CN104152537A - Swine-derived eperythrozoon detecion kit, method and applications - Google Patents
Swine-derived eperythrozoon detecion kit, method and applications Download PDFInfo
- Publication number
- CN104152537A CN104152537A CN201310176304.9A CN201310176304A CN104152537A CN 104152537 A CN104152537 A CN 104152537A CN 201310176304 A CN201310176304 A CN 201310176304A CN 104152537 A CN104152537 A CN 104152537A
- Authority
- CN
- China
- Prior art keywords
- eperythrozoon
- pig
- source
- gene
- swine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a swine-derived eperythrozoon detecion kit, a method and applications. The kit comprises a TaqMan probe and a primer pair designed aimed at a swine-derived eperythrozoon G1 gene. The probe binds to the 658th-793th nucleotide sequence of the swine-derived eperythrozoon G1 gene specifically. The primer pair is used for amplification of the 658th-793th nucleotide sequence of the swine-derived eperythrozoon G1 gene. The swine-derived eperythrozoon real-time fluorescence quantification PCR detection kit based on the attachment protein G1 gene has characteristics of strong specificity, high sensitivity and good repeatability, can detect whether eperythrozoon is existed in a swine blood sample rapidly, accurately and with high throughput, can be applied at aspects of clinical diagnosis, molecular epidemiological investigation, therapeutic effect evaluation, pig farm purification of swine eperythrozoonosis and the like, and has an important meaning to early state rapid diagnosis, prevention and control and purification of swine eperythrozoonosis.
Description
Technical field
The invention belongs to mycoplasma infection detection technique field in animal blood, be specifically related to boar source Eperythrozoon detection kit and methods and applications.
Background technology
Pig source Eperythrozoon belong to can not vitro culture bloodthirsty mycoplasma family in member, generally colonize in the surface of swine erythrocyte and inner.Pig source Infected with Eperythrozoon extensively distributes in the whole world, to pig industry, brings serious financial loss.Its acute infection can cause serious microbemia, acute erythrocyte hemolysis, sometimes can cause young piglet death, farrowing sow miscarriage etc.For chronically infected pig, Bacteria in Blood content is low, and clinical symptom is changeable, such as may there is gentle jaundice, subhealth state, the speed of growth is slow, throughput is low or the infectious diseases susceptible to other.Under strong immunization and antibiotic therapy, pig source Eperythrozoon still can be set up chronic and infection persistence in host.Pig infects after Eperythrozoon, very likely after transference cure, is converted into chronic infection.The Eperythrozoon (being pig source Eperythrozoon) of finding at present infected pigs has two kinds, comprises eperythrozoon suis (Mycoplasma suis) and little Eperythrozoon (M.parvum).Owing to relying on the molecular assay method of 16S rRNA gene and Rnase P RNA sequence just to occur soon, still insufficient to the research of little Eperythrozoon.
Although as far back as 1932, the Eperythrozoon cause of disease Ji Yi U.S. is identified, but the epidemic data of its infection is still unclear, needs a kind of method accurately and reliably that pig source Infected with Eperythrozoon is diagnosed and identified, and then promote this sick prevention and control and purification.The traditional diagnosis method of the eperythrozoonosis of pig comprises microscopy, serology detection, regular-PCR amplification etc.And the diagnosis of this disease mainly be take microscopy as main clinically, comprising blood compressing tablet and smear staining.Because Eperythrozoon main parasitic is in erythrocyte surface and blood plasma, often cause red blood cell deformation, but erythrocytic distortion can cause by many factors, as change of smear technique, osmotic pressure etc., therefore easily will be out of shape red corpuscle false judgment is Eperythrozoon, thereby causes mistaken diagnosis.Eperythrozoon is bluish voilet when Giemsa staining, it is light blue that Wright's staining is, acridine orange dyeing is light green fluorescence, but Giemsa staining and Wright's staining need to be avoided the interference of sex change red corpuscle (basophilic erythrocyte, polychromatic erythrocyte and person of outstanding talent-Zhou Shi corpusculum red corpuscle), thrombocyte, antithrombotics and dye granule; Pollution foreign matter on slide glass and white corpuscle fragment all may cause non-specific luminous, cause detected result to occur false positive.The Serology test of pig source Eperythrozoon comprises complement fixation test (CFT) (complement fixation test, CFT), indirect hemagglutination test (indirect hemagglutination assay, IHA) and enzyme linked immunosorbent assay (enzyme-linked immunosorbent assay, ELISA) etc.Because Eperythrozoon there is no ripe extracorporeal culturing method, be difficult to obtain a large amount of original antigens and the application that hindered serological method.Regular-PCR diagnostic method mainly concentrated on amplification 16S rRNA gene in recent years, and this gene order is also at present the most frequently used bacterium kind classification and the sequence fragment of identifying.16S rRNA gene discovery pig source Eperythrozoon and other the procaryotic similaritys of comparing a plurality of prokaryotic organism, mycoplasma are very high.Pig blood sample in clinical collection originally may be polluted by various bacteria, adopts pcr amplification 16SrRNA gene very easily to occur false positive.Therefore in the urgent need to setting up a kind of accurate, special pig source eperytozoa body detecting method.Pig source Eperythrozoon glyceraldehyde-3-phosphate dehydrogenase sample albumen 1 (glyceraldehyde-3-phosphate dehydrogenase-likeprotein1, be called for short G1 albumen) a kind of adhesion protein of gene main code, the function with glyceraldehyde-3-phosphate dehydrogenase is pig source Eperythrozoon specific gene.The G1 gene (MPG1) of little Eperythrozoon is carried out to nucleotide sequence similarity that pcr amplification analysis finds its DNA sequence dna and eperythrozoon suis G1 gene (MSG1) between 96.6%～98.2%, and amino acid whose similarity is between 98.2%～100%, both are without significant difference, and its medium and small Eperythrozoon G1 gene is answered sequence height homology at 450～550,600～900 nucleotide sequences and eperythrozoon suis G1 gene pairs.
Real-Time Fluorescent Quantitative PCR Technique is to add fluorophor in PCR reaction system, utilizes the whole PCR process of accumulation Real-Time Monitoring of fluorescent signal, finally by typical curve, unknown template is carried out the method for timing analysis.Compare with existing diagnostic method, quantitative fluorescent PCR once can carry out diagnosis and detection to a plurality of samples simultaneously; Detection speed is rapider, and result judgement need to be by electrophoretic analysis, thereby greatly saves time and reduced the pollution to environment; Can real-time quantitative analysis to detecting sample.
Summary of the invention
The present invention will solve the high technical problem of detection method false positive rate of current pig source Eperythrozoon, a kind of pig source Eperythrozoon real-time fluorescence quantitative PCR detection kit based on attachment proteins G1 gene is provided, this test kit high specificity, susceptibility are high, can detect quickly and accurately in pig blood sample, whether have Eperythrozoon.
In order to solve the problems of the technologies described above, the present invention is achieved through the following technical solutions:
In one aspect of the invention, provide a boar source Eperythrozoon detection kit, described test kit comprises:
For the TaqMan probe of pig source Eperythrozoon G1 gene design, this probe and 658th～793 nucleotide sequence specific bindings of described pig source Eperythrozoon G1 gene;
For the primer pair of pig source Eperythrozoon G1 gene design, this primer pair is for the nucleotide sequence of 658th～793 of the pig source Eperythrozoon G1 genes of increasing.
Preferably, the sequence of described probe is as shown in SEQ ID NO:4; The sequence of described primer pair is as shown in SEQ ID NO:2 and SEQID NO:3.
Described test kit also comprises: the positive recombinant plasmid standard substance that contain eperythrozoon suis G1 gene.
Described test kit also comprises: quantitative fluorescent PCR reaction buffer and polysaccharase.
5 ' end of described probe is marked with fluorescence report group, and 3 ' end is marked with quenching group.
In another aspect of this invention, also provide a kind of method that detects pig source eperytozoa bulk concentration, comprised the following steps:
For pig source Eperythrozoon G1 gene design TaqMan probe, this probe and 658th～793 nucleotide sequence specific bindings of described pig source Eperythrozoon G1 gene;
For pig source Eperythrozoon G1 gene design pair of primers, this is the nucleotide sequence for 658th～793 of the pig source Eperythrozoon G1 genes of increasing to primer;
With described TaqMan probe and primer, the positive recombinant plasmid standard substance that contain eperythrozoon suis G1 gene are carried out to real-time fluorescence quantitative PCR detection, according to detected result, draw out typical curve;
With described TaqMan probe and primer, pig blood sample DNA to be measured is carried out to real-time fluorescence quantitative PCR detection, according to described typical curve, analyze the concentration of pig source Eperythrozoon in pig blood sample to be measured.
