CN112063722A - Fusion gene of PDGFRB translocation hemopathy, detection primer and application thereof - Google Patents

Abstract

The invention relates to a PDGFRB translocation blood disease fusion gene, which is formed by fusing CSNK2A1 exon4 and PDGFRB exon12, wherein the accession number of CSNK2A1 gene sequence in GeneBank is NM-177559.3, and the accession number of PDGFRB gene sequence in GeneBank is NM-002609.4; the fusion gene comprises a nucleotide sequence shown in SEQ ID NO. 3. The invention discovers a new fusion gene of the PDGFRB translocation hemopathy, designs a specific PCR primer aiming at the fusion gene, enlarges the detection range of the original detection means, can be applied to clinic, can improve the detection rate and the accuracy rate of diagnosing the CSNK2A1-PDGFRB translocation hemopathy, and provides a basis for diagnosis and typing and molecular targeted therapy.

Description

Fusion gene of PDGFRB translocation hemopathy, detection primer and application thereof

Technical Field

The invention particularly relates to a fusion gene of PDGFRB translocation hemopathy, and a detection primer and application thereof.

Background

Myeloproliferative diseases are invasive hematological malignancies which can be attacked in all ages, most patients are resistant to traditional chemotherapy schemes, and allogeneic hematopoietic stem cell transplantation (allo-HSCT) is the only measure for potential cure of the diseases. Due to the low incidence of these diseases, clinicians lack deep knowledge of these diseases and often misdiagnose other hematological tumors, such as chronic myelomonocytic leukemia (CMML), atypical cml (aacml), T lymphoblastic lymphoma with eosinophilia, myelodysplastic syndrome (MDS), and the like.

Clinical and laboratory characteristics of PDGFRB rearrangement positive MPN patients were as follows: peripheral leukocyte level is obviously increased and eosinophilia is often accompanied, marrow puncture shows myelogenous hyperproliferation, and positive signs are accompanied by superficial lymph node swelling, hepatosplenomegaly and the like. Accurate diagnosis of PDGFRB gene rearrangement would help improve the understanding and appreciation of the clinical and biological characteristics of this type of disease.

At present, high-throughput sequencing is the only detection means capable of determining unknown translocation sites, but high-throughput sequencing is expensive in cost, long in detection period, scarce in detection platforms, high in requirement on sample quality, not beneficial to popularization and is not the preferred detection means for most patients. The method is the most accurate, convenient and economic method for designing a specific PCR primer combination aiming at the known fusion site, carrying out PCR amplification and sequencing after carrying out reverse transcription on RNA extracted from tumor tissues and detecting the specific translocation site of the fusion gene according to the past experience. Therefore, a new pathogenic fusion site is discovered, and the PCR primer is further designed, so that the detection accuracy of the PDGFRB translocation hematopathy can be further improved.

Disclosure of Invention

The invention aims to solve the technical problem of providing a novel fusion gene of PDGFRB translocation hemopathy, and a detection primer and application thereof.

In order to solve the technical problems, the invention adopts the following technical scheme:

the invention provides a fusion gene of PDGFRB translocation hematopathy, which is formed by fusing CSNK2A1 exon4 and PDGFRB exon 12.

Preferably, the fusion gene comprises a nucleotide sequence shown in SEQ ID NO.3 or a nucleotide sequence with more than 80% homology with the nucleotide sequence.

Further preferably, the fusion gene comprises a nucleotide sequence having homology of 85% or more with the nucleotide sequence shown in SEQ ID NO.3, further preferably 90% or more, further preferably 95% or more, and most preferably 98% or more.

Preferably, the CSNK2A1 gene sequence has the accession number NM-177559.3 in GeneBank.

Preferably, the PDGFRB gene sequence has the accession number NM-002609.4 in GeneBank.

The fusion gene is detected and found for the first time in a PDGFRB translocation blood disease case with the morphology conforming to the characteristics of PDGFRB rearrangement positive MPN by a high-throughput sequencing technology.

The second aspect of the invention provides an application of the fusion gene of PDGFRB translocation hemopathy as a detection target in preparing a diagnostic reagent for PDGFRB translocation hemopathy.

