CN103937806A - Rh blood group DEL phenotype RHD838>A allele and detection method thereof - Google Patents

Abstract

The invention relates to an RHD838>A allele and a detection method thereof, and belongs to the field of analysis and detection technologies in molecular biology. A primer sequence which can amplify a target part including a mutant gene sequence is designed by a PCR-specific primer technology, and PCR amplification selectively and specially aiming at the specific RHD838>A allele is performed on the zone of the target part including the mutant gene sequence by virtue of a gene amplification method. According to the detection method, the gene level is detected by virtue of a molecular biological method which can be used for greatly improving the sensitivity and specificity of the detection and is simple, convenient and rapid. Since different nationalities have difference in the RHD gene, the detection method is designed specially aiming at the RHD838>A allele according to the RHD genetic molecule background of Chinese on the basis of relative researches. The RHD838>A allele and the detection method thereof have significant clinical meaning in overcoming the shortage of the serological technique, and also have wide scientific research and application value.

Description

A kind of Rh blood group DEL type RHD838G > A allelotrope and detection method thereof

Technical field

The present invention relates to a kind of RHD838G>A allelotrope and detection method thereof, be specifically related to a kind of method that is doped in the known mutations gene in wild type gene bunch, belong to molecular biological analysis detection technique field.

Background technology

Rh blood group is the system of the most complicated in human erythrocyte's blood group system, tool polymorphism, is also the main erythrocyte blood type that causes clinical blood transfusion reaction and serious hemolytic disease of newborn.Found at present more than 50 kind of Rh blood group antigen, wherein RhD antigen has very strong immunogenicity, is to be produced by RHD genes encoding, is the emphasis of blood group research.D antigen whether detected according to Surface of Erythrocytes clinically, Rh blood group antigen are divided into the RhD positive and the negative two large classes of RhD.

Japanese scholars Okubo in 1984 etc. are to further detecting by absorption and elution test through the RhD negative sample of direct agglutination test and indirect antihuman globulin test (IAT) confirmation, find that a part of individual erythrocyte surface still can detect the existence of D antigen, be referred to as D and diffuse type (DEL type).It belongs to the one of weak D type, antigenicity extremely a little less than.Compared with white people, DEL type ratio in Chinese RhD Population with Negative is very high.Shao etc. show ShenZhen,GuangDong area large sample investigation result, DEL type China by the RhD Population with Negative of conventional serological identification in shared ratio be about 26%, the ratio of Taiwan's scholars report this area is 32.6%.Wagner etc. carry out large sample investigation and find that DEL type is rare in the European white race.Different areas are not agnate because there being the difference of genetic background, and the genotype of DEL blood group D antigen also exists larger difference.Become in recent years the focus of erythrocyte blood type research about the research of DEL blood group RHD gene.Finding successively has new allelotrope to exist in DEL blood group RHD gene, and has obvious hereditary property.

At present, the conventional sense method of DEL blood group D antigen is to adopt serology salt water law and indirect antihuman globulin test and absorption and elution test to identify.Also there is unstable in the method not only complex operation, result.In addition,, due to the impact of disease or other factors, some individual red corpuscle result in the time of serology shaping is difficult to judgement; Chronic long blood transfusion patients Serological presents the phenomenon in " the mixing visual field " sometimes; When obtaining the red corpuscle of sample or red corpuscle sample when not enough, as fetal blood group qualification, forensic identification hangover etc., serology detection can not obtain correct result.

By the method for immunoserology, the detection of DEL blood group is depended on specificity and the working method of the Antibodies Against Rhesus D Antigen of use, reliability is lower, and because complex steps is not suitable for clinical large-scale application, method is that the method that applying gene detects detects DEL blood group reliably.Now determine DEL blood group D antigen gene type by detecting DNA, not only in the deficiency that makes up serological technique, there is important clinical practice meaning, be worth but also there is research application widely.DEL blood group D antigen constantly has new allelotrope to be found in recent years, this research group has also found the neomorph of 1 routine DEL blood group RHD genotype RHD838G>A sudden change recently, and has set up corresponding detection method for newfound RHD838G>A allelotrope.

Summary of the invention

The object of the present invention is to provide Rh blood group DEL type RHD838G>A mutator gene and detection method thereof, carry out Rh blood group DEL type gene type assay the phenotypic evaluation index as DEL blood group by detecting RHD838G>A transgenation.