The sequence of described probe is as shown in SEQ ID NO:4; The sequence of described primer is as shown in SEQ ID NO:2 and SEQ ID NO:3.
Described positive recombinant plasmid is eperythrozoon suis G1 total length encoding gene is inserted to pMD18-T carrier and make.
In another aspect of this invention, also provide the application of above-mentioned pig source Eperythrozoon detection kit in the product of the eperythrozoonosis of preparation diagnosis pig.
The present invention is based on the pig source Eperythrozoon real-time fluorescence quantitative PCR detection kit of attachment proteins G1 gene, there is high specificity, high, the reproducible feature of susceptibility, can be fast, detect in pig blood sample, whether there is Eperythrozoon accurately, high-throughput, can be applicable to the aspects such as clinical diagnosis, Molecule Epidemiology Investigation, curative effect evaluation and pig farm purification of the eperythrozoonosis of pig, significant for Rapid&Early diagnosis, prevention and control and the purification of the eperythrozoonosis of pig.
Accompanying drawing explanation
Below in conjunction with the drawings and specific embodiments, the present invention is further detailed explanation.
Fig. 1 is the pig source Eperythrozoon G1 gene PCR amplification electrophorogram of the embodiment of the present invention 1;
Fig. 2 is that the pig source Eperythrozoon G1 gene masculine plasmid enzyme restriction of the embodiment of the present invention 1 is identified electrophorogram;
Fig. 3 is the embodiment of the present invention 3 sensitivity test amplification curve diagrams;
Fig. 4 is the embodiment of the present invention 3 real-time fluorescence quantitative PCR canonical plottings;
Fig. 5 is the embodiment of the present invention 4 specific test amplification curve diagrams;
Fig. 6 is the embodiment of the present invention 6 pig field blood sample Infected with Eperythrozoon detected result figure.
Embodiment
In the following example, the experimental technique of unreceipted actual conditions, conventionally condition routinely, as < < molecular cloning experiment guide > > (Pehanorm Brooker J, Russell D W, work, Huang Peitang, Wang Jiaxi, the thick plinth of Zhu, waits and translates. molecular cloning experiment guide, the 3rd edition, Beijing: Science Press, 2002) method described in is carried out.
Eperythrozoon suis G1 gene order (the GenBank accession number: AM407404.1) that the present invention announces according to GenBank, 1 pair of primer and TaqMan probe have been designed, developed the real-time fluorescence quantitative PCR detection kit based on TaqMan probe in detecting pig source Eperythrozoon, and the pig blood sample of collection in worksite has been detected.Result demonstration, the probe of design has very high specificity to detecting pig source Eperythrozoon, the detection threshold of plasmid DNA reaches 100 copies, 319 parts of clinical pig blood samples have been detected, the infection sample number of pig source Eperythrozoon is 45 parts (containing 34 parts of eperythrozoon suises and 11 parts of little Eperythrozoons), two kinds of total infection positive rates of Eperythrozoon are 14.11%, prompting pig source Eperythrozoon TaqMan real-time fluorescence quantitative PCR detection kit is easy and simple to handle, fast, in fluorescent PCR instrument, react in one hour and can obtain accurate result, high specificity, susceptibility is high, reproducible, can be used for the clinical diagnosis of the eperythrozoonosis of pig, Molecule Epidemiology Investigation, the Quantitative detection of curative effect evaluation and pig farm purification etc.
Pig of the present invention source Eperythrozoon detection kit, comprising:
For the TaqMan probe of pig source Eperythrozoon G1 gene design, this probe and 658th～793 nucleotide sequence specific bindings of pig source Eperythrozoon G1 gene;
For the primer pair of pig source Eperythrozoon G1 gene design, this primer pair is for the nucleotide sequence of 658th～793 of the pig source Eperythrozoon G1 genes of increasing.
In following preferred embodiment, the sequence of probe is as shown in SEQ ID NO:4; The sequence of primer pair is as shown in SEQ ID NO:2 and SEQ ID NO:3.
Clone and the sequential analysis of embodiment 1 pig source Eperythrozoon G1 gene
(1) design of primers:
Eperythrozoon suis G1 protein coding gene sequence (the GenBank accession number: AM407404.1) of announcing according to GenBank, application Primer Premier5.0 software design the Auele Specific Primer of amplification pig source Eperythrozoon G1 albumen total length encoding gene, primer sequence is as follows:
Upstream primer MF1:5 '-GCGGGATCCATGACAATCCACAAAGTAGC-3 ' (SEQ ID NO:5);
Downstream primer MR1:5 '-CGCCTGCAGTTAAAGAGAAATGTAGTA-3 ' (SEQ ID NO:6).
