CN102943116A - Gene detection kit for Thailand type alpha-thalassemia - Google Patents

Abstract

The invention relates to the field of biological medicine, and in particular relates to a gene detection kit for quickly detecting Thailand type alpha-thalassemia in a clinic sample. The technical scheme of the gene detection kit aims at providing the gene detection kit for the Thailand type alpha-thalassemia, wherein the gene detection kit comprises PCR (polymerase chain reaction) liquid, the PCR reaction liquid comprises a forward primer THAI-F and a reverse primer THAI-R, the primers are the forward 10724-10725 position and the reverse 1219-1220 position of the breaking point position aiming at the Thailand type alpha-thalassemia, and the primers are respectively designed at the forward 5'-end and the reverse 3'-end of the breaking point. According to the kit provided by the invention, the leak detection of the alpha-thalassemia caused by the common blood screening method can be reduced, the birth of the children who suffer from the heavy type alpha-thalassemia can be reduced or avoided, and a condition can be created for the more comprehensive thalassemia screening. The detection kit provided by the invention is convenient to use, high in accuracy, and good in social benefit and economic benefit in the high incidence area of the thalassemia.

Description

The gene detecting kit of Thailand's type α-thalassemia

Technical field

The present invention relates to biomedicine field, be specifically related to a kind of in clinical sample the test kit of rapid detection Thailand type gene of alpha thalassemia type.

Background technology

α-thalassemia " thalassemia " (be called for short α-ground poor) is a kind of autosomal recessive hereditary diseases, is one of modal human single gene inheritance disease in the world, is listed in 6 kinds of common diseases of harm humans health by the World Health Organization.This disease is because disappearance or the sudden change of globin gene sequence, cause α-globin peptide chain dyssynthesis, the synthetic minimizing of ɑ-peptide chain of globin maybe can not be synthesized cause, make the α chain that forms globin and the synthetic overbalance of β chain and the hemolytic anemia that causes is sick.

Human alpha globin gene bunch is positioned at karyomit(e) p13.3 No. 16, is about 40kb, and every karyomit(e) has 2 α pearl protein-2 genes, and dyad has 4 alpha globin genes; Most of α ground is poor to be because due to the disappearance of alpha globin gene, minority is caused by point mutation.With regard to monoploid was individual, according to the synthetic degree that reduces of alpha globin, can be with the poor two class defectives that are divided in α ground: a class be the poor 1(α in α ground ⁰-ground is poor), characteristics are 2 α genes of disappearance, alpha globin is synthetic to be obstructed fully, China is more common be absence type ground, South East Asia poor (-- ^SEA); Two classes are the poor 2(α in α ground ⁺-thalassemia), undergone mutation by a α gene or lack and cause.The alpha Thalassemia of China about 80% is by due to the gene of coding for alpha albumen (α 2 is or/and the α 1) disappearance; Modal disappearance type is-α ^3.7,-α ^4.2,-- ^SEA3 kinds.Along with further illustrating of the poor mechanism in α-ground, some new genetically deficient types are found in succession, for example-- ^11.1,-α ^2.4,-α ^2.7, Philippines type α ground poor (-- ^FIL), Thailand type α ground poor (-- ^Thai) and (type α ground, Hong Kong is poor) HK α α etc.

Since Boonsa etc. reported (-- ^Thai) since, there is successively case to be detected.The poor genetically deficient fragment in Thailand type α-ground than South East Asia genetically deficient ground poor (-- ^SEA) fragment also will grow, and can form medium and heavy alpha Thalassemia clinically, i.e. Pasteur's oedema tire that HbH is sick and Thailand's type lacks of Thailand's type disappearance.Because the Hematological Features of Thailand's type is poor consistent with absence type α ground, South East Asia, all show the low pigment of minicell, MCV reduces and MCH reduces etc., thereby may cause mistaken diagnosis and fail to pinpoint a disease in diagnosis, and then causes the HbH disease of Thailand's type disappearance and the birth of Pasteur's Hb Ballt's hydtops fetails Hb Bart's that Thailand's type lacks.Therefore, carry out Thailand type α-ground poor (-- ^Thai) detect significant to genetic counseling and antenatal diagnosis.

