CN102943116B - Gene detection kit for Thailand type alpha-thalassemia - Google Patents

Abstract

The invention relates to the field of biological medicine, and in particular relates to a gene detection kit for quickly detecting Thailand type alpha-thalassemia in a clinic sample. The technical scheme of the gene detection kit aims at providing the gene detection kit for the Thailand type alpha-thalassemia, wherein the gene detection kit comprises PCR (polymerase chain reaction) liquid, the PCR reaction liquid comprises a forward primer THAI-F and a reverse primer THAI-R, the primers are the forward 10724-10725 position and the reverse 1219-1220 position of the breaking point position aiming at the Thailand type alpha-thalassemia, and the primers are respectively designed at the forward 5'-end and the reverse 3'-end of the breaking point. According to the kit provided by the invention, the leak detection of the alpha-thalassemia caused by the common blood screening method can be reduced, the birth of the children who suffer from the heavy type alpha-thalassemia can be reduced or avoided, and a condition can be created for the more comprehensive thalassemia screening. The detection kit provided by the invention is convenient to use, high in accuracy, and good in social benefit and economic benefit in the high incidence area of the thalassemia.

Description

The gene detecting kit of Thailand's type α-thalassemia

Technical field

The present invention relates to biomedicine field, be specifically related to a kind of test kit of rapid detection Thailand type gene of alpha thalassemia type in clinical sample.

Background technology

α-thalassemia " thalassemia " (be called for short α-ground poor) is a kind of autosomal recessive hereditary diseases, is one of modal mankind's single gene inheritance disease in the world, is listed in 6 kinds of common diseases of harm humans health by the World Health Organization.This disease is disappearance due to globin gene sequence or sudden change, cause α-globin peptide chain dyssynthesis, ɑ-peptide chain of globin synthesis is reduced maybe can not synthesize to cause, make the α chain of composition globin and β chain synthesis overbalance and the hemolytic anemia that causes.

Mankind's alpha globin gene bunch is positioned at No. 16 karyomit(e) p13.3, is about 40kb, and every bar karyomit(e) has 2 α pearl protein-2 genes, and dyad has 4 alpha globin genes; Most of α ground is poor is that caused by disappearance due to alpha globin gene, minority is caused by point mutation.With regard to a monoploid is individual, according to the degree that alpha globin synthesis reduces, two class defects can be divided into by poor for α ground: a class is the poor 1(α in α ground ⁰-ground is poor), feature is disappearance 2 α genes, and alpha globin synthesis is obstructed completely, what China was more common be South East Asia absence type poor (-- ^sEA); Two classes are the poor 2(α in α ground ⁺-thalassemia), being undergone mutation by a α gene or lacking causes.The alpha Thalassemia of China about 80% is caused by the gene of coding for alpha albumen (α 2 is or/and α 1) lacks; Modal deletion type is-α ^3.7,-α ^4.2,-- ^sEA3 kinds.Along with illustrating further of the poor mechanism in α-ground, some new genetically deficient types are found in succession, such as-- ^11.1,-α ^2.4,-α ^2.7, Philippines type α ground poor (-- ^fIL), Thailand type α ground poor (-- ^thai) and (type α ground in Hong Kong is poor) HK α α etc.

Since Boonsa etc. report (-- ^thai) since, there is case to be detected successively.Thailand type α-ground poor genetically deficient fragment than South East Asia genetically deficient ground poor (-- ^sEA) fragment also will grow, and can form medium and heavy alpha Thalassemia clinically, i.e. Pasteur's oedema tire of lacking of the sick and Thailand's type of the HbH of Thailand's type disappearance.Because the Hematological Features of Thailand's type is poor consistent with South East Asia absence type α ground, all show the low pigment of minicell, MCV reduces and MCH reduces, and thus may cause mistaken diagnosis and fail to pinpoint a disease in diagnosis, and then causes the birth of the HbH disease of Thailand's type disappearance and Pasteur's Hb Ballt's hydtops fetails Hb Bart's of Thailand's type disappearance.Therefore, carry out Thailand type α-ground poor (-- ^thai) detect to genetic counseling and antenatal diagnosis significant.