In a third aspect of the present invention, PCR primers for detecting a fusion gene of PDGFRB translocating hematological disorder are provided, wherein one primer is designed with CSNK2a1 exon4 as a target gene, and the other primer is designed with PDGFRB exon12 as a target gene. All primer pairs capable of detecting the fusion gene of the present invention are within the scope of the present invention.

Preferably, the length of the primer is between 15bp and 30bp, the GC content of the primer is between 40 percent and 60 percent, the annealing temperature is between 58 ℃ and 62 ℃, and a complementary sequence does not exist between the primer and the primer.

Preferably, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.1, or has 80% or more homology thereto, more preferably 85% or more homology thereto, even more preferably 90% or more homology thereto, even more preferably 95% or more homology thereto, and most preferably 98% or more homology thereto.

Preferably, the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.2, or has 80% or more homology thereto, more preferably 85% or more homology thereto, even more preferably 90% or more homology thereto, even more preferably 95% or more homology thereto, and most preferably 98% or more homology thereto.

Aiming at the novel fusion gene found by the invention, the inventor designs primers in the exon4 of CSNK2A1 and the exon12 of PDGFRB respectively, follows the design principle of the primers, the primers are preferably designed in a conserved region of a template cDNA, the length of the primers is between 15bp and 30bp, the GC content of the primers is between 40 percent and 60 percent, the annealing temperature is preferably close to 60 ℃, complementary sequences do not exist between the primers and the primers, and an amplification band is single and specific.

Through multiple times of debugging and verification by the inventor, the optimal upstream primer is shown as SEQ ID NO.1 (CSNK2A1-F: GTGCCAAGCAGGGCCAGAGT) and the optimal downstream primer is shown as SEQ ID NO.2 (PDGFRB-R: AGGGTGCGTCCCAGCACAAG), according to the experimental result of the inventor, the specificity and the sensitivity of the primer combination diagnosis reach 100 percent, and the time is only three working days. The probe combination provided by the invention is used for detecting the CSNK2A1-PDGFRB translocation tumor, is convenient, rapid and reliable, has high detection rate, can be used for preparing a CSNK2A1-PDGFRB translocation tumor diagnosis kit, and provides a new tool for rapid and accurate diagnosis of the CSNK2A1-PDGFRB translocation tumor.

The fourth aspect of the invention provides an application of the PCR primer in preparing a diagnostic reagent for PDGFRB translocation hematopathy.

The fifth aspect of the invention provides a diagnostic kit for PDGFRB translocation hemopathy, which comprises the PCR primer.

Due to the implementation of the technical scheme, compared with the prior art, the invention has the following advantages:

the invention provides a novel fusion gene of PDGFRB translocation hematopathy, and a specific PCR primer is designed aiming at the fusion gene, so that the detection range of the original detection means is enlarged, the detection method can be applied to clinic, the detection rate and the accuracy of diagnosing CSNK2A1-PDGFRB translocation hematopathy can be improved, and a basis is provided for diagnosis and typing and molecular targeted therapy.

Drawings

FIG. 1 is a sequence chart of CSNK2A1-PDGFRB fusion gene detected successfully by applying the primer combination of the invention to verify in known CSNK2A1-PDGFRB fusion type tumors.

Detailed Description

In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the invention is further described with the specific embodiments.

Embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used are not indicated by the manufacturer and are commercially available.

Example 1 validation was performed for well-diagnosed cases:

the team of the invention detects the CSNK2A1-PDGFRB fusion gene in one case of MPN with morphology conforming to PDGFRB rearrangement positive by a high-throughput sequencing technology, and finds that the gene is formed by fusing CSNK2A1 exon4 and PDGFRB exon12, and the nucleotide sequence of the gene is shown as SEQ ID No. 3.