Detection method of the present invention is to utilize the change in the specific sequence site of mankind DEL blood group different genotype, designs primer sequence targetedly, carries out that polymerase chain reaction completes.

According to technical scheme provided by the invention, a kind of Rh blood group DEL type RHD838G>A allelotrope, its wild type gene DNA sequence dna is as shown in SEQ ID NO:1, and mutator gene DNA sequence dna is as shown in SEQ ID NO:2.

The sequence that obtains nucleotide sequence and RHD wild-type from testing sample compares, and whether check sudden change is 838G → A sudden change.The coded protein of described RHD mutator gene has the change of 280A → T aminoacid sequence.

The allelic detection method of described Rh blood group DEL type RHD838G>A, optionally increases to the detection zone of the target site that comprises mutator gene by gene amplification method, detects thus having or not of this mutator gene; Described detection method is as follows:

(1) extract DNA in sample to be checked;

(2) taking this DNA as template, carry out PCR reaction near the PCR primer of coding region design RHD838G>A mutator gene, obtain PCR reaction product;

(3) measure the nucleotide sequence composition of PCR reaction product;

(4) sequence of nucleotide sequence and RHD wild type gene is compared, determined whether 838G → A sudden change.

By database BLAST comparison function, translate to determine whether to exist 280A → T amino acid mutation site according to normal single open reading frame.The nucleotide sequence composition of described PCR reaction product can check order PCR reaction product by sequenator.

The allelic detection method of described Rh blood group DEL type RHD838G>A, concrete steps are as follows:

(1) design of primers: for RHD allelotrope sequence, design a pair of specific oligonucleotide primer sequence, wherein forward primer is RHD838A-F, and its sequence is as shown in SEQ ID NO:3; Reverse primer is RHD838A-R, and its sequence is as shown in SEQ ID NO:4; Amplified production fragment length is 163bp; And introduce 1 pair of internal reference primer sequence as the DNA sample positive internal reference that increases, and forward primer is β-globin-F, its sequence is as shown in SEQ ID NO:5; Reverse primer is β-globin-R, and its sequence is as shown in SEQ ID NO:6, and internal reference amplified production fragment length is 102bp;

(2) RHD838G>A allelotrope increases expansion: reaction system cumulative volume 50 μ L; Wherein contain PCR5 × damping fluid 10 μ L, DNA profiling 200ng, the Taq polysaccharase 1.0 μ L of 1U/ μ L, MgCl ₂final concentration is 2.0mmol/L, and dNTP final concentration is 200nmol/L, and the final concentration of specificity forward primer and reverse primer is 200nmol/L; Add sterilization distilled water to reaction system cumulative volume 50 μ L;

Above-mentioned reaction system is reacted in PCR instrument to reaction conditions: 95 DEG C of denaturation 5min, then 94 DEG C of sex change 30s successively, then 62 DEG C of annealing 40s, 72 DEG C are extended 1min, totally 35 circulations;

(3) RHD838G>A allelotrope detects: thing that the increasing of step (2) gained is expanded production is carried out to electrophoresis with sepharose, whether have object fragment to detect it.

Beneficial effect of the present invention: the present invention adopts molecular biology method to carry out the detection of gene level, can be highly sensitive and high precision detect having or not of the mutator gene that is doped in gene pool.Owing to there being the difference of RHD gene between different nationalities, on the basis of correlative study, according to Chinese RHD gene molecule background, design for newfound RHD838G>A allelotrope in Chinese specially.Carry out Rh blood group DEL type gene type assay the phenotypic evaluation index as DEL blood group by detecting RHD838G>A transgenation.The present invention not only has important clinical practice meaning in the deficiency that makes up serological technique, is worth but also have research application widely.

Brief description of the drawings

Fig. 1 is that in embodiment, RHD838G>A allelotrope detects gel electrophoresis figure.

Fig. 2 is RHD838G>A allelic mutation sequencer map in embodiment.

Embodiment

In the present invention, " wild type gene " refers to and do not undergo mutation, have the gene that contains genetic information of normal function originally; " mutated genes " refers to the gene that sudden change has occurred; " sudden change " refers to the change of the nucleotide sequence of DNA, RNA etc., the base substitution that is equivalent to use in genetics, insert in, disappearance, inversion, repetition, transposition etc.; " gene pool " refers to the gene colony being made up of lots of genes.