The poor detection technique in existing α-ground mainly contains routine blood test detection, erythrocyte fragility detection, hemoglobin electrophoresis etc., the defect of these methods can only carry out the poor examination in preliminary ground to patient, cannot make a definite diagnosis Patient genotype, and easily fail to pinpoint a disease in diagnosis lightly poor, cause the birth of the poor infant in severe of future generation ground.There is the method made a definite diagnosis according to the poor gene in α-ground in recent years, detection method has Southern hybridization, multiple Gap-PCR, multiple ligase enzyme rely on the methods such as probe amplification technology (MLPA), real-time fluorescence quantitative PCR, reverse dot blot hybridization, direct Sequencing technology, and each gene diagnosis method is summarized as follows:

(1) Southern hybridization technique: α, the beta globin genes probe of Southern marking hybridization technique and labelled with radioisotope are hybridized, according to collection of illustrative plates, can poor 1, α-ground, differential diagnosis α-ground poor 2, HbH disease, Bart ' s oedema tire etc.Although the method accuracy compared with high but complex operation, waste time and energy, the amount of DNA demand is large, need radio-labeling, and can not be applied to the detection of non-missing gene, be thus generally only suitable for research and use, be unsuitable for clinical applying.

(2) probe ligation amplification technology (MLPA) is relied on: MLPA is the detection being usually used in the poor missing gene in α ground grown up for 2002, but because testing cost is high, complex operation, consuming time longer, testing process reaches 16 hours, and need special plant and instrument, and general only for studying use, be not easy to applying of Molecular screening method.

(3) sequencing technologies: sequencing technologies, directly to the analysis of DNA sequence dna, is considered to the gold standard of clinical detection always; Current sequencing technologies is faced with process (nucleic acid extraction), the amplification standardized attestation problem of sample, signal detection, special the makeing mistakes and Error Correcting Problem of order-checking platform, and information biology aspect possibility produced problem, clinical verification program and standardization issue etc., never effective solution, therefore also fails to apply in clinical.

(4) reverse dot blot hybridization (Reverse Dot Blot, RDB): this law is on the basis of pcr amplification, by the PCR primer be marked on primer and the specific probe hybridization be fixed on film bar, then by fluorescence excitation or a series of color reaction observations.This method is sensitive, but consuming time longer, is generally used for point mutation detection.

(5) technology of Gap-PCR and improvement thereof: since the round pcr invention eighties, because it is simple to operate, this technology is widely used in poor molecular diagnosis, at two ends, absent region design pair of primers, the very long scope not belonging to amplification of two primer extension products under normal circumstances, and can specific amplification be there is when there is absent region.Nineteen ninety Lebo etc. apply round pcr and detect the application such as α-ground poor 1, Dode and Baysal round pcr detection α-ground poor 2.China poor (-α in modal 3 kinds of absence type a ground can only be examined in the market with the test kit of Gap-PCR exploitation ^3.7,-α ^4.2with-- ^sEA).

(6) real-time fluorescence quantitative PCR (Taqman probe method): real-time fluorescence quantitative PCR is the most popular detection platform of current clinical diagnosing system, fluorophor is added in PCR reaction system, fluorescent signal is utilized to accumulate, the fluorescent signal that Real-Time Monitoring PCR process and continuous analysing amplified product are correlated with, carries out the method for quantitative analysis to unknown template finally by typical curve.In thalassemia detects, be confined to a kind of genotypic detection, workload is large; Probe needs fluorescent mark, and testing cost is high.

Currently available products and patent Patents are " for diagnosing thalassemic DNA chip and preparation method thereof ", " diagnosing alpha-thalassemic nucleic acid film bar and test kit " and " for diagnosing beta-thalassemic nucleic acid hybridization film bar and test kit ", these patents and the present application patent do not belong to same technology platform, and the ASSOCIATE STATISTICS contrast of the patent that disclose or have the right relevant to the present application is in table 1.

Table 1

At present, the poor test kit in diagnosis absence type α ground of China's clinical application all adopts multiple Gap-PCR technology, mainly for-- ^sEA,-α ^3.7with-α ^4.2detect, as Yaneng Biotechnology (Shenzhen) Co., Ltd., prebiotic hall bio tech ltd, Shenzhen and Guangzhou Da An genome company α-poor detection kit; Chaozhou Kaipu Biochemistry Co., Ltd.'s PCR-based is combined the α developed with luminex, 2 kinds of mutated-genotype (α that β-thalassemic mutator gene combined detection kit is also only additional α-ground is poor ^cSα, α ^qSdetection α), Thailand type α-ground is poor not in the scope that it detects.

