood disease and detection primer and application thereof Download PDFInfo
- Publication number
- CN110616229A CN110616229A CN201910977892.3A CN201910977892A CN110616229A CN 110616229 A CN110616229 A CN 110616229A CN 201910977892 A CN201910977892 A CN 201910977892A CN 110616229 A CN110616229 A CN 110616229A
- Authority
- CN
- China
- Prior art keywords
- fgfr1
- fusion gene
- translocation
- tfg
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Oncology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Hospice & Palliative Care (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a fusion gene of FGFR1 translocation blood disease, which is formed by fusing TFG exon8 and FGFR1exon10, wherein the accession number of a TFG gene sequence in GeneBank is NM _006070.6, and the accession number of an FGFR1 gene sequence in GeneBank is NM _ 023110.3; the fusion gene comprises a nucleotide sequence shown in SEQ ID NO. 3. The invention discovers a new fusion gene of FGFR1 translocation hematopathy, designs a specific PCR primer aiming at the fusion gene, enlarges the detection range of the original detection means, can be applied to clinic, can improve the detection rate and the accuracy rate of diagnosing TFG-FGFR1 translocation hematopathy, and provides a basis for diagnosis and typing and molecular targeted therapy.
Description
Technical Field
The invention particularly relates to a fusion gene of FGFR1 translocation hemopathy, and a detection primer and application thereof.
Background
8p11 myeloproliferative syndrome (EMS) is an invasive hematological malignancy, can be developed in all ages, is resistant to traditional chemotherapy schemes for most patients, and is the only measure with potential cure possibility for the diseases by allogeneic hematopoietic stem cell transplantation (allo-HSCT). Because of the low incidence of these diseases, clinicians lack deep knowledge of these diseases, EMS is often misdiagnosed as other hematological tumors, such as chronic myelomonocytic leukemia (CMML), atypical cml (aacml), T lymphoblastic lymphoma accompanied by eosinophilia, myelodysplastic syndrome (MDS), etc., and some patients lose their treatment opportunity because of the marked increase in erythrocytes and misdiagnosed as Polycythemia Vera (PV).
At present, at least 14 FGFR1 partner genes are found at home and abroad, and are CEP110(9q33), ZNF198 (ZYM 2) (13q12), FOP (6q27), TRIM24(7q34), FGFR1OP2(12p11), MYO18A (17q11), BCR (22q11), HERVK (19q13), NUP98(11p15), CUX1(7q22), CPSF6(12p11), TPR (1q25), RFPI (2q37) and RANP 2(2q12), wherein the ZNF198 gene located on 13q12 is the most common, but the research on molecular fragmentation sites and clinical and laboratory characteristics of the genes is lack of large-area data.
The clinical and laboratory characteristics of EMS patients positive for FGFR1 rearrangement were as follows: peripheral leukocyte level is obviously increased and eosinophilia is often accompanied, marrow puncture shows myelogenous hyperproliferation, and positive signs are often superficial lymph node swelling, hepatosplenomegaly and the like. ZNF198 is the most common partner gene of FGFR1, and 30 cases accompanied by t (8;13) (p11; q12) genetic abnormality are reported in total retrieved by NCBI, but most patients are not detected molecularly. The clinical manifestations of these patients at the initial diagnosis are different, and the diagnosis conditions are as follows: acute Lymphoblastic Leukemia (ALL) 2 cases, T lymphoblastic lymphoma 3 cases, MPN4 cases, and T cell non-Hodgkin lymphoma (T-NHL) 1 case. Of the 4 patients diagnosed with malignant lymphoma, 3 patients progressed to acute leukemia in the short term, mostly died within two years of diagnosis, and only a few allogeneic hematopoietic stem cell transplants survived.