The poor detection technique in existing α-ground mainly contains routine blood test detection, erythrocyte fragility detection, hemoglobin electrophoresis etc., the defective of these methods is to carry out the poor examination in preliminary ground to the patient, can't make a definite diagnosis patient's genotype, and fail to pinpoint a disease in diagnosis easily lightly poor, cause the birth of the poor infant in severe of future generation ground.The method made a definite diagnosis according to the poor gene in α-ground has appearred in recent years, detection method has Southern hybridization, multiple Gap-PCR, multiple ligase enzyme to rely on the methods such as probe amplification technology (MLPA), real-time fluorescence quantitative PCR, reversal point hybridization, direct Sequencing technology, and each gene diagnosis method is summarized as follows:

(1) Southern hybridization technique: the α of Southern marking hybridization technique and labelled with radioisotope, beta globin genes probe are hybridized, and according to collection of illustrative plates, but differential diagnosis α-ground is poor 1, α-ground is poor 2, HbH disease, Bart ' s oedema tire etc.Although the method accuracy is higher complex operation, waste time and energy, the amount of DNA demand is large, need radio-labeling, and can not be applied to the detection of non-missing gene, thereby generally is only suitable for research and uses, and is unsuitable for clinical applying.

(2) relying on probe ligation amplification technology (MLPA): MLPA is the detection that is usually used in the poor missing gene in α ground that grew up in 2002, but because testing cost is high, complex operation, consuming time longer, testing process reaches 16 hours, and need special plant and instrument, general is used for research, is not easy to applying of Molecular screening method.

(3) sequencing technologies: sequencing technologies is considered to the gold standard of clinical detection directly to the analysis of dna sequence dna always; Sequencing technologies is faced with processing (nucleic acid extraction), the amplification standardized attestation problem of sample at present, signal detection, special the makeing mistakes and Error Correcting Problem of order-checking platform, and the information biology aspect problem that may occur, clinical verification program and standardization issue etc., never effectively solve, therefore also fail in clinical, to apply.

(4) reversal point hybridization (Reverse Dot Blot, RDB): this law is on the basis of pcr amplification, with the PCR product and the specific probe hybridization that is fixed on the film bar that is marked on the primer, again by fluorescence excitation or a series of color reaction observations.This method is sensitive, but consuming time longer, generally is used for point mutation detection.

(5) Gap-PCR and improved technology thereof: since the round pcr invention eighties, because it is simple to operate, this technology is widely used in the poor molecular diagnosis in ground, at the regional two ends design of disappearance pair of primers, the very long scope that does not belong to amplification of two primer extension products under normal circumstances, and specific amplification can appear when the disappearance zone occurring.Nineteen ninety Lebo etc. use round pcr, and to detect α-ground poor 1, and Dode and Baysal etc. use round pcr and detect α-ground poor 2.Can only examine the modal 3 kinds of poor (α in absence type a ground of China with the test kit of Gap-PCR exploitation in the market ^3.7,-α ^4.2With-- ^SEA).

(6) real-time fluorescence quantitative PCR (Taqman probe method): real-time fluorescence quantitative PCR is the most popular detection platform of present clinical diagnosing system, in the PCR reaction system, add fluorophor, utilize the fluorescent signal accumulation, Real-Time Monitoring PCR process and the continuous relevant fluorescent signal of amplified production, the method for by typical curve unknown template being carried out at last quantitative analysis analyzed.In thalassemia detects, be confined to a kind of genotypic detection, workload is large; Probe needs fluorescent mark, and testing cost is high.