In the poor testing product patented technology in existing α-ground, have no directly carry out Thailand type α-ground poor (-- ^thai) detection, all only occur based on-- ^sEA,-α ^3.7,-α ^4.2,-α ^2.8deng detection technique and method.

Summary of the invention

The object of the invention is exploitation a kind of simple to operate, fast for Thailand type α-ground poor (-- ^thai) test kit that detects, stable to Thailand type α-ground poor (-- ^thai) genotype diagnoses.

Technical scheme of the present invention is for providing the gene detecting kit of a kind of Thailand type α-thalassemia, comprise PCR reaction solution, described PCR reaction solution comprises upstream primer THAI-F and downstream primer THAI-R, described primer is for poor breaking point position upstream 10724-10725 position, Thailand type α-ground, 1219-1220 position, downstream, holds at breaking point upstream 5 ' end and downstream 3 ' primer designed respectively.

Preferably, in the gene detecting kit of above-mentioned Thailand type α-thalassemia, the nucleotides sequence of described upstream primer THAI-F is classified as SEQ ID NO:1, and the nucleotides sequence of described downstream primer THAI-R is classified as SEQ ID NO:2.

Preferably, in the gene detecting kit of above-mentioned Thailand type α-thalassemia, the concentration of described PCR reaction solution middle and upper reaches primer THAI-F and downstream primer THAI-R is equal is 0.1-1 μM, MgCl ₂concentration is the concentration of 1.5mM-5mM, dNTP is 100nM-300nM, and the concentration of archaeal dna polymerase is 1-5U/ reaction.

Preferably, in the gene detecting kit of above-mentioned Thailand type α-thalassemia,

The described each component concentration of PCR reaction solution is:

Deionized water: 10 μ L;

5×Q buffer：5μL；

10×CoralLoad PCR Buffer：2.5μL；

The equal-volume mixed solution of 2.5mM dATP, dCTP, dGTP, dTTP: 2 μ L;

10 μMs of primer THAI-F:0.5 μ L;

10 μMs of primer THAI-R:0.5 μ L;

5U/ μ L Hotstar Taq enzyme: 0.5 μ L.

Test kit of the present invention is based on the know-why of Gap-PCR in conjunction with agarose gel electrophoresis, Thailand's type (-- ^thai) breaking point upstream and downstream position carries out specific amplification relative to conservative region, realize to Thailand type α-ground poor (-- ^thai) detection.

The present invention further illustrate Thailand type α-ground poor (-- ^thai) breakpoint location, at gene recombination breakpoint location upstream and downstream design primer, adopt simultaneously delivered the primer sequence in document to the sample of clinical collection (MCV is starkly lower than 80, MCH and is starkly lower than the sample of 28 or only carries one-- ^sEAthe Hb Ballt's hydtops fetails Hb Bart's sample of gene) screen, the positive sample screened is carried out the template of Sanger sequence verification as primer screening, by further system and program optimization, finally determine the optimization routines of each component final concentration and amplification in preferred combination of primers, system, realize poor on the special amplification Thailand type α-ground of stable system optimized (-- ^thai) gene-specific fragments.

Although conventional design of primers is simple, the present invention, due to the high homology of α-globin gene, takes into full account the length of primer, GC content and annealing temperature during design of primers.By testing the primer of design, and raising whole redesign primer on the basis of test, so repeatedly finally obtaining the primer that specific amplification of the present invention is strong and amplification efficiency is high.

Test kit of the present invention can detect the poor gene type in a kind of ground newly, for reducing the poor under-enumeration in α-ground that normal blood examination method causes, reducing or avoiding more fully the poor screening of birth of the poor infant in heavy α-ground to create condition.Test kit of the present invention is easy to use, accuracy is high, can produce good Social benefit and economic benefit in poor district occurred frequently over the ground.

Accompanying drawing explanation

Fig. 1 be test kit of the present invention to Thailand's type (-- ^thai) the poor detected result in α-ground, 1: negative control; 2: Thailand's type (-- ^thai) α-ground is poor; 3:DL2000 Markers.

Embodiment

By describing technology contents of the present invention, structural attitude in detail, realized object and effect, accompanying drawing is coordinated to be explained in detail below in conjunction with embodiment.

This test kit is based on the know-why of Gap-PCR in conjunction with agarose gel electrophoresis, poor on Thailand type α-ground (-- ^thai) breaking point upstream and downstream position carries out specific amplification relative to conservative region, realize to Thailand type α-ground poor (-- ^thai) detection.