From the NCBI database, we searched 15 BCR-FGFR1 positive patients, most of whom rapidly developed leukemic transformation, or were diagnosed as leukemic stages. EMS for the hand gene MYO18A is reported in only 1 case literature, the clinical performance of initial diagnosis is similar to CML, the early diagnosis is the same as the disease case, the early diagnosis is easy to be misdiagnosed as aCML, and the mechanism research of the early diagnosis is not reported yet. The RBPMS gene of the RNA binding protein with various splicing forms, also called hermes, is positioned on chromosome 8p11-12, about 230Kb, the N segment of the gene has an RNA binding sequence which is conserved in vertebrates and insects, the C segment of the gene is rich in an alpha helical structure which has an important function for the sequence specificity of RNA recognition, and a plurality of transcription factors can be combined with the promoter region of the RBPMS gene to regulate the transcription activity of the gene. Previous studies have shown that RBPMS can regulate mature RNA required for cardiac differentiation, and overexpression of RBPMS can cause deletion of some mature RNA encoding cardiac differentiation markers, arrest of overall cardiac morphological development, and also play a regulating role in mRNA metabolism required for renal differentiation. Recent studies have shown that mRNA transcript levels of RBPMS2 are significantly up-regulated in gastrointestinal stromal tumors and do not rely on KIT signaling pathway activation; the RBPMS1 can inhibit the conduction of an AP-1 signal channel and regulate the amplification and migration of breast cancer cells, and the research finds that a new viewpoint is provided for the targeted treatment of tumors. Therefore, accurate diagnosis of FGFR1 gene rearrangement would help improve the understanding and appreciation of the clinical and biological characteristics of such diseases.
At present, high-throughput sequencing is the only detection means capable of determining unknown translocation sites, but high-throughput sequencing is expensive in cost, long in detection period, scarce in detection platforms, high in requirement on sample quality, not beneficial to popularization and is not the preferred detection means for most patients. The method is the most accurate, convenient and economic method for designing a specific PCR primer combination aiming at the known fusion site, carrying out PCR amplification and sequencing after carrying out reverse transcription on RNA extracted from tumor tissues and detecting the specific translocation site of the fusion gene according to the past experience. Therefore, a new pathogenic fusion site is discovered, and then the PCR primer is designed, so that the detection accuracy of the FGFR1 translocation hematopathy can be further improved.
Disclosure of Invention
The invention aims to solve the technical problem of providing a novel fusion gene of FGFR1 translocation hemopathy and a detection primer and application thereof.
In order to solve the technical problems, the invention adopts the following technical scheme:
the invention provides an FGFR1 translocation blood disease fusion gene, which is formed by fusing TFG exon8 and FGFR1exon10, wherein the accession number of a TFG gene sequence in GeneBank is NM _006070.6, and the accession number of an FGFR1 gene sequence in GeneBank is NM _ 023110.3; the fusion gene comprises a nucleotide sequence shown in SEQ ID NO. 3.
The fusion gene is detected and found for the first time in a case of morphological characteristics conforming to the FGFR1 translocation blood disease by a high-throughput sequencing technology.
The second aspect of the invention provides an application of the fusion gene of FGFR1 translocation hemotopathy as a detection target point in preparation of a diagnostic reagent of FGFR1 translocation hemotopathy.
In a third aspect of the present invention, PCR primers for detecting the fusion gene of FGFR1 translocating blood disease are provided, and all primer pairs capable of detecting the fusion gene of the present invention are within the scope of the present invention.
Aiming at the novel fusion gene found by the invention, the inventor designs primers in the exon8 of TFG and the exon10 of FGFR1 respectively, follows the principle of primer design, the primers are preferably designed in a conserved region of template cDNA, the length of the primers is between 15bp and 30bp, the GC content of the primers is between 40 percent and 60 percent, the annealing temperature is preferably close to 72 ℃, complementary sequences do not exist between the primers and the primers, and the amplified band is single and specific.