Primers are respectively designed in the exon4 of CSNK2A1 and the exon12 of PDGFRB, the primers are preferably designed in a conserved region of a template cDNA according to the principle of primer design, the length of the primers is between 15bp and 30bp, the GC content of the primers is between 40 percent and 60 percent, the annealing temperature is preferably close to 60 ℃, complementary sequences do not exist between the primers and the primers, and an amplified band is single and specific. Through multiple times of debugging and verification, the optimal upstream primer is shown as SEQ ID NO.1 (CSNK2A1-F: GTGCCAAGCAGGGCCAGAGT) and the optimal downstream primer is shown as SEQ ID NO.2 (PDGFRB-R: AGGGTGCGTCCCAGCACAAG).

For this case of high throughput sequenced RNA-seq detecting the new fusion gene CSNK2A1 exon4-PDGFRB exon12, verification was performed using the above primers we designed.

Firstly, RNA extraction:

collecting heparin anticoagulant 3mL marrow fluid, centrifuging at 1,500rpm for 5min, removing upper layer plasma, adding 5mL erythrocyte lysate into cell precipitate, shaking with oscillator, mixing, standing at room temperature for 5min, centrifuging at 1,500rpm for 5min, and repeating lysis once again. After washing the cell pellet 2 times by adding PBS, all supernatant was removed for subsequent extraction of total cellular RNA.

1) Adding 1mL of Trizol into the cell sediment, and blowing and beating the Trizol up and down by a pipettor to be uniformly mixed; 2) standing on ice for 5min, adding 200 μ L chloroform, and mixing by turning upside down for 30 s; 3) standing on ice for 10min, then centrifuging at 12000g and 4 ℃ for 10min by a centrifuge; 4) taking 500 mu L of the upper-layer water phase by a liquid transfer machine, adding the upper-layer water phase into a ribozyme-free 1.5mL EP tube, adding isopropanol with the same volume, slightly reversing the mixture up and down, uniformly mixing, and standing on ice for at least 10 min; 12000g, centrifuging for 10min by a centrifuge at 4 ℃; 5) discarding all supernatant, adding 1000 μ L of 75% ethanol, and bouncing the precipitate; 6)12000g, 10min, centrifugation at 4 ℃; 7) discarding all supernatant, drying at room temperature for 15min, adding appropriate amount of nuclease-free water to dissolve RNA, and storing at-80 deg.C. 8) And (3) measuring the concentration and purity of the RNA by using a Nano Drop ultraviolet spectrophotometer, zeroing by using nuclease-free water before measurement, washing to be clean after each measurement is finished, wiping off liquid on the surfaces of the upper base and the lower base of the cuvette by using soft lens wiping paper, and then measuring the next sample. Concentration measurement: the RNA concentration was measured by the Nano Drop instrument; purity detection: the RNA purity is determined according to the ratio of OD260 to OD280, and the ideal ratio range is 1.8-2.0. If the ratio is less than 1.8, protein pollution is indicated; if the ratio is >2.0, degradation of RNA is indicated.

Second, reverse transcription PCR RT-PCR

RNA was reverse transcribed using a Kit (K1622, RevertAId First Strand cDNA Synthesis Kit, MBI) as described in the Kit. The PCR amplification primer is a primer combination of the CSNK2A1-PDGFRB fusion gene, namely an upstream primer is shown as SEQ ID NO.1 (CSNK2A1-F: GTGCCAAGCAGGGCCAGAGT), and a downstream primer is shown as SEQ ID NO.2 (PDFGRB-R: AGGGTGCGTCCCAGCACAAG). The reaction system comprises: mu.L of TaKaRa Ex TaqTMHS solution, 2.5. mu.L of 10 XTaq Buffer (Mg2+ plus), 2. mu.L of dNTP (all available from Takara, Japan), primer concentration of 20. mu. mol/L, cDNA template of 100ng, and sterile deionized water to 25. mu.L. The PCR amplification conditions are that after denaturation at 94 ℃ for 3min, 30s at 94 ℃, 30s at 60 ℃ and 1min at 72 ℃, the cycle is 35 times, and finally extension is carried out for 5min at 72 ℃. The PCR product was visualized under UV light after 3% agarose, 100V, electrophoresis, Gel-red staining and sequencing.