The composition of the gene detecting kit of embodiment one Thailand of the present invention type α-thalassemia

1, the design of primer and screening:

People α-globin gene order is compared, Thailand type α-ground poor (-- ^thai) breaking point position upstream be 10724-10725 position (Genebank No:Z84721), downstream is 1219-1220 position (Genebank No:Z69706), at breaking point upstream 5 ' end and downstream 3 end ' design primer respectively, THAI-F is incorporated into 5 ' end position of a-globin protein gene bunch, and THAI-R is incorporated into 3 ' end position of a-globin protein gene bunch.Utilize orthogonal test and grads PCR experiment, carry out the screening of primer, screen suitable combination of primers, preferred combination of primers sequence is as follows:

THAI-F：AGATCAGTTCCAGCAAGCCTGGTG；

THAI-R：GAGATTGCCGATTGTTGAGATTG。

2, the optimization of PCR reaction system

Isocyatic 2 PCR primer storage liquid THAI-F and the THAI-R of equal-volume, the concentration range of every bar primer is at 0.1-1 μM, MgCl ₂final concentration selects 1.5mM-5mM, isocyatic four kinds of deoxy adenosine triphosphate (dATP, dGTP, dCTP, dTTP) mixed solution dNTP final concentrations select 100nM-300nM, archaeal dna polymerase final concentration selects 1-5U/ reaction, utilize orthogonal test method, contrasted by great many of experiments, determine that final PCR reaction system is in table 2.

Table 2

As table 2: in the PCR reaction system formula of optimization, DNA application of sample amount is 4 μ L, total reaction volume is 25 μ L.

3, the determination of reaction conditions

Present method adopts Standard PCR system, and reaction conditions divides following steps optimization:

Through great many of experiments, the optimum reaction condition finally determined is:

Annealing temperature and annealing time on pcr amplification efficiency and specific amplification impact comparatively large, annealing temperature is on the low side has non-specific amplification band in above-mentioned condition optimizing result display, and may cause false positive results, temperature drift amplification efficiency is on the low side, and sensitivity declines.The reaction conditions specificity that this programme is set up is good, and amplification efficiency is high, and sensitivity can reach 2ng/ μ L.

4, the present invention be used for Thailand type α-ground poor (-- ^thai) process that detects is as follows:

(1) extract detected sample DNA, extract genomic dna from peripheral blood, fine hair or amniocyte, concentration is at 10-500ng.

(2) pcr amplification: carry out pcr amplification with the genomic dna extracted for template, obtain amplified production.

(3) electrophoresis detection qualification PCR primer: get the product 3.0 μ L in pcr amplification; Point sample is in additional 0.005% nucleic acid dye of agarose gel of 1.5%; Electrophoresis about 50 minutes under 5V/cm voltage, takes out observations in gel imaging system and preservation of taking pictures.

(4) result interpretation: Thailand type α-ground poor (-- ^thai) amplified production length 722bp, normal genotype and other genotype sample are without amplification.

Embodiment two test kit of the present invention is to the detection case of clinical sample

1, with clinical routine blood test, hemoglobin electrophoresis result for contrast, utilize test kit of the present invention, the sample of 100 routine routine blood test exceptions detected.Filter out 3 routine Thailand type α-ground poor (-- ^thai) patient, and other genotype and normal sample do not detect.Use test kit detected result of the present invention and routine blood test, hemoglobin electrophoresis result consistent.Carried out gold standard sequencing analysis to the sample screened, detected result is in table 3: test kit of the present invention is to the inspection situation of clinical sample, and statistical study comparing result is in table 4: test kit detected result of the present invention and sequencing result contrast.

Table 3

Table 4

Use test kit of the present invention to detect clinical 100 routine samples, 3 examples are that Thailand type α-ground is poor as a result, and contrast with sequencing result, positive coincidence rate and negative match-rate are 100%, rate of accuracy reached 100%.Repeated test experience is carried out to above-mentioned positive sample.Choose 3 routine samples, carry out 3 lot number products, different people (2 people) operates, and each sample of each test repeats 3 times and detects, kits for evaluation repeatability, and detected result is consistent, and it is good that test kit detects repeatability.