Through multiple times of debugging and verification by the inventor, the optimal upstream primer is shown as SEQ ID NO.1 (TFG-E8-F: ACTCAGGTTATGGCAGCAAGT) and the optimal downstream primer is shown as SEQ ID NO.2 (FGFR 1-E10-R: ACACGGTTGGGTTTGTCCTT) finally, according to the experimental result of the inventor, the specificity and the sensitivity of the primer combination diagnosis reach 100 percent, and the time is only three working days. The probe combination provided by the invention is used for detecting the TFG-FGFR1 translocation tumor, is convenient, rapid and reliable, has high detectable rate, can be used for preparing a TFG-FGFR1 translocation tumor diagnosis kit, and provides a new tool for rapid and accurate diagnosis of the TFG-FGFR1 translocation tumor.
The fourth aspect of the invention provides an application of the PCR primer in preparing a diagnostic reagent for FGFR1 translocation blood diseases.
The fifth aspect of the invention provides a diagnostic kit for FGFR1 translocation blood diseases, which comprises the PCR primer.
Due to the implementation of the technical scheme, compared with the prior art, the invention has the following advantages:
the invention discovers a new fusion gene of FGFR1 translocation hematopathy, designs a specific PCR primer aiming at the fusion gene, enlarges the detection range of the original detection means, can be applied to clinic, can improve the detection rate and the accuracy rate of diagnosing TFG-FGFR1 translocation hematopathy, and provides a basis for diagnosis and typing and molecular targeted therapy.
Drawings
FIG. 1 is a sequence diagram of TFG-FGFR1 fusion gene sequence successfully detected by applying the primer combination of the invention to verification in the known TFG-FGFR1 fusion tumor.
Detailed Description
In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the invention is further described with the specific embodiments.
Embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used are not indicated by the manufacturer and are commercially available.
Example 1 validation was performed for well-diagnosed cases:
the group of the invention detects a TFG-FGFR1 fusion gene in a case of a translocation blood disease which is morphologically consistent with TFG-FGFR1 by a high-throughput sequencing technology, finds that the gene is formed by fusion of TFG exon8 and FGFR1exon10, and has a nucleotide sequence shown as SEQ ID NO. 3. For this case of high throughput sequenced RNA-seq detecting the TFG exon8-FGFR1exon10 new fusion gene, validation was performed using primers designed by us.
Firstly, RNA extraction:
extraction was performed exactly according to the RNeasy FFPE Kit instructions. Dewaxing: carrying out xylene dewaxing on the collected glass slide, rinsing the glass slide by using absolute ethyl alcohol, scraping the glass slide by using an operation blade after air drying, and putting the glass slide into a 1.5ml EP tube; ② enzymolysis: adding 150 μ L digestive juice, adding 10 μ L proteinase K, mixing, performing enzymolysis at 56 deg.C for 15min, performing enzymolysis at 80 deg.C for 15min, and cooling on ice; ③ adding 16 mu L of DNA enzyme buffer solution, then adding 10 mu L of DNase I, mixing uniformly, standing for 15min at room temperature, centrifuging for 15min at 12000rpm, and taking the supernatant; adding 320 mu L of binding liquid, adding 720 mu L of absolute ethyl alcohol, uniformly mixing, transferring into an adsorption column by 2 times, centrifuging at 8000rpm for 1min, and discarding waste liquid; washing: adding 500 μ L of washing solution, and centrifuging at 8000rpm for 1 min; washing is repeated once, waste liquid is discarded, the adsorption column is transferred into a new 2mL collection tube, and centrifugation is carried out for 5min at 12000 rpm; sixthly, elution: transferring the adsorption column to 1.5mL EP tube, adding 100 μ L eluent, standing at room temperature for 1min, centrifuging at 12000rpm for 1min, measuring concentration and purity of the collected eluent (DNA extract), and storing at-80 deg.C.