(2) pig blood sample gene group DNA extraction:
By Whole Blood Genomic DNA, extract test kit (resin type, purchased from match Parkson company, catalog number: CUC-100), extract pig blood sample gene group DNA according to the specification sheets of this test kit: get the aseptic anticoagulated whole blood of 500 μ L in 1mL purifying resin, put upside down and mix 5-6 time.Incubation 3min under room temperature, puts upside down therebetween and mixes once, the centrifugal 3s of 5000r/min, collecting precipitation.With 1mL GN in conjunction with liquid by purifying Resin Suspension, put upside down and mix, the centrifugal 3s of 5000r/min, collecting precipitation.With the rinsing of 0.5mL rinsing liquid, purify resin twice, put upside down and mix, the centrifugal 3s of 5000r/min, collecting precipitation.With 0.8mL dehydrated alcohol, suspend, pack centrifugal purification post into, the centrifugal 1min of 12000r/min, outwells the ethanol in waste collection pipe, more centrifugal 1min, eliminates ethanol as far as possible.Centrifugal purification column sleeve is entered in a clean 1.5mL centrifuge tube, add 100 μ L TE damping fluids on purifying resin, room temperature is placed 3min, the centrifugal 2min of 12000r/min, and the liquid of collecting in centrifuge tube is the pig blood complete genome DNA eluting.
(3) amplification of pig source Eperythrozoon G1 full length gene sequence:
1) pig source Eperythrozoon G1 full length gene sequence amplification reaction system is as follows: the Ex TaqBuffer of 2.5 μ L10 times concentration, 2 μ LdNTP, 0.2 μ L ExTaq, each 0.15 μ L of upstream and downstream primer, 2 μ LDNA templates, with sterilizing distilled water polishing to 25 μ L.If the negative contrast of sterilizing distilled water.
2) pcr amplification reaction condition: 95 ℃ of 5min; 94 ℃ of 60s, 55 ℃ of 45s, 72 ℃ of 60s, after totally 35 circulations, 72 ℃ are extended 8min.
3) amplified production analysis: get 5 μ LPCR products, be added in 2% the sepharose that contains 0.5 μ g/mL ethidium bromide dyestuff, electrophoresis 20min under 125V voltage observes the collection of illustrative plates of amplified production on gel imaging system.And contrast with negative control, there is electrophoretic band about 1000bp left and right in test sample hole, cuts glue purification.As a result, successfully amplified pig source Eperythrozoon G1 full-length gene (Fig. 1), expanding fragment length is 1011bp.In Fig. 1, M:DL2000DNAMarker; 1: object fragment; N: negative control.
4) object band is cut to glue purification, will reclaim product cloning to pMD18-T carrier and transform DH5 α competent cell, after enzyme is cut evaluation, carry out sequencing.As a result, successfully built the recombinant plasmid that contains pig source Eperythrozoon G1 gene, enzyme is cut result and is shown external source clip size correct (Fig. 2), in Fig. 2, and M1:DL1kb DNAMarker; M2:DL2000DNAMarker; 1: pig source Eperythrozoon G1 gene masculine plasmid enzyme restriction fragment.Eperythrozoon suis G1 full length gene sequence is as follows:
ATGACAATCCACAAAGTAGCAATCAATGGATTCGGAAGAATCGGAAGATTACTATTTAGA
AATCTTCTTTCTTCTCAAGGAGTTCAAGTTGTAGCTGTTAATGACGTAGTTGACATTAAA
GTTCTTACTCACCTTTTGGTTTATGACAGTGCTCAAGGAAAACTAAAAGATTGAGAAGT
AAGTTGTGATTCAGAATACATAAGACTAAAGAATGTAAATACTGGAGAAGTTAGAGAAG
TTAGAGTTTTCAACTTCAATACTGAAAAGATTTATCACTGAGGTGAATTAGAAATTGATT
GTGTTGTTGAATGTTCAGGAAGATTCTTAACTAAGGAAGCAGTTAAGTGTCACCTTGATG
CAGGAGCTCAAAAAGTTCTTATTTCAGCTCCTGCAAAGGATGACACTAAGACAGTTGTT