2, the performance index of test kit of the present invention:

2.1, sensitivity: this test kit can stablize detect human blood genomic dna concentration at 2ng/ μ L;

2.2, accuracy: this test kit detect Thailand type α-ground poor (-- ^thai) accuracy reach more than 99% (in carry out 100 routine samples, 3 routine positive sample detect entirely, and other 97 routine genotype and normal sample are without detected result);

2.3, specificity: this test kit detect Thailand type α-ground poor (-- ^thai) specificity reaches more than 99% (duplicate detection result is feminine gender for 100 samples, other poor genotype samples in ground of 97 examples);

2.4, repeatability: the repeatability of this test kit is more than 99% (choose 3 routine samples, different lot number product, different people (2 people) operates, and does 2 times in one day, does 2 days altogether, and each sample of each test repeats 3 times and detects, and result is consistent);

2.5, stability: this product uses before the deadline and can meet above each index completely.

The clinical application of embodiment three test kit of the present invention

1, purposes

To in α-thalassemia rare genotype Thailand type (-- ^thai) detect, for the genetic screening that ground is poor provides reliable foundation.In clinical application, when patients with clinical manifestations is-- ^sEAisozygoty, the α poor point mutation in ground (detects α ^cSα, α ^qSα) do not detect, use the poor product in absence type α-ground on market (detect-- ^sEA,-α ^3.7with-α ^4.2) when doing genetic analysis, patient parents only have a side to carry-- ^sEAgene, and the opposing party without-- ^sEAgene, can carry out Thailand type α-ground poor (-- ^thai) detection.The second situation, patient has the poor clinical symptom in obvious standard type α-ground, but utilize the poor product in absence type α-ground (detect-- ^sEA,-α ^3.7with-α ^4.2) detect, do not detect and lack poor feature, can carry out Thailand type α-ground poor (-- ^thai) detection.

2, inspection principle

This test kit is based on the know-why of Gap-PCR in conjunction with agarose gel electrophoresis, Thailand's type (-- ^thai) breaking point upstream and downstream position carries out specific amplification relative to conservative region, realize to Thailand type α-ground poor (-- ^thai) detection.

3, test kit of the present invention mainly forms

Table 5

4, instrument is suitable for

PCR gene amplification instrument: ABI 9700, unexpected rival 9600, C1000 Touch ^tMthermalCycler (Bio-RAD); Electrophoresis apparatus: Powerpac Basic(Bio-RAD); Labworks image acquisition and analysis software: UV-3C(Zhuhai unexpected rival).

5, condition of storage and validity period

Condition of storage: test kit lucifuge is stored in less than-18 DEG C, avoids multigelation.

Validity period: 6 months.

6, sample requirement

1) this test kit samples sources is anticoagulated whole blood, and antithrombotics used is Sodium Citrate or EDTA, can not use anticoagulant heparin.

2) sample collection: venous blood samples 1-5mL enters in the pipe containing antithrombotics, has marked sample information.

3) blood sample is preserved: anticoagulated whole blood is placed in room temperature and is no more than 24 hours, and 2-8 DEG C of preservation is no more than one month, and less than-18 DEG C preservations are no more than 2 years, can preserve for a long time for-70 DEG C, should avoid multigelation during freezen protective.

4) blood sample transport: ice bag sealing need be added with curling stone or bubble chamber during anticoagulated whole blood transport, should ensure that ice bag does not thaw, and the time limit in transit be no more than 72 hours.

7, the method for inspection

1) extraction of DNA:

The extracting method of this test kit to human gene group DNA does not specify requirement, general Available experimental room ordinary method (phenol-chloroform extraction process) or test kit extract human gene group DNA, and the whole blood DNA of recommendation QIAGEN company extracts the DNA rapid extraction test kit of test kit or Yaneng Biotechnology (Shenzhen) Co., Ltd..Whole blood DNA according to QIAGEN extracts test kit, direct by specification application of sample; If extract DNA by phenol-chloroform or other method, then to measure DNA concentration, carry out if desired concentrating or diluting, after DNA concentration being adjusted to 2 ~ 200ng/L, just can carry out test experience.

2) application of sample pcr amplification

Take out the PCR reaction solution of test kit, cover at tube wall or pipe and carry out mark, of short duration centrifugal in 5000rpm, then add the testing sample DNA 4 μ L extracted respectively, reaction is totally 25 μ L, positive and negative contrast is set, of short duration centrifugal to be placed in fluorescent PCR detector and to record sample put order.

Amplification program is as shown in table 6.

Table 6

3) electrophoresis detection: get the direct point sample electrophoresis (adding electrophoretic pigment) of 3 μ L amplified production, the agarose gel of 1.5%, doses 0.005% nucleic acid dye; 110 volts of voltage 50 minutes, after electrophoresis terminates, takes out observations in gel imaging system and preservation of taking pictures.