Currently available products and patent Patents are " being used for diagnosing thalassemic DNA chip and preparation method thereof ", " diagnosing alpha-thalassemic nucleic acid film bar and test kit " and " being used for diagnosing beta-thalassemic nucleic acid hybridization film bar and test kit ", these patents and the present application patent do not belong to same technology platform, and the ASSOCIATE STATISTICS contrast of the patent that disclose or have the right relevant with the present application sees Table 1.

Table 1

At present, the poor test kit in diagnosis absence type α ground of China's clinical application all adopts multiple Gap-PCR technology, mainly for-- ^SEA,-α ^3.7With-α ^4.2Detect, such as the poor detection kit in α-ground of Yaneng Biotechnology (Shenzhen) Co., Ltd., Shenzhen Yi Shengtang bio tech ltd and Guangzhou Da An genome company; Chaozhou Kaipu Biochemistry Co., Ltd.'s PCR-based be combined with luminex the exploitation α, β-thalassemic mutator gene combined detection kit has also only added 2 kinds of poor mutator gene type (α of α-ground ^CSα, α ^QSDetection α), Thailand type α-ground is poor not in the scope of its detection.

In the poor testing product patented technology in existing α-ground, have no directly carry out Thailand type α-ground poor (-- ^Thai) detection, all only occur based on-- ^SEA,-α ^3.7,-α ^4.2,-α ^2.8Deng detection technique and method.

Summary of the invention

The objective of the invention is to develop a kind of simple to operate, fast be used for Thailand type α-ground poor (-- ^Thai) test kit that detects, stable to Thailand type α-ground poor (-- ^Thai) genotype diagnoses.

Technical scheme of the present invention is for providing the gene detecting kit of a kind of Thailand type α-thalassemia, comprise the PCR reaction solution, described PCR reaction solution comprises upstream primer THAI-F and downstream primer THAI-R, described primer is for poor breaking point position upstream 10724-10725 position, Thailand type α-ground, 1219-1220 position, downstream, the primer that 5 ' end and downstream 3 ' end design respectively in the breaking point upstream.

Preferably, in the gene detecting kit of above-mentioned Thailand type α-thalassemia, the nucleotides sequence of described upstream primer THAI-F is classified SEQ ID NO:1 as, and the nucleotides sequence of described downstream primer THAI-R is classified SEQ ID NO:2 as.

Preferably, in the gene detecting kit of above-mentioned Thailand type α-thalassemia, the concentration of described PCR reaction solution middle and upper reaches primer THAI-F and downstream primer THAI-R equates to be 0.1-1 μ M, MgCl ₂Concentration is 1.5mM-5mM, and the concentration of dNTP is 100nM-300nM, and the concentration of archaeal dna polymerase is the 1-5U/ reaction.

Preferably, in the gene detecting kit of above-mentioned Thailand type α-thalassemia,

Described each component concentration of PCR reaction solution is:

Deionized water: 10 μ L;

5×Q buffer：5μL；

10×CoralLoad PCR Buffer：2.5μL；

2.5mM the equal-volume mixed solution of dATP, dCTP, dGTP, dTTP: 2 μ L;

10 μ M primer THAI-F:0.5 μ L;

10 μ M primer THAI-R:0.5 μ L;

5U/ μ L Hotstar Taq enzyme: 0.5 μ L.

Test kit of the present invention is based on Gap-PCR in conjunction with the know-why of agarose gel electrophoresis, Thailand's type (-- ^Thai) the relative conservative region in breaking point upstream and downstream position carries out specific amplification, realize to Thailand type α-ground poor (-- ^Thai) detection.

The present invention further illustrate Thailand type α-ground poor (-- ^Thai) breakpoint location, at gene recombination breakpoint location upstream and downstream design primer, adopt simultaneously the primer sequence delivered in the document to the sample of clinical collection (MCV is starkly lower than 80, MCH and is starkly lower than 28 sample or has only carried one-- ^SEAThe Hb Ballt's hydtops fetails Hb Bart's sample of gene) screens, the positive sample that screens is carried out the Sanger sequence verification as the template of primer screening, by further system and program optimization, the final optimization routines of determining each component final concentration in preferred combination of primers, the system and amplification, the special amplification Thailand type α-ground of stable system that is implemented in optimization poor (-- ^Thai) the specific gene fragment.