TACAACGTAAACCATACTCAAATTACCAGCTCAGACAATGTTATTTCAGGAGCTTCATGT
ACAACTAATGCACTAGCTCCTATCGTAAAAATTATTCACAGAAAATTTGGAATTAATTCTG
GATTCATGACAACAGTTCATGCTTTCACTTCTGACCAAAGACTTCAAGACTCTCCTCACG
CTGACCTA AGA AGAGCTAGAGCAGCTGCTGGATCA ATTATTCCTACA ACTACCGGAGCA
ATTCCAGAATTAAATGGAAAAC
GTACCTGTATTGACTGGTTCTCTAGTTGACCTATGCCTAAAAATAAATA
ATGAAGCAATTAAGGATGGAGAAAATGAAACCCTTGCTTATG
TAGAAGATCCAATCGTATCTGCTGACATTATTGGAGATACACATGGTTCTATTTTTGACTC
ATCTCTAACTAAAGTATTGCCAACTGGAGAAGTTAAGTTGTATGCATGATATGACAACGA
GTCTTCTTATGTAAATCAACTTGCAAGAACTCTGAAATACTACATTTCTCTTTAA(SEQ IDNO：1)
The preparation of the positive recombinant plasmid standard form of embodiment 2
(1) evaluation of positive plasmid
Object band is cut to glue, with glue, reclaim test kit and reclaim purifying, object fragment is cloned into pMD18-T carrier and transforms bacillus coli DH 5 alpha competent cell, 37 ℃ of overnight incubation in containing penbritin solid medium, selecting single bacterium colony cultivates, extract plasmid, through restriction analysis and order-checking, identify.The sequence of acquisition and the upper sequence of announcing of GenBank are compared, to determine positive recombinant plasmid.
(2) concentration determination of positive plasmid
After recombinant plasmid dna is dissolved with sterilizing distilled water, in nucleic acid-protein determinator, under 260nm and 280nm wavelength, measure plasmid concentration, and according to formula, calculate the copy number of plasmid DNA in every microlitre liquid.
Note: the molecular-weight average of each base is 660.
The foundation of embodiment 3 pig source Eperythrozoon real-time fluorescence quantitative PCR detection methods
(1) design of primer and probe:
According to the pig source a pair of Auele Specific Primer of Eperythrozoon G1 full length gene sequences Design and TaqMan probe, the fluorescence report group of probe 5 ' end mark is FAM, the quenching group of 3 ' end mark is MGB, expanding fragment length is 136bp, is nucleotide sequence between SEQID NO:1 sequence 658th～793 bit bases.The sequence that primer and probe increase is shown in shown in the eperythrozoon suis G1 full length sequence square frame of embodiment 1.Designed primer and probe sequence are as follows:
MF2：5’-GCTGCTGCAATTGGAAGAGTA-3’(SEQ IDNO：2)；
MR2：5’-TGATTTCTTCTGCAGAAACAGACT-3’(SEQ ID NO：3)；
Probe：5’(FAM)-TTGATGGAATTGCACACAGA-3’(MGB)(SEQ ID NO：4)。
(2) determining of real-time fluorescence quantitative PCR detection method:
1) set up quantitative fluorescent PCR reaction system: 10 * PCR Buffer2 μ L, MgCl
2(50mM) 1.2 μ L, dNTP (10mM) 0.5 μ L, each 0.5 μ L of upstream and downstream primer (10mM), probe (10mM) 0.2 μ L, Taq enzyme (5U/ μ L) 0.2 μ L, DNA profiling 1 μ L, with sterilizing distilled water polishing 20 μ L.Each sample detection arranges 3 repetitions.
2) quantitative fluorescent PCR reaction conditions: Pre-PCR read, 50 ℃ of 1min; 95 ℃ of sex change 10min; 95 ℃ of sex change 15s, 1min, totally 40 circulations are extended in 60 ℃ of annealing; 60 ℃ are extended 1min.
3) drafting of quantitative fluorescent PCR typical curve:
Adopt acquired positive recombinant plasmid dna to make fluorescent quantitation standard substance, measure concentration and be converted into after copy number/μ L, 10 times of gradient dilutions, with 7 dilution plasmid standard Criterion curves.
4) fluorescence quantitative PCR detection: analyze the pig source eperytozoa bulk concentration in tested blood sample according to typical curve.