4) setting of establishment condition is tested.

(1) this product requirement detects at every turn and all should arrange a positive quality control, and to monitor amplification condition, result should be electrophoresis and only occurs 722bp band.If without band, then illustrative experiment failure, the failure of prompting pcr amplification, should detect again.

(2) this product requirement detects at every turn and arranges a negative Quality Control, monitors pollution, and the detected result of negative Quality Control is that electrophoresis is without band.If negative Quality Control has one or more band, then point out this experiment to have pollution, again detect after answering decontamination.

(3) result interpretation: Thailand type α-ground poor (-- ^thai), size is 722bp, and only occur one band amplification, as shown in Figure 1, swimming lane 1 is negative control to result, swimming lane 2 be Thailand type α-ground poor (-- ^thai), swimming lane 3 is DL2000 Markers.

8, the explanation of assay

1) pcr amplification does not have product

(1) confirm that DNA extraction and PCR process are without misoperation.

(2) the sample DNA concentration extracted is too low, should increase DNA consumption during PCR.

2) amplified production concentration is too high: suggestion reduces applied sample amount when running glue detection or chooses larger point sample sky carries out race glue.

9, the limitation of the method for inspection

1) this test kit can only detect Thailand type α-ground poor (-- ^thai), the sieving and diagnosis that complementary carrying out ground is poor.

10, product performance index

1) sensitivity: test kit of the present invention can stablize detect human blood genomic dna concentration at 2ng/ μ L;

2) accuracy: test kit of the present invention detect Thailand type α-ground poor (-- ^thai) energy accuracy reach more than 99% (in carry out 100 routine samples, 3 routine positive sample detect entirely, and 97 other genotype of example and normal sample are without detected result);

3) specificity: test kit of the present invention detect Thailand type α-ground poor (-- ^thai) specificity reaches more than 99% (duplicate detection result is feminine gender for 100 routine samples, other poor genotype samples in ground of 97 examples);

4) repeatability: the repeatability of test kit of the present invention is more than 99%;

5) stability: test kit of the present invention uses before the deadline and can meet above each index completely.

11, precaution

1) this product is only for vitro detection.

2) in transportation, have PCR reaction solution is attached on tube wall (lid), therefore please first centrifugal before use, to ensure the volume of PCR reaction system and to prevent potential pollution.

3) indicator contained by PCR Mix has aberration to belong to normal phenomenon before amplification, does not affect amplification.

4) storage temperature necessarily can not lower than less than-18 DEG C.

The foregoing is only embodiments of the invention; not thereby the scope of the claims of the present invention is limited; every utilize specification sheets of the present invention and accompanying drawing content to do equivalent structure or equivalent flow process conversion; or be directly or indirectly used in other relevant technical fields, be all in like manner included in scope of patent protection of the present invention.

SEQUENCE LISTING

<110> Yaneng Biotechnology (Shenzhen) Co., Ltd.

The gene detecting kit of <120> Thailand type α-thalassemia

<160>2

<170>PatentIn version 3.3

<210>1

<211>24

<212>DNA

<213> artificial sequence

<400>1

agatcagttc cagcaagcc ggtg 24

<210>2

<211>13

<212>DNA

<213> artificial sequence

<400>2

gagattgccg attgttgaga ttg 23

Claims (1)

1. the gene detecting kit of Thailand's type α-thalassemia, it is characterized in that, comprise PCR reaction solution, described PCR reaction solution comprises upstream primer THAI-F and downstream primer THAI-R, described primer is for poor breaking point position upstream 10724-10725 position, Thailand type α-ground, 1219-1220 position, downstream, the primer designed respectively is held at breaking point upstream 5 ' end and downstream 3 ', the nucleotides sequence of described upstream primer THAI-F is classified as SEQ ID NO:1, and the nucleotides sequence of described downstream primer THAI-R is classified as SEQ ID NO:2;

The described each component concentration of PCR reaction solution is:

Deionized water: 10 μ L;

5×Q buffer：5μL；

10×CoralLoad PCR Buffer：2.5μL；

2.5mM the equal-volume mixed solution of dATP, dCTP, dGTP, dTTP: 2 μ L;

10 μMs of primer THAI-F:0.5 μ L;

10 μMs of primer THAI-R:0.5 μ L;

5U/ μ L Hotstar Taq enzyme: 0.5 μ L.