Although conventional design of primers is simple, the present invention takes into full account length, GC content and the annealing temperature of primer owing to the high homology of α-globin gene during design of primers.By the primer of design is tested, and raise bulk wight on the basis of test and newly design primer, so repeatedly finally obtaining specific amplification of the present invention reaches by force the high primer of amplification efficiency.

Test kit of the present invention can detect the poor gene type in a kind of new ground, be to reduce the poor under-enumeration in α-ground that normal blood examination method causes, and reduces or avoids the more fully poor screening of birth of the poor infant in heavy α-ground to create condition.Test kit of the present invention is easy to use, accuracy is high, and poor district occurred frequently produces good Social benefit and economic benefit over the ground.

Description of drawings

Fig. 1 be test kit of the present invention to Thailand's type (-- ^Thai) the poor detected result in α-ground, 1: negative control; 2: Thailand's type (-- ^Thai) α-ground is poor; 3:DL2000 Markers.

Embodiment

By describing technology contents of the present invention, structural attitude in detail, realized purpose and effect, below in conjunction with embodiment and cooperate that accompanying drawing is detailed to give explanation.

This test kit is based on Gap-PCR in conjunction with the know-why of agarose gel electrophoresis, poor on Thailand type α-ground (-- ^Thai) the relative conservative region in breaking point upstream and downstream position carries out specific amplification, realize to Thailand type α-ground poor (-- ^Thai) detection.

The composition of the gene detecting kit of embodiment one Thailand of the present invention type α-thalassemia

1, the design of primer and screening:

People α-globin gene order is compared, Thailand type α-ground poor (-- ^Thai) the breaking point position upstream be 10724-10725 position (Genebank No:Z84721), the downstream is 1219-1220 position (Genebank No:Z69706), 5 ' end and downstream 3 ends in the breaking point upstream ' design respectively primer, THAI-F is incorporated into 5 ' end position of a-globin protein gene bunch, and THAI-R is incorporated into 3 ' end position of a-globin protein gene bunch.Utilize the experiment of orthogonal test and grads PCR, carry out the screening of primer, screen suitable combination of primers, preferred combination of primers sequence is as follows:

THAI-F：AGATCAGTTCCAGCAAGCCTGGTG；

THAI-R：GAGATTGCCGATTGTTGAGATTG。

2, the optimization of PCR reaction system

Isocyatic 2 the PCR primer storage liquid THAI-F of equal-volume and THAI-R, the concentration range of every primer is at 0.1-1 μ M, MgCl ₂Final concentration is selected 1.5mM-5mM, isocyatic four kinds of deoxidation Triphosadens (dATP, dGTP, dCTP, dTTP) mixed solution dNTP final concentration is selected 100nM-300nM, the archaeal dna polymerase final concentration is selected the 1-5U/ reaction, utilize orthogonal test method, by the great many of experiments contrast, determine that final PCR reaction system sees Table 2.

Table 2

Such as table 2: DNA application of sample amount is 4 μ L in the PCR reaction system prescription of optimization, and total reaction volume is 25 μ L.

3, reaction conditions determines

Present method adopts conventional PCR system, and reaction conditions divides following steps optimization:

Through great many of experiments, the final optimum reaction condition of determining is:

Annealing temperature and annealing time are larger on pcr amplification efficient and specific amplification impact, and above-mentioned condition optimizing result shows the annealing temperature non-specific amplification band that has on the low side, may cause false positive results, and the temperature drift amplification efficiency is on the low side, and sensitivity descends.The reaction conditions specificity that this programme is set up is good, and amplification efficiency is high, and sensitivity can reach 2ng/ μ L.

4, the present invention be used for Thailand type α-ground poor (-- ^Thai) process that detects is as follows:

(1) extract detected sample DNA, extract genomic dna from peripheral blood, fine hair or amniocyte, concentration is at 10-500ng.