5) result shows, the pig source Eperythrozoon real time fluorescence quantifying PCR method that the present invention sets up detects plasmid DNA copy number 10
2～10
9in scope, (Fig. 3 is from left to right followed successively by sample copy number 10
9copy/μ L～10 copy/μ L), the logarithm of plasmid copy number and Ct value are good linear relationship, and amplification efficiency percentage ratio reaches 108.429, coefficient R
2=0.993 (Fig. 4).
The specificity analyses of embodiment 4 pig source Eperythrozoon real time fluorescence quantifying PCR methods
With Different Kinds of Pathogens microorganism, comprise that the DNA of toxoplasma gondii (Toxoplasmagondii) RH strain, vole Babesia (Babesiamicroti), haemophilus parasuis (Haemophilusparasuis), chicken virus mycoplasma (Mycoplasma gallisepticum), cryptosporidium parvum (Cryptosporidium parvum) is as template, establish negative control and positive control simultaneously, carry out fluorescence quantitative PCR detection, wherein negative control is sterilizing distilled water, and positive control is the recombinant plasmid dna containing eperythrozoon suis G1 gene that embodiment 2 builds.Result shows to only have positive control to occur amplification curve, and other all do not occur amplification curve (Fig. 5), show the method high specificity.
The repeatability analysis of embodiment 5 pig source Eperythrozoon real time fluorescence quantifying PCR methods
Between same reaction system is criticized, repeat, each sample repeats 3 times, according to the Ct value obtaining, carries out variation coefficient statistics.As a result, the variation coefficient of two groups of samples is respectively 1.08% and 1.17%, all lower than 5%.Show that error is little, amplification efficiency is stablized (table 1).
Table 1
Composition and the application of embodiment 6 pig source Eperythrozoon real-time fluorescence quantitative PCR detection kits
1, the composition of test kit
By the primer pair shown in the probe shown in SEQ ID NO:4, SEQ ID NO:2 and SEQ ID NO:3, the positive recombinant plasmid standard substance, quantitative fluorescent PCR reaction buffer and the polysaccharase that contain eperythrozoon suis G1 gene, be assembled into test kit, assembling is placed on conditions suitable and preserves.
2, the application of test kit of the present invention
(1) the sick pig blood sample of aseptic collection is 319 parts, adds antithrombotics acid citrate dextrose (acid citrate dextrose, ACD), and the ratio of blood and antithrombotics is 1: 1O, mixes 4 ℃ of preservations.
(2) get 500 μ L anticoagulations, by Whole Blood Genomic DNA, extract test kit and extract pig blood sample gene group DNA, in-20 ℃ of preservations.
(3) with test kit of the present invention, carry out fluorescence quantitative PCR detection, amplification curve and the typical curve of doing according to 10 times of gradient dilutions of eperythrozoon suis G1 gene masculine plasmid are compared, judged.Result: detect altogether 45 parts of pig source Infected with Eperythrozoon positive, infection rate is 14.11% (Fig. 6), through 16S rRNA gene and Rnase P RNA sequential analysis proof wherein 34 parts be eperythrozoon suis (M.suis), 11 parts is little Eperythrozoon (M.parvum).
The above embodiment has only expressed embodiments of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Sequence table
<110> China Agriculture Academe Shanghai Veterinary Institute
<120> pig source Eperythrozoon detection kit and methods and applications
<160>6
<170>PatentIn version3.3
<210>1
<211>1011
<212>DNA
<213>Mycoplasma suis
<400>1
atgacaatcc acaaagtagc aatcaatgga ttcggaagaa tcggaagatt actatttaga 60
aatcttcttt cttctcaagg agttcaagtt gtagctgtta atgacgtagt tgacattaaa 120
gttcttactc accttttggt ttatgacagt gctcaaggaa aactaaaaga ttgagaagta 180
agttgtgatt cagaatacat aagactaaag aatgtaaata ctggagaagt tagagaagtt 240
agagttttca acttcaatac tgaaaagatt tatcactgag gtgaattaga aattgattgt 300
gttgttgaat gttcaggaag attcttaact aaggaagcag ttaagtgtca ccttgatgca 360
ggagctcaaa aagttcttat ttcagctcct gcaaaggatg acactaagac agttgtttac 420