The preparation of embodiment 1DNA template

The test kit that employing is purchased extracts Whole Blood Genomic DNA, and concrete steps are as follows:

(1) get one of aseptic 2.0mL centrifuge tube, add 1mL cell pyrolysis liquid.

(2) light shaking is so through the whole blood sample of EDTA anti-freezing, until thoroughly mix; Then draw 500 μ L blood samples and add in the above-mentioned centrifuge tube that contains cell pyrolysis liquid, topple over gently centrifuge tube and mix for 5-6 time.

(3) incubated at room 10 minutes (putting upside down during this time centrifuge tube mixes for 2-3 time).

(4) centrifugal 5 minutes of 12000rpm room temperature.

(5) as far as possible supernatant liquor is moved slowly and abandon totally with pipettor, note not by the white mass sucking-off of two-phase intersection.

(6) use vortex vibrator (Votex) acutely to mix, until white corpuscle resuspended (10-15 second).

(7) in re-suspended cell solution, add karyorhexis liquid 300 μ L.Inhale and put 5-6 cracking white corpuscle of solution with liquid transfer gun head.Now solution should become very thickness.If visible cell agglomerate after mixing, is placed in solution 37 DEG C and hatches until agglomerate dissipates.If hatch after 1 hour still visible cell agglomerate, separately add karyorhexis liquid 100 μ L and repeat to be placed in 37 DEG C and hatch.

(8) in karyorhexis thing, add albumen precipitation liquid 100 μ L, use vortex vibrator concuss 10-20 second.

(9) centrifugal 5 minutes of 12000rpm room temperature.

(10) its supernatant liquor is gone in the 2.0mL centrifuge tube that adds 300 μ L room temperature Virahols of reference numeral.

(11) put upside down gently to mix solution, until white linear DNA forms precipitation.

(12) centrifugal 1 minute of 12000rpm room temperature.

(13) abandoning supernatant, the ethanol that to add with the isopyknic room temperature volumetric concentration of sample size be 70%, puts upside down centrifuge tube for several times gently.

(14) as far as possible ethanol is moved slowly and abandon totally with pipettor.Centrifuge tube is placed in to 50 DEG C of baking 5-10 minute, allows remaining ethanol volatilization clean as far as possible.

(15) to the DNA lysate that adds 50-100 μ L in centrifuge tube, mix gently.

(16) assess DNA extraction effect with 1% agarose gel electrophoresis, Nanodrop nucleic acid instrument detection level, quantitatively arrives 20ng/ μ L ,-20 DEG C of preservations.

Embodiment 2RHD838G>A allelotrope detection technique scheme:

Instrument: Veriti96 type PCR instrument, BIO-RAD Gel Doc XR+ type gel imaging instrument (Bio Rad Laboratories), gel-electrophoretic apparatus (Beijing 61 companies).

Reagent: QIAamp DNA extraction test kit (German Qiagen company); DNA Isolation Kit extracts test kit (Beijing PELFREEZ company); PCR damping fluid, dNTP, Taq enzyme (American AB I company); Primer and probe are synthetic by the Shanghai biological company limited of raw work.

(1) design of primers: according to RHD gene (sequence number: BN000065) and the allelic sequence of the various RHD of Chinese of American National bioinformation center (NCBI) GenBank record, by Oligo6.0 primer software design primer, final definite 1 couple of specific oligonucleotide primer sequence (RHD838A-F, CGGTGTTGGC AGGAGGCGTG G; RHD838A-R, CTTCAGCCAAAGCAGAGGAG G), amplified production fragment length is 163bp;

And introduce 1 pair of internal reference primer sequence as DNA sample increase positive internal reference (β-globin-F, GTGCACCTGA CTCCTGAGGA GA; β-globin-R, CCTTGATACC AACCTGCCCAG), amplified production fragment length is 102bp.

RHD838G>A allelotrope detection primer sequence and atopic are as shown in table 1.

Table 1

Note: * F=forward primer; R=reverse primer.

The position of the related exon base sequence of # primer nucleotide sequence refers to the whole numbering that puts in order of 10 exons being started by ATG start code; The position of related intron base sequence refers to the single numbering that puts in order of each intron.