(2) pcr amplification: carry out pcr amplification take the genomic dna that extracts as template, obtain amplified production.

(3) electrophoresis detection is identified the PCR product: get the product 3.0 μ L in the pcr amplification; Point sample adds 0.005% nucleic acid dye in 1.5% agarose gel; Electrophoresis is about 50 minutes under 5V/cm voltage, takes out observations and the preservation of taking pictures in gel imaging system.

(4) as a result interpretation: Thailand type α-ground poor (-- ^Thai) amplified production length 722bp, normal genotype and other genotype sample are without amplification.

Embodiment two test kits of the present invention are to the detection case of clinical sample

1, take clinical routine blood test, hemoglobin electrophoresis result as contrast, utilizes test kit of the present invention, the unusual sample of 100 routine routine blood tests is detected.Filter out 3 routine Thailand type α-ground poor (-- ^Thai) patient, and other genotype and normal sample do not detect.Use test kit detected result of the present invention and routine blood test, hemoglobin electrophoresis result consistent.The sample that screens has been carried out the gold standard sequencing analysis, and detected result sees Table 3: test kit of the present invention is to the check situation of clinical sample, and the statistical study comparing result sees Table 4: test kit detected result of the present invention and sequencing result contrast.

Table 3

Table 4

Use test kit of the present invention that clinical 100 routine samples are detected, 3 examples are that Thailand type α-ground is poor as a result, compare with sequencing result, and positive coincidence rate and negative match-rate are 100%, rate of accuracy reached 100%.Above-mentioned positive sample is carried out repeated test experience.Choose 3 routine samples, carry out 3 lot number products, different people (2 people) operation is tested each sample at every turn and is repeated 3 detections, kits for evaluation repeatability, and detected result is consistent, and it is good that test kit detects repeatability.

2, the performance index of test kit of the present invention:

2.1, sensitivity: this test kit can stablize detect the human blood genomic dna concentration at 2ng/ μ L;

2.2, accuracy: this test kit detect Thailand type α-ground poor (-- ^Thai) accuracy reach (in the 100 routine samples that carry out, 3 routine positive sample detect entirely, and other 97 routine genotype and normal sample are without detected result) more than 99%;

2.3, specificity: this test kit detect Thailand type α-ground poor (-- ^Thai) specificity reaches more than 99% (duplicate detection result is all negative for 100 samples, other poor genotype samples in ground of 97 examples);

2.4, repeatability: the repeatability of this test kit is (choose 3 routine samples, different lot number products, different people (2 people) operation was done 2 times in one day, did altogether 2 days, tested each sample at every turn and repeated 3 times and detect, the result is consistent) more than 99%;

2.5, stability: this product is used before the deadline can satisfy above each index fully.

The clinical application of embodiment three test kits of the present invention

1, purposes

To the rare genotype Thailand type in the α-thalassemia (-- ^Thai) detect, for the poor genetic screening in ground provides reliable foundation.In clinical application, when patient clinical shows as-- ^SEAIsozygoty, the poor point mutation in α ground (detects α ^CSα, α ^QSα) do not detect, the poor product in absence type α-ground on the use market (detect-- ^SEA,-α ^3.7With-α ^4.2) when doing genetic analysis, the patient parents only have a side to carry-- ^SEAGene, and the opposing party without-- ^SEAGene, can carry out Thailand type α-ground poor (-- ^Thai) detection.The second situation, the patient has the poor clinical symptom in obvious standard type α-ground, but utilize the poor product in absence type α-ground (detect-- ^SEA,-α ^3.7With-α ^4.2) detect, do not detect the poor feature in disappearance ground, can carry out Thailand type α-ground poor (-- ^Thai) detection.

2, inspection principle

This test kit is based on Gap-PCR in conjunction with the know-why of agarose gel electrophoresis, Thailand's type (-- ^Thai) the relative conservative region in breaking point upstream and downstream position carries out specific amplification, realize to Thailand type α-ground poor (-- ^Thai) detection.