aacgtaaacc atactcaaat taccagctca gacaatgtta tttcaggagc ttcatgtaca 480
actaatgcac tagctcctat cgtaaaaatt attcacagaa aatttggaat taattctgga 540
ttcatgacaa cagttcatgc tttcacttct gaccaaagac ttcaagactc tcctcacgct 600
gacctaagaa gagctagagc agctgctgga tcaattattc ctacaactac cggagcagct 660
gctgcaattg gaagagtaat tccagaatta aatggaaaac ttgatggaat tgcacacaga 720
gtacctgtat tgactggttc tctagttgac ctatgcctaa aaataaataa gtctgtttct 780
gcagaagaaa tcaatgaagc aattaaggat ggagaaaatg aaacccttgc ttatgtagaa 840
gatccaatcg tatctgctga cattattgga gatacacatg gttctatttt tgactcatct 900
ctaactaaag tattgccaac tggagaagtt aagttgtatg catgatatga caacgagtct 960
tcttatgtaa atcaacttgc aagaactctg aaatactaca tttctcttta a 1011
<210>2
<211>21
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(21)
<223> primer
<400>2
gctgctgcaa ttggaagagt a 21
<210>3
<211>24
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(24)
<223> primer
<400>3
tgatttcttc tgcagaaaca gact 24
<210>4
<211>20
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(20)
<223> probe
<400>4
ttgatggaat tgcacacaga 20
<210>5
<211>29
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(29)
<223> primer
<400>5
gcgggatcca tgacaatcca caaagtagc 29
<210>6
<211>27
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(27)
<223> primer
<400>6
cgcctgcagt taaagagaaa tgtagta 27
Claims (9)
1. a boar source Eperythrozoon detection kit, is characterized in that, described test kit comprises:
For the TaqMan probe of pig source Eperythrozoon G1 gene design, this probe and 658th～793 nucleotide sequence specific bindings of described pig source Eperythrozoon G1 gene;
For the primer pair of pig source Eperythrozoon G1 gene design, this primer pair is for the nucleotide sequence of 658th～793 of the pig source Eperythrozoon G1 genes of increasing.
2. pig according to claim 1 source Eperythrozoon detection kit, is characterized in that, the sequence of described probe is as shown in SEQ ID NO:4; The sequence of described primer pair is as shown in SEQ ID NO:2 and SEQ ID NO:3.
3. pig according to claim 1 source Eperythrozoon detection kit, is characterized in that, described test kit also comprises: the positive recombinant plasmid standard substance that contain eperythrozoon suis G1 gene.
4. pig according to claim 1 source Eperythrozoon detection kit, is characterized in that, described test kit also comprises: quantitative fluorescent PCR reaction buffer and polysaccharase.
5. pig according to claim 1 source Eperythrozoon detection kit, is characterized in that, 5 ' end of described probe is marked with fluorescence report group, and 3 ' end is marked with quenching group.
6. a method that detects pig source eperytozoa bulk concentration, is characterized in that, comprises the following steps:
For pig source Eperythrozoon G1 gene design TaqMan probe, this probe and 658th～793 nucleotide sequence specific bindings of described pig source Eperythrozoon G1 gene;
For pig source Eperythrozoon G1 gene design pair of primers, this is the nucleotide sequence for 658th～793 of the pig source Eperythrozoon G1 genes of increasing to primer;
With described TaqMan probe and primer, the positive recombinant plasmid standard substance that contain eperythrozoon suis G1 gene are carried out to real-time fluorescence quantitative PCR detection, according to detected result, draw out typical curve;
With described TaqMan probe and primer, pig blood sample DNA to be measured is carried out to real-time fluorescence quantitative PCR detection, according to described typical curve, analyze the concentration of pig source Eperythrozoon in pig blood sample to be measured.
7. the method for detection according to claim 6 pig source eperytozoa bulk concentration, is characterized in that, the sequence of described probe is as shown in SEQ ID NO:4; The sequence of described primer is as shown in SEQ ID NO:2 and SEQ ID NO:3.
8. the method for detection according to claim 6 pig source eperytozoa bulk concentration, is characterized in that, described positive recombinant plasmid is total length eperythrozoon suis G1 gene is inserted to pMD18-T carrier and make.