Second, reverse transcription PCR RT-PCR
RNA was reverse transcribed using a Kit (K1622, RevertAId First Strand cDNA Synthesis Kit, MBI) as described in the Kit. The PCR amplification primer is a TFG-FGFR1 fusion gene primer combination, namely an upstream primer is shown as SEQ ID NO.1 (TFG-E8-F: actcaggttatggcagcaagt), and a downstream primer is shown as SEQ ID NO.2 (FGFR 1-E10-R: acacggttgggtttgtcctt). The reaction system comprises: mu.L of TaKaRa Ex TaqTMHS solution, 2.5. mu.L of 10 XTaq Buffer (Mg2+ plus), 2. mu.L of dNTP (all available from Takara, Japan), primer concentration of 20. mu. mol/L, cDNA template of 100ng, and sterile deionized water to 25. mu.L. The PCR amplification conditions are that after denaturation at 94 ℃ for 3min, 30s at 94 ℃, 30s at 60 ℃ and 1min at 72 ℃, the cycle is 35 times, and finally extension is carried out for 5min at 72 ℃. The PCR product was visualized under UV light after 3% agarose, 100V, electrophoresis, ethidium bromide staining, and sequencing.
As a result: the primer PCR of the invention can be used to see a single specific electrophoresis band, the amplified product is sequenced to obtain a TFG exon8-FGFR1exon10 fusion gene sequence (figure 1), and all sequences of the amplified product are as follows: actcaggttatggcagcaagtatgtctgcttttgatcctttaaaaaaccaagatgaaatcaataaaaatgttatgtcagcgtttggcttaacagatgatcaggtttcagggccacccagtgctcctgcagaagatcgttcaggaacacccgacagcattgcttcctcctcctcagcagctcacccaccaggcgttcagccacagcagccaccatatacaggagctcagactcaagcaggtcagattgaaggtcagatgtaccaacagtaccagcaacaggccggctatggtgcacagcagccgcaggctccacctcagcagcctcaacagtatggtattcagtattcagcaagctatagtcagcagactggacctcaacaacctcagcagttccagggatatggccagcaaccaacttcccaggcaccagctcctgccttttctggtcagcctcaacaactgcctgctcagccgccacagcagtaccaggtgtctgctgactccagtgcatccatgaactctggggttcttctggttcggccatcacggctctcctccagtgggactcccatgctagcaggggtctctgagtatgagcttcccgaagaccctcgctgggagctgcctcgggacagactggtcttaggcaaacccctgggagagggctgctttgggcaggtggtgttggcagaggctatcgggctggacaaggacaaacccaaccgtgt (SEQ ID NO.3), which proves that the primer combination designed by the project is reliable and sensitive, the primer can successfully amplify the target band, and the band is single and specific.
Example 2 test for control group cases
We performed the detection using the primer combination of example 1 of the present invention for 30 well-diagnosed control cases, and the RNA extraction, reverse transcription PCR and sequencing methods were the same as above.
As a result: the primer combination designed by the invention is used for detection, and the TFG-FGFR1 fusion gene is not detected, so that the primer specificity designed by the project is high.
Evaluation: the primer combination of the invention supplements the original FGFR1 translocation blood disease fusion gene primer, expands the type of the FGFR1 translocation blood disease fusion gene and increases the detection rate of diagnosing the tumor by an RT-PCR method.
The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.