3, test kit chief component of the present invention

Table 5

4, applicable instrument

Pcr gene amplification instrument: ABI 9700, unexpected rival 9600, C1000 Touch ^TMThermalCycler (Bio-RAD); Electrophoresis apparatus: Powerpac Basic(Bio-RAD); Gel imaging analysis system: UV-3C(Zhuhai unexpected rival).

5, condition of storage and validity period

Condition of storage: the test kit lucifuge is stored in below-18 ℃, avoids multigelation.

Validity period: 6 months.

6, sample requirement

1) this test kit sample source is anticoagulated whole blood, and used antithrombotics is Sodium Citrate or EDTA, can not use anticoagulant heparin.

2) sample collection: venous blood samples 1-5mL enters to contain in the pipe of antithrombotics, the good sample information of mark.

3) blood sample is preserved: anticoagulated whole blood is placed in room temperature and is no more than 24 hours, and 2-8 ℃ of preservation is no more than one month, preserve below-18 ℃ and be no more than 2 years, but-70 ℃ of prolonged preservation should be avoided multigelation during freezing preservation.

4) blood sample transportation: need during the anticoagulated whole blood transportation to add the ice bag sealing with curling stone or bubble chamber, should guarantee that ice bag does not thaw, and the time limit in transit should not be above 72 hours.

7, the method for inspection

1) extraction of DNA:

This test kit is not specified requirement to human gene group DNA's extracting method, general available laboratory ordinary method (phenol-chloroform extraction process) or test kit extract the human gene group DNA, and the whole blood DNA of recommendation QIAGEN company extracts the DNA rapid extraction test kit of test kit or Yaneng Biotechnology (Shenzhen) Co., Ltd..If adopt the whole blood DNA of QIAGEN to extract test kit, directly the by specification application of sample; If extract DNA with phenol-chloroform or other method, then to measure DNA concentration, concentrate in case of necessity or dilute, after being adjusted to 2 ~ 200ng/L, DNA concentration just can carry out test experience.

2) application of sample pcr amplification

Take out the PCR reaction solution of test kit, cover at tube wall or pipe and to carry out mark, of short duration centrifugal in 5000rpm, then add respectively the testing sample DNA 4 μ L that extracted, reaction totally is 25 μ L, positive and negative contrasts is set, of short durationly centrifugally is placed in the fluorescent PCR detector and records sample and put order.

Amplification program is as shown in table 6.

Table 6

3) electrophoresis detection: get the direct point sample electrophoresis of 3 μ L amplified productions (having added the electrophoresis dyestuff), 1.5% agarose gel is dosed 0.005% nucleic acid dye; 110 volts of voltage 50 minutes, electrophoresis takes out observations and the preservation of taking pictures in gel imaging system after finishing.

4) setting of experiment establishment condition.

(1) the each detection of this product requirement all should arrange a positive quality control, and with the monitoring amplification condition, the result should be electrophoresis and the 722bp band only occurs.If without band, then illustrative experiment failure, the failure of prompting pcr amplification should be done detection again.

(2) the each detection of this product requirement arranges a negative Quality Control, and pollution is monitored, and the detected result of negative Quality Control is that electrophoresis is without band.If negative Quality Control has one or more band, then point out this experiment that pollution is arranged, answer after the decontamination and again detect.

(3) as a result interpretation: Thailand type α-ground poor (-- ^Thai), size is 722bp, and band amplification only occurs, the result as shown in Figure 1, swimming lane 1 negative contrast, swimming lane 2 be Thailand type α-ground poor (-- ^Thai), swimming lane 3 is DL2000 Markers.

8, the explanation of assay

1) pcr amplification does not have product

(1) confirms that DNA extraction and PCR process are without misoperation.

(2) the sample DNA concentration of extracting is excessively low, should increase the DNA consumption during PCR.