9. the application of pig claimed in claim 1 source Eperythrozoon detection kit in the product of the eperythrozoonosis of preparation diagnosis pig.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310176304.9A CN104152537A (en) | 2013-05-13 | 2013-05-13 | Swine-derived eperythrozoon detecion kit, method and applications |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310176304.9A CN104152537A (en) | 2013-05-13 | 2013-05-13 | Swine-derived eperythrozoon detecion kit, method and applications |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104152537A true CN104152537A (en) | 2014-11-19 |
Family
ID=51878162
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310176304.9A Pending CN104152537A (en) | 2013-05-13 | 2013-05-13 | Swine-derived eperythrozoon detecion kit, method and applications |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104152537A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434973A (en) * | 2016-11-22 | 2017-02-22 | 湖南新南方养殖服务有限公司 | Real-time fluorescent PCR (polymerase chain reaction) kit for detecting swine Eperythrozoon in umbilical cord blood and application thereof |
| CN107589117A (en) * | 2017-08-22 | 2018-01-16 | 贵州省畜牧兽医研究所 | A kind of quick microscopy diagnostic kit of swine eperythrozoonosis and preparation method thereof |
-
2013
- 2013-05-13 CN CN201310176304.9A patent/CN104152537A/en active Pending
Non-Patent Citations (4)
| Title |
|---|
| A.M.S GUIMARAES ET AL.: "a quantitative TaqMan PCR assay for the detection of Mycoplasma suis", 《JOURNAL OF APPLIED MICROBIOLOGY》 * |
| LUDWIG E. HOELZLE ET AL.: "First LightCycler real-time PCR assay for the quantitative detection of Mycoplasma suis in clinical samples", 《JOURNAL OF MICROBIOLOGICAL METHODS》 * |
| 刘永夏等: "应用重组MSG1 蛋白检测猪附红细胞体抗体的ELISA 检测方法的建立", 《中国农业科学》 * |
| 闫若潜等: "猪附红细胞体荧光定量PCR检测方法的建立及应用", 《农业生物技术学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434973A (en) * | 2016-11-22 | 2017-02-22 | 湖南新南方养殖服务有限公司 | Real-time fluorescent PCR (polymerase chain reaction) kit for detecting swine Eperythrozoon in umbilical cord blood and application thereof |
| CN107589117A (en) * | 2017-08-22 | 2018-01-16 | 贵州省畜牧兽医研究所 | A kind of quick microscopy diagnostic kit of swine eperythrozoonosis and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103382507B (en) | 1 type and 3 type duck hepatitis A virus (HAV) single stage method dual RT-PCR detection kit, primer pair and method | |
| CN105420379A (en) | Real-time fluorescence quantification PCR detecting kit for cow mycoplasma and special primers and TaqMan probe thereof | |
| CN112501268A (en) | Nanopore sequencing-based primer group and kit for rapidly identifying respiratory microorganisms and application of primer group and kit | |
| CN103866034A (en) | Multiple real-time fluorescence quantification PCR (polymerase chain reaction) detection kit and detection method for helicobacter pylori in gastric juice | |
| CN102174653A (en) | Haemophilus parasuis real-time fluorescent quantitative PCR (polymerase chain reaction) detection method | |
| CN104059977A (en) | Salmonella serotype identification method and kit thereof | |
| CN103966228B (en) | A kind of Rh blood group DEL type RHD93T > A allelotrope and detection method thereof | |
| CN109234419A (en) | Bacillus anthracis double fluorescent quantitative PCR detection kit and detection method | |
| CN105018628A (en) | Kit for recognizing Brucella A19 vaccine strain and wild strain | |
| CN104131006A (en) | Rapid detection kit for human adenoviruses | |
| CN110305975B (en) | RPA kit for rapidly detecting mycoplasma synoviae and application thereof | |
| CN109371148B (en) | Fluorescent PCR kit for identifying three porcine respiratory bacteria and quantitative detection method | |
| CN102634605B (en) | Method for detecting egg drop syndrome viruses and kit for method | |
| CN102876774B (en) | Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid | |
| CN103937806B (en) | A kind of Rh blood group DEL type RHD838G > A allelotrope and detection method thereof | |
| CN112359125A (en) | Method for rapidly detecting cryptococcus gatherensis | |
| CN104152537A (en) | Swine-derived eperythrozoon detecion kit, method and applications | |
| CN102154270B (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
| CN101892320B (en) | Multiple PCR identification method of salmonella serogroup A, B, C1, C2 or D | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN110157836B (en) | Primer, probe and method for detecting IBRV and BVDV | |
| CN109182599A (en) | For detect the specific primer of grass carp hemorrhage virus to, probe, detection kit | |
| AU2020104336A4 (en) | Application of Riemerella anatipestifer Imp gene and the PCR Assay Kit and Method thereof | |
| CN105177144A (en) | Nucleotide for specificity of K4, K32 and K34 of vibrio parahaemolyticus and application thereof | |
| CN111197094B (en) | Compositions, kits and methods for genotyping vibrio parahaemolyticus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20141119 |