Sequence listing
<110> Suzhou university
<120> fusion gene of FGFR1 translocation blood disease, detection primer and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 1
actcaggtta tggcagcaag t 21
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 2
acacggttgg gtttgtcctt 20
<210> 3
<211> 728
<212> DNA
<213> human (Homo sapiens)
<400> 3
actcaggtta tggcagcaag tatgtctgct tttgatcctt taaaaaacca agatgaaatc 60
aataaaaatg ttatgtcagc gtttggctta acagatgatc aggtttcagg gccacccagt 120
gctcctgcag aagatcgttc aggaacaccc gacagcattg cttcctcctc ctcagcagct 180
cacccaccag gcgttcagcc acagcagcca ccatatacag gagctcagac tcaagcaggt 240
cagattgaag gtcagatgta ccaacagtac cagcaacagg ccggctatgg tgcacagcag 300
ccgcaggctc cacctcagca gcctcaacag tatggtattc agtattcagc aagctatagt 360
cagcagactg gacctcaaca acctcagcag ttccagggat atggccagca accaacttcc 420
caggcaccag ctcctgcctt ttctggtcag cctcaacaac tgcctgctca gccgccacag 480
cagtaccagg tgtctgctga ctccagtgca tccatgaact ctggggttct tctggttcgg 540
ccatcacggc tctcctccag tgggactccc atgctagcag gggtctctga gtatgagctt 600
cccgaagacc ctcgctggga gctgcctcgg gacagactgg tcttaggcaa acccctggga 660
gagggctgct ttgggcaggt ggtgttggca gaggctatcg ggctggacaa ggacaaaccc 720
aaccgtgt 728
Claims (6)
1. A fusion gene of FGFR1 translocation hemotopathy, which is characterized in that: the fusion gene is formed by fusing TFG exon8 and FGFR1exon10, the accession number of the TFG gene sequence in GeneBank is NM-006070.6, and the accession number of the FGFR1 gene sequence in GeneBank is NM-023110.3; the fusion gene comprises a nucleotide sequence shown in SEQ ID NO. 3.
2. The application of the fusion gene of FGFR1 translocation hemotopathy of claim 1 as a detection target in preparing a diagnostic reagent of FGFR1 translocation hemotopathy.
3. PCR primers for detecting the fusion gene of FGFR1 translocation blood disease according to claim 1.
4. The PCR primer of claim 3, wherein: the upstream primer is shown as SEQ ID NO.1, and the downstream primer is shown as SEQ ID NO. 2.
5. Use of the PCR primers of claim 3 or 4 in the preparation of a diagnostic reagent for FGFR1 translocation blood disease.
6. A diagnostic kit for FGFR1 translocation blood disease, which is characterized in that: the diagnostic kit comprises the PCR primer of claim 3 or 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910977892.3A CN110616229A (en) | 2019-11-20 | 2019-11-20 | Fusion gene of FGFR1 translocation blood disease and detection primer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910977892.3A CN110616229A (en) | 2019-11-20 | 2019-11-20 | Fusion gene of FGFR1 translocation blood disease and detection primer and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110616229A true CN110616229A (en) | 2019-12-27 |
Family
ID=68925732
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910977892.3A Pending CN110616229A (en) | 2019-11-20 | 2019-11-20 | Fusion gene of FGFR1 translocation blood disease and detection primer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110616229A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111471770A (en) * | 2020-05-07 | 2020-07-31 | 南京实践医学检验有限公司 | Kit and method for detecting leukemia fusion gene based on multiple fluorescence RT-PCR |
| CN111549043A (en) * | 2020-06-09 | 2020-08-18 | 苏州大学附属第一医院 | Fusion gene of RARA-related variant APL and detection primer and application thereof |
| CN112063722A (en) * | 2020-09-29 | 2020-12-11 | 苏州大学 | Fusion gene of PDGFRB translocation hemopathy, detection primer and application thereof |
| CN112094860A (en) * | 2020-09-09 | 2020-12-18 | 苏州大学 | CTCF-ETO2 blood disease fusion gene and detection primer and application thereof |
| CN117165609A (en) * | 2023-09-06 | 2023-12-05 | 上海新培晶医学检验所有限公司 | CBFA2T3-NAT16 fusion gene, detection primer and application thereof |
-
2019
- 2019-11-20 CN CN201910977892.3A patent/CN110616229A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| FREDRIK MERTENS等: "Gene Fusions in Soft Tissue Tumors: Recurrent and Overlapping Pathogenetic Themes", 《 GENES CHROMOSOMES CANCER》 * |