As a result: the primers of the invention can be used for detecting a single specific electrophoresis band after PCR, sequencing is carried out on the amplification product to obtain a CSNK2A1 exon4-PDGFRB exon12 fusion gene sequence (figure 1), and the whole sequence of the amplification product is as follows:

GTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAAGTTGTTGTTAAAATTCTCAAGAAGCCACGTTACGAGATCCGATGGAAGGTGATTGAGTCTGTGAGCTCTGACGGCCATGAGTACATCTACGTGGACCCCATGCAGCTGCCCTATGACTCCACGTGGGAGCTGCCGCGGGACCAGCTTGTGCTGGGACGCACCCT (SEQ ID NO.3), which proves that the primer combination designed by the project is reliable and sensitive, the primer can successfully amplify the target band, and the band is single and specific.

Example 2 test for control group cases

We performed the detection of 30 well-diagnosed control cases using the primer combination of the present invention, example 1, and the RNA extraction, reverse transcription PCR and sequencing methods were the same as above.

As a result: the primer combination designed by the invention is used for detection, and the CSNK2A1-PDGFRB fusion gene is not detected, so that the primer specificity designed by the project is high.

Evaluation: the primer combination of the invention supplements the original PDGFRB translocation blood disease fusion gene primer, expands the type of PDGFRB translocation blood disease fusion gene and increases the detection rate of diagnosing the tumor by an RT-PCR method.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> Suzhou university

<120> fusion gene of PDGFRB translocation hemopathy, detection primer and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 1

gtgccaagca gggccagagt 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 2

agggtgcgtc ccagcacaag 20

<210> 3

<211> 344

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 3

gtgccaagca gggccagagt ttacacagat gttaatacac acagacctcg agaatactgg 60

gattacgagt cacatgtggt ggaatgggga aatcaagatg actaccagct ggttcgaaaa 120

ttaggccgag gtaaatacag tgaagtattt gaagccatca acatcacaaa taatgaaaaa 180

gttgttgtta aaattctcaa gaagccacgt tacgagatcc gatggaaggt gattgagtct 240

gtgagctctg acggccatga gtacatctac gtggacccca tgcagctgcc ctatgactcc 300

acgtgggagc tgccgcggga ccagcttgtg ctgggacgca ccct 344

Claims (10)

1. A fusion gene of PDGFRB translocation hemopathy, which is characterized in that: the fusion gene is formed by fusing CSNK2A1 exon4 and PDGFRB exon 12.

2. The fusion gene of PDGFRB translocating blood disease of claim 1, wherein: the fusion gene comprises a nucleotide sequence shown in SEQ ID NO.3 or a nucleotide sequence with homology of more than 80 percent with the fusion gene.

3. The fusion gene of PDGFRB translocating blood disease of claim 1, wherein: the accession number of the CSNK2A1 gene sequence in GeneBank is NM-177559.3.

4. The fusion gene of PDGFRB translocating blood disease of claim 1, wherein: the PDGFRB gene sequence has the accession number NM-002609.4 in GeneBank.

5. Use of the fusion gene of PDGFRB translocation hemopathy as defined in any one of claims 1 to 4 as a detection target in the preparation of a diagnostic reagent for FGFR1 translocation hemopathy.

6. A PCR primer for detecting the fusion gene of PDGFRB translocation disease as described in claim 1, wherein one primer is designed with CSNK2A1 exon4 as the target gene and the other primer is designed with PDGFRB exon12 as the target gene.

7. The PCR primer of claim 6, wherein: the length of the primer is between 15bp and 30bp, the GC content of the primer is between 40 percent and 60 percent, the annealing temperature is between 58 ℃ and 62 ℃, and a complementary sequence does not exist between the primer and the primer.

8. The PCR primer according to claim 6 or 7, characterized in that: the upstream primer is shown as SEQ ID NO.1, or has homology of more than 80 percent with the upstream primer; the downstream primer is shown as SEQ ID NO.2, or has more than 80% homology with the downstream primer.

9. Use of a PCR primer according to any one of claims 6 to 8 in the preparation of a diagnostic reagent for PDGFRB translocating hematological disorders.

10. A diagnostic kit for PDGFRB translocation hemopathy, which is characterized in that: the diagnostic kit comprising the PCR primer of any one of claims 6 to 8.

Images