2) amplified production concentration is too high: suggestion reduces the applied sample amount when running the glue detection or chooses larger point sample sky and run glue.

9, the limitation of the method for inspection

1) this test kit can only detect Thailand type α-ground poor (-- ^Thai), the complementary poor sieving and diagnosis in carrying out ground.

10, product performance index

1) sensitivity: test kit of the present invention can stablize detect the human blood genomic dna concentration at 2ng/ μ L;

2) accuracy: test kit of the present invention detect Thailand type α-ground poor (-- ^Thai) the energy accuracy reach more than 99% (in the 100 routine samples that carry out, 3 routine positive sample detect entirely, and 97 other genotype of example and normal sample are without detected result);

3) specificity: test kit of the present invention detect Thailand type α-ground poor (-- ^Thai) specificity reaches more than 99% (duplicate detection result is all negative for 100 routine samples, other poor genotype samples in ground of 97 examples);

4) repeatability: the repeatability of test kit of the present invention is more than 99%;

5) stability: test kit of the present invention uses before the deadline can satisfy above each index fully.

11, precaution

1) this product only is used for vitro detection.

2) in transportation, have the PCR reaction solution and be attached on the tube wall (lid), therefore please first centrifugal before use, with the volume that guarantees the PCR reaction system and prevent potential pollution.

3) the contained indicator of PCR Mix has aberration to belong to normal phenomenon before amplification, does not affect amplification.

4) storage temperature necessarily can not be lower than below-18 ℃.

The above only is embodiments of the invention; be not so limit claim of the present invention; every equivalent structure or equivalent flow process conversion that utilizes specification sheets of the present invention and accompanying drawing content to do; or directly or indirectly be used in other relevant technical fields, all in like manner be included in the scope of patent protection of the present invention.

SEQUENCE LISTING

＜110〉Yaneng Biotechnology (Shenzhen) Co., Ltd.

＜120〉gene detecting kit of Thailand's type α-thalassemia

<160>2

<170>PatentIn version 3.3

<210>1

<211>24

<212>DNA

＜213〉artificial sequence

<400>1

agatcagttc cagcaagcc ggtg 24

<210>2

<211>13

<212>DNA

＜213〉artificial sequence

<400>2

gagattgccg attgttgaga ttg 23

Claims (4)

1. the gene detecting kit of Thailand's type α-thalassemia, it is characterized in that, comprise the PCR reaction solution, described PCR reaction solution comprises upstream primer THAI-F and downstream primer THAI-R, described primer is for poor breaking point position upstream 10724-10725 position, Thailand type α-ground, 1219-1220 position, downstream, the primer that 5 ' end and downstream 3 ' end design respectively in the breaking point upstream.

2. the gene detecting kit of Thailand according to claim 1 type α-thalassemia is characterized in that the nucleotides sequence of described upstream primer THAI-F is classified SEQ ID NO:1 as, and the nucleotides sequence of described downstream primer THAI-R is classified SEQ ID NO:2 as.

3. the gene detecting kit of Thailand according to claim 2 type α-thalassemia is characterized in that, the concentration of described PCR reaction solution middle and upper reaches primer THAI-F and downstream primer THAI-R equates to be 0.1-1 μ M, MgCl ₂Concentration is 1.5mM-5mM, and the concentration of dNTP is 100nM-300nM, and the concentration of archaeal dna polymerase is the 1-5U/ reaction.

4. the gene detecting kit of Thailand according to claim 1 type α-thalassemia is characterized in that described each component concentration of PCR reaction solution is:

Deionized water: 10 μ L;

5×Q buffer：5μL；

10×CoralLoad PCR Buffer：2.5μL；

2.5mM the equal-volume mixed solution of dATP, dCTP, dGTP, dTTP: 2 μ L;

10 μ M primer THAI-F:0.5 μ L;

10 μ M primer THAI-R:0.5 μ L;

5U/ μ L Hotstar Taq enzyme: 0.5 μ L.

Images