(2) reaction conditions: reaction cumulative volume: 50 μ L, containing PCR5 × damping fluid 10 μ L, DNA profiling 200ng, Taq polysaccharase (1U/ μ L) 1.0 μ L, MgCl ₂final concentration 2.0mmol/L, dNTP final concentration 200nmol/L, and the upper and lower primer final concentration of specificity 200nmol/L, and add sterilization distilled water to cumulative volume 50 μ L.

Reaction conditions: 95 DEG C of denaturations 5 minutes, then 94 DEG C of sex change 30 seconds successively, then 62 DEG C of annealing 40 seconds, 72 DEG C are extended 1 minute, totally 35 circulations.

(3) allelotrope detects: thing that the increasing of step (2) gained is expanded production is carried out to electrophoresis with 1.5% sepharose, whether have object fragment to detect it.By gel imaging instrument observations and take pictures, PCR product is shown as single band after electrophoresis, without assorted band, points out PCR product single, without non-specific amplification.If pillar location is positioned at the position of suitable size, it is object fragment.Be 163bp according to the object fragment PCR products of above-mentioned primer amplification, reaction result is shown in accompanying drawing 1, and visible object band, illustrates that design of primers is reasonable, can amplify object band.

Wherein, detect gained gel electrophoresis figure as shown in Figure 1, by figure M:50bp gradient molecular weight marker, 1: blank, the contrast of 2-3:RHD gene wild-type, 4-7:RHD838G>A saltant type sample.

Detect gained transgenation sequencer map as shown in Figure 2, in figure, arrow is depicted as RHD gene the 6th exon 838 positions and has occurred G>A sudden change.

Claims (3)

1. a Rh blood group DEL type rHD838G>A allelotrope, is characterized in that: its wild type gene DNA sequence dna is as shown in SEQ ID NO:1, and mutated genes DNA sequence dna is as shown in SEQ ID NO:2.

2. Rh blood group DEL type described in claim 1 rHDthe allelic detection method of 838G>A, is characterized in that: by gene amplification method, optionally increased in the detection zone of the target site that comprises mutator gene, detect thus having or not of this mutator gene; Described detection method is as follows:

(1) extract DNA in sample to be checked;

(2) taking this DNA as template, for rHDnear the PCR primer of coding region design 838G>A mutator gene carries out PCR reaction, obtains PCR reaction product;

(3) measure the nucleotide sequence composition of PCR reaction product;

(4) by nucleotide sequence with rHDthe sequence of wild type gene compares, and has determined whether 838G → A sudden change.

3. Rh blood group DEL type as claimed in claim 2 rHDthe allelic detection method of 838G>A, is characterized in that concrete steps are as follows:

(1) design of primers: for rHDallelotrope sequence, designs a pair of specific oligonucleotide primer sequence, and wherein forward primer is rHD838A-F, its sequence is as shown in SEQ ID NO:3; Reverse primer is rHD838A-R, its sequence is as shown in SEQ ID NO:4; Amplified production fragment length is 163bp; And introduce 1 pair of internal reference primer sequence as the DNA sample positive internal reference that increases, and forward primer is β-globin-F, its sequence is as shown in SEQ ID NO:5; Reverse primer is β-globin-R, and its sequence is as shown in SEQ ID NO:6, and internal reference amplified production fragment length is 102bp;

(2) rHD838G>A allelotrope increases and expands: reaction system cumulative volume 50 μ L; Wherein contain PCR 5 × damping fluid 10 μ L, DNA profiling 200ng, the Taq polysaccharase 1.0 μ L of 1U/ μ L, MgCl ₂final concentration is 2.0mmol/L, and dNTP final concentration is 200nmol/L, and the final concentration of specificity forward primer and reverse primer is 200nmol/L; Add sterilization distilled water to reaction system cumulative volume 50 μ L;

Above-mentioned reaction system is reacted in PCR instrument to reaction conditions: 95 DEG C of denaturation 5min, then 94 DEG C of sex change 30s successively, then 62 DEG C of annealing 40s, 72 DEG C are extended 1min, totally 35 circulations;

(3) rHD838G>A allelotrope detects: thing that the increasing of step (2) gained is expanded production is carried out to electrophoresis with sepharose, whether have object fragment to detect it.