| KLARISARIKOVA等: "Global Survey of Phosphotyrosine Signaling Identifies Oncogenic Kinases in Lung Cancer", 《CELL》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111471770A (en) * | 2020-05-07 | 2020-07-31 | 南京实践医学检验有限公司 | Kit and method for detecting leukemia fusion gene based on multiple fluorescence RT-PCR |
| CN111549043A (en) * | 2020-06-09 | 2020-08-18 | 苏州大学附属第一医院 | Fusion gene of RARA-related variant APL and detection primer and application thereof |
| CN112094860A (en) * | 2020-09-09 | 2020-12-18 | 苏州大学 | CTCF-ETO2 blood disease fusion gene and detection primer and application thereof |
| CN112063722A (en) * | 2020-09-29 | 2020-12-11 | 苏州大学 | Fusion gene of PDGFRB translocation hemopathy, detection primer and application thereof |
| CN112063722B (en) * | 2020-09-29 | 2023-02-07 | 苏州大学 | Fusion gene of PDGFRB translocation hemopathy, detection primer and application thereof |
| CN117165609A (en) * | 2023-09-06 | 2023-12-05 | 上海新培晶医学检验所有限公司 | CBFA2T3-NAT16 fusion gene, detection primer and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110616229A (en) | Fusion gene of FGFR1 translocation blood disease and detection primer and application thereof | |
| KR20170016490A (en) | Prostate cancer detection kit or device, and detection method | |
| CN109182527B (en) | Interferon related kit for prognosis evaluation and chemotherapy effect prediction in glioma | |
| CN107779504B (en) | MicroRNA molecular marker for colorectal cancer and application thereof | |
| CN105296659A (en) | Gene marker related to ischemic stroke | |
| CN102994628A (en) | Primer group for detecting ALK-1 (activin receptor type II-like kinase-1) gene mutation, and application thereof as well as kit comprising primer group | |
| CN108192974B (en) | Application of long-chain non-coding RNA LINC00842 as biomarker in preparation of lung adenocarcinoma prognosis detection preparation | |
| CN102776286A (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN109402262B (en) | PCR detection kit for auxiliary diagnosis of neuroblastoma and method for detecting miR-199a-3p expression level | |
| CN109913482B (en) | PIK3CA-I874R mutant gene and application thereof in auxiliary diagnosis of breast cancer | |
| CN105567861A (en) | Application of IFI27 as coronary heart disease diagnosis marker | |
| CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
| CN107254546B (en) | SNP marker related to breast cancer neoadjuvant chemotherapy curative effect and application thereof | |
| CN110564850A (en) | EWSR1-TFEB fusion gene and detection primer and application thereof | |
| CN109022466B (en) | ACTA2-MITF fusion gene and detection primer and application thereof | |
| CN109182528B (en) | Glioblastoma multiforme auxiliary diagnosis and prognosis evaluation kit based on ITGB5 gene and use method thereof | |
| CN110499368A (en) | One kind SNP marker relevant to carcinoma of mouth prognosis prediction and its application | |
| CN103045722B (en) | Detection kit of disease-causing gene CRYGD of crystalline congenital cataract | |
| CN109913481B (en) | PIK3CA gene g.179224821G & gtA mutation and application thereof in breast cancer auxiliary diagnosis | |
| CN110184353B (en) | SNP marker related to esophagus cancer patient prognosis and application thereof | |
| CN108676880B (en) | Human serum AFP negative hepatocellular carcinoma detection kit | |
| CN110295232B (en) | microRNA biomarkers for colorectal cancer | |
| CN111154883B (en) | Breast cancer related gene PIK3CA site g.179220986A & gtT mutant and application thereof | |
| CN112094860A (en) | CTCF-ETO2 blood disease fusion gene and detection primer and application thereof | |
| CN112430648A (en) | Oligonucleotide, method and kit for detecting ETV6-RUNX1 fusion gene in sample |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |