CN103173533A

CN103173533A - Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting TRECs and KRECs genes and application thereof

Info

Publication number: CN103173533A
Application number: CN2012104707135A
Authority: CN
Inventors: 王晓川; 刘丹如; 王牧; 房聪
Original assignee: WUXI UNI-KING CLINICAL TESTING INSTITUTE Co Ltd
Current assignee: WUXI UNI-KING CLINICAL TESTING INSTITUTE Co Ltd
Priority date: 2012-11-20
Filing date: 2012-11-20
Publication date: 2013-06-26
Anticipated expiration: 2032-11-20
Also published as: CN103173533B

Abstract

The invention relates to a real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting TRECs and KRECs genes and application thereof. The kit comprises a PCR system based on nested PCR technology and a real-time fluorescence quantitative PCR system based on real-time fluorescence PCR technology, wherein the nested PCR system comprises forward and reverse primers for TRECs, KRECs and beta-actin genes; and the real-time fluorescence quantitative PCR system comprises forward and reverse primers and specific fluorescence probes for TRECs, KRECs and beta-actin genes. The kit can be used for quickly screening the T-cell level and B-cell level of a neonatal immune system, and has the advantages of high sensitivity, high stability and excellent reproducibility. The method is suitable for combined quantitative detection of TRECs and KRECs, can be used for screening functions of the neonatal immune system, and has practical clinical application value.

Description

Real-time fluorescence quantitative PCR test kit and the application of a kind of detection by quantitative TRECs and KRECs gene

Technical field

The invention belongs to external nucleic acid diagnostic field, relate to free φt cell receptor resecting loop (the T-cell receptor excision circles of a kind of detection by quantitative, TRECs) and κ-deletion restructuring resecting loop (κ-deleting recombination excision circles, KRECs) the real time fluorescent quantitative poly chain reaction of gene (Polymerase Chain Reaction, PCR) test kit and application thereof.

Background technology

Primary immunodeficiency disease (Primary Immunodeficiency Disease, PID) be entirely not cause immunodeficient disease due to immune dysfunction because of immunity system hereditary defect or congenital development, its total incidence is: the U.S. 1/10000, Australia 2.82/100000 people, Japan and Sweden 1/5000 people, China's Hongkong 1/8000 people.If the comprehensive statistical information of domestic shortage according to 1/10000 sickness rate, has 2500 new PID cases in 2,500 ten thousand newborn infants of the annual birth of China, and the Childhood of whole, the accumulative total patient reaches 30,000-60,000 examples.Primary immunodeficiency disease with genetic correlation, often occurs in the infant, repeated infection can occur, but serious life-threatening.Because wherein some may obtain effective treatment, therefore in time diagnosis is still very important.

November calendar year 2001, (the Centers for DiseaseControl and Prevention of U.S. CDC, CDC) hold symposium in Atlanta, the provincial capital, George Asia, foundation is for neonatal screening (Newborn Screening, NBS) scheme of experiment and EARLY RECOGNITION PID is so that can early diagnosis and therapy PID patient.U.S. CDC in 2009 carries out severe combined immunodeficiency (Severe CombinedImmunodefieieney Disease, SCID) neonatal screening in U.S.'s Wei Sikang star state.

By the difference of immune deficiency character, it is that main (being that antibody deficiency is main immune deficiency), cellular immunity deficiency are associating immune deficiency three major types main and that both have concurrently that primary immunodeficiency disease can be divided into humoral immune defect.In addition, the non-specific immunity defective such as complement defect, phagocytic cell defective also belongs to this group.Severe combined immunodeficiency is with T lymphopenia or dysfunction, companion or reduce or functional defect is one group of disease of feature without bone-marrow-derived lymphocyte and NK cell quantity, Neonatal Morbidity is greatly about 1/50000 to 1/100000, this disease age of onset early, clinical manifestation is heavy, prognosis is relatively poor, and is if do not diagnosed timely and treat, how dead in 2 years old.SCID is a kind of serious severe combined immunodeficiency, if infant does not carry out effective immunologic reconstitution, often dead in infancy, the time of immunologic reconstitution and prognosis in close relations, if carry out the hematopoietic stem cell transplantation survival rate near 95% in birth in 3 months, be down to 76% and carry out the hematopoietic stem cell transplantation survival rate after 3 months, therefore include SCID in neonatal screening very necessary.

At present SCID mainly is divided into T-B+SCID and the large class of T-B-SCID two, and wherein the pathogenesis of T-B+SCID has γ c genetic flaw, Janus Kinase 3(JAK3) genetic flaw, IL-7R α genetic flaw, CD45 genetic flaw, CD3 δ/CD3 ε/CD3 ζ genetic flaw; The pathogenesis of T-B-SCID has RAG1/2 genetic flaw, DCLRE1C genetic flaw, ADA genetic flaw, DNA PKcs genetic flaw, reticular dysgenesis.In addition, SCID also comprises Oemnn syndrome, DNA ligase VI, Cemunnos/XLF defective, CD40L defective, CD40 defective, purine nucleoside phosphorylase (PNP) defective, CD3 γ defective, CD8 defective, ZAP-70 defective, MHC class Ⅰmolecule defective, MHC class Ⅱmolecule defective, calcium channel defective etc.Cause the reason of SCID various, diagnose very difficult, but the quantity that the common trait of all SCID is mature T cells significantly reduces.

The process that the T cell breaks up in thymus gland be occur in the rearrangement of φt cell receptor gene in, be finally the combination of V, D and J gene fragment; In the process of each V, D and the rearrangement of J gene fragment, there is cut cyclic DNA product in the capital, the DNA that is cut forms free φt cell receptor resecting loop (T-cell receptor excision circles, TRECs), and the T cell of 70% express alpha β TCRs all produced in ripe late period

TREC.TRECs is highly stable in the T cell, does not increase along with the propagation of cell, but constantly is diluted, and the level of newborn infant TRECs is the highest, but obviously reduces in the level of rear 5 years TRECs of birth.Utilize quantitative PCR detection δ Rec-ψ J α TRECs can reflect the T lymphocyte quantity of the up-to-date generation of peripheral blood, in patient T cell, TRECs lacks or minimizing in various degree, can be used as the screening method of SCID, examination goes out the newborn infant of T cell maturation defective, be conducive to early diagnose early treatment, reduce neonatal death.

Antibody deficiency is that main immunodeficient disease belongs to the cellular immunity deficiency class, it is the one group of PID that causes due to B cell early development obstacle, due to humoral immune defect, bacterium easily occurs repeatedly to be infected, showing as the minimizing in various degree of B cell and immunoglobulin (Ig), is the highest primary immunodeficiency disease of sickness rate.Be divided at present following a few class: 1) serious hypogammag lobulinemia, pathogenesis has BTK genetic flaw, μ chain shortage, λ 5 chain shortages, Ig α shortage, Ig β shortage, BLNK (BLNK) shortage, osteomyelodysplasia etc., wherein the chain agammaglobulinemia of X (XLA) is modal humoral immune defect disease, its cause of disease is Bruton Tyrosylprotein kinase (Bruton's Tyrosine Kinase, BTK) defective shows as B cell and immunoglobulin (Ig) significantly low; 2) severe of serum IgG and IgA reduce companion B cell normal, reduce or significantly reduce, pathogenesis has Common Variable Immunodeficiency (Common Variable Immunodeficiency Disease, CVID), inducible co-stimulator (Inducible Co-Stimulator, ICOS) defective, CD19 defective, the chain Lymphoid tissue propagation of X syndromes (X-linked Lymph Proliferative Disease, XLP); 3) severe of serum IgG and IgA reduces, IgM is normal or increase (being high IgM syndromes), pathogenesis has CD40L defective, CD40 defective, activation to induce cytidine deaminase (Activation-induced Cytidine Deaminase, AICDA) defective, uridylic N-glycosylase (Uracil-N-Glycosylase, UNG) defective; 4) isotype or light chain lack, and pathogenesis has Ig heavy chain shortage, κ chain shortage, selectivity IgG subclass defective, selective IgA deficiency etc.Antibody deficiency is that the main immunodeficient disease cause of disease is various, diagnose very difficultly, but common trait is bone-marrow-derived lymphocyte shortage or minimizing in various degree.

In the B cell mature process, the κ that forms during gene rearrangement that the λ chain of immunoglobulin (Ig) occurs-deletion resecting loop (κ-deleting recombination excision circles that recombinates, KRECs), KRECs does not increase along with the propagation of cell yet, but constantly is diluted.Because antibody deficiency is the B cell maturation defective in main immunodeficient disease occur in κ-deletion and recombinate before, in patient B cell, KRECs lacks or minimizing in various degree, utilize quantitative PCR method to detect KRECs and can be used as the neonatal screening method that antibody deficiency is main immunodeficient disease, therefore by can examination to the quantitative assay of KRECs going out to suffer from the newborn infant of B cell maturation defective.

United screening newborn infant primary T cell and B cellular immunity deficiency, can detect newborn infant T cell and b cell level, not only can examination SCID and the antibody defective be main immunodeficient disease, and can provide clinical relevant indication for other and T cell primary immunodeficiency disease or the other system disease relevant with the B cell development, be conducive to early diagnosis and treatment.But, also lack at present method and the test kit that can unite detection by quantitative TRECs and KRECs.

Summary of the invention

The objective of the invention is to be to provide a kind of copy number by detection by quantitative TRECs and KRECs gene, be used for the real-time fluorescence quantitative PCR test kit of examination newborn infant primary T cell and B cellular immunity deficiency, this test kit is applicable to exist at present all types of fluorescence quantitative gene extenders on market.The present invention can detect the level of newborn infant T cell and B cell, and normally whether judgement neonatal immune system function has good application prospect in the Clinical Laboratory field.

Another object of the present invention is the application that has been to provide in examination newborn infant T cell and B cellular immunity deficiency, sample acquisition, storage convenience that the mentioned reagent box is required, and sensitivity and specificity are high, and detection method is easy, quick, and experimental result is reliable.

In order to realize above-mentioned purpose, the invention provides:

the real-time fluorescence quantitative PCR test kit of a kind of detection by quantitative TRECs and KRECs gene, this test kit is comprising DNA extraction liquid, the nest-type PRC reaction solution, the standard substance I that comprises TRECs gene insertion sequence, the standard substance II that comprises KRECs gene insertion sequence, the standard substance III that comprises β-actin gene insertion sequence, the negative control product, the blank product, comprise the real-time fluorescence primer of TRECs gene and the Fluorescence PCR liquid I of probe, comprise the Fluorescence PCR liquid II of the real-time fluorescence primer of KRECs gene and probe and comprise the real-time fluorescence primer of β-actin gene and the Fluorescence PCR liquid III of probe.

In a scheme of the present invention, the nest-type PRC reaction solution is PCR forward primer, the reverse primer by TRECs, KRECs and β-Actin, 2 * taq PCR MasterMix, and 1mMMgCl2 and aseptic ultrapure water form.In a concrete scheme of the present invention, the nest-type PRC forward primer of TRECs gene (SEQ NO:1) is 5 '-GAGGGCAGCCCTCTCCAAGGCAAAATGG-3 ', and reverse primer (SEQ NO:2) is 5 '-TGATCTTGTCTGACATTTGCTCCGTGGT-3 '.The nest-type PRC forward primer (SEQNO:3) of KRECs gene is 5 '-GCTCAGCGCCCATTACGTTTCTG-3 ', and reverse primer (SEQNO:4) is 5 '-CTGTGAGGGACACGCAGCCTG-3 '.The nest-type PRC forward primer of β-actin gene (SEQ NO:5) is 5 '-CTCATTTCCCTCTCAGGCATGG-3 ', and reverse primer (SEQ NO:6) is 5 '-CCACGTCACACTTCATGATGGA-3 '.

In a scheme of the present invention, Fluorescence PCR liquid I is comprised of TRECs fluorescence PCR primer and probe, 2.5 * real time Mix, bovine serum albumin (BSA), 20xPCR Enhancer and aseptic ultrapure water.In a concrete scheme of the present invention, the fluorescent PCR forward primer of TRECs gene (SEQ NO:7) is 5 '-TGAGAACGGTGAATGAAGAGC-3 ', and reverse primer (SEQ NO:8) is that 5 '-CCATGCTGACACCTCTGG-3 ' and probe (SEQ NO:9) are FAM-ACGGTGATGCATAGGCACCTGCACC-TRAMA.

In a scheme of the present invention, Fluorescence PCR liquid II is comprised of KRECs fluorescence PCR primer and probe, 2.5 * real time Mix, BSA, 20xPCR Enhancer and aseptic ultrapure water.In a concrete scheme of the present invention, the fluorescent PCR forward primer of KRECs gene (SEQ NO:10) is 5 '-GTGGCATTATTTGTATCACTGTGC-3 ', and reverse primer (SEQ NO:11) is that 5 '-CAGCTCTTACCCTAGAGTTTCTGC-3 ' and probe (SEQ NO:12) are VIC-CACGGGAGCAGGTTGGCAGCGC-TRAMA.

In a scheme of the present invention, Fluorescence PCR liquid III is comprised of β-Actin fluorescence PCR primer and probe, 2.5 * real time Mix, BSA, 20xPCR Enhancer and aseptic ultrapure water.In a concrete scheme of the present invention, the fluorescent PCR forward primer of β-actin gene (SEQ NO:13) is 5 '-CTCATTTCCCTCTCAGGCATGG-3 ', and reverse primer (SEQ NO:14) is that 5 '-CCACGTCACACTTCATGATGGA-3 ' and probe (SEQNO:15) are VIC-CTGTGGCATCCACGAAACT-TRAMA.

In a scheme of the present invention, the specific probe of TRECs, the KRECs described in Fluorescence PCR liquid I, Fluorescence PCR liquid II and Fluorescence PCR liquid III and β-actin gene is the Taqman probe, label probe 5 ' end be a kind of fluorescence report group, be a kind of in FAM, VIC, TET, JOE, ROX, CY3, CY5, HEX; 3 ' end is for the fluorescent quenching group, is a kind of in TAMRA, DABCYL, NFQ.In reaction system of the present invention, can use one or more fluorescent probe, the fluorescence report group of institute's mark can be for a kind of or two kinds.In a concrete scheme of the present invention, TRECs label probe 5 ' end is the FAM probe, and 3 ' end is the TAMRA probe; KRECs label probe 5 ' end is the VIC probe, and 3 ' end is the TAMRA probe; β-Actin label probe 5 ' end is the VIC probe, and 3 ' end is the TAMRA probe.

In a scheme of the present invention, the standard substance I is to contain 131 nucleotide fragments of insertion TRECs gene to connect into the pUC57 vector plasmid.In a concrete scheme of the present invention, the insertion sequence of described TRECs gene (SEQ NO:16) is 5 '-TCGTGAGAACGGTGAATGAAGAGCAGACAGGGCCCGTGCCAGCTGCAGGGTTTAGG CACGGGGTGCAGGTGCCTATGCATCACCGTGCACAGGAGTGGGCACCTTTACAAAA ACCAGAGGTGTCAGCATGG-3 '.Standard substance I spectrophotometric instrumentation A ₂₆₀Quantitatively, depositing concentration is 1.0 * 10 ⁸Copy/ul, 1.0 * 10 ⁷Copy/ul, 1.0 * 10 ⁶Copy/ul, 1.0 * 10 ⁵Copy/ul, 1.0 * 10 ⁴Copy/ul, 1.0 * 10 ³6 concentration gradients of copy/ul.

In a scheme of the present invention, the standard substance II is to contain 89 nucleotide fragments of insertion KRECs gene to connect into the pUC57 vector plasmid.In a concrete scheme of the present invention, the insertion sequence of described KRECs gene (SEQ NO:17) is 5 '-TCCCTTAGTGGCATTATTTGTATCACTGTGCACAGTGTGCGCTGCCAACCTGCTCC CGTGCAGAAACTCTAGGGTAAGAGCTGGCTCCT-3 '.Standard substance II spectrophotometric instrumentation A ₂₆₀Quantitatively, depositing concentration is 1.0 * 10 ⁸Copy/ul, 1.0 * 10 ⁷Copy/ul, 1.0 * 10 ⁶Copy/ul, 1.0 * 10 ⁵Copy/ul, 1.0 * 10 ⁴Copy/ul, 1.0 * 10 ³6 concentration gradients of copy/ul.

In a scheme of the present invention, standard substance Fluorescence PCR liquid III is to contain insertion β-70 of actin genes nucleotide fragments to connect into the pUC57 vector plasmid.In a concrete scheme of the present invention, the insertion sequence of described β-actin gene (SEQ NO:18) is: 5 '-ATTTCCCTCTCAGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCAT CATGAAGTGTGACG-3 '.Standard substance III is quantitative with spectrophotometric instrumentation A260, and depositing concentration is 1.0 * 10 ⁸Copy/ul, 1.0 * 10 ⁷Copy/ul, 1.0 * 10 ⁶Copy/ul, 1.0 * 10 ⁵Copy/ul, 1.0 * 10 ⁴Copy/ul, 1.0 * 10 ³6 concentration gradients of copy/ul.

In a scheme of the present invention, the negative control product are TRECs, KRECs and β-actin recombinant plasmid, and its concentration is 5.0 * 10 ⁵Copy/ul.

In a scheme of the present invention, the blank product are aseptic ultrapure water.

In another aspect of the present invention, the copy number of a kind of detection by quantitative TRECs and KRECs gene also is provided, application in examination newborn infant T nucleus B cellular immunity deficiency, the detection method of real-time fluorescent PCR reagent case to newborn infant T cell and B cellular immunity deficiency, the method comprises the following steps:

1) with DNA extraction liquid, dried blood filter paper DNA is extracted:

2) standard substance and testing sample are added the nest-type PRC reaction solution, with the PCR detector, TRECs, KRECs and β-actin gene are increased;

3) the PCR product after increasing adds the real-time fluorescence quantitative PCR reaction system, detects with fluorescent quantitative detector and carries out PCR and detect;

4) by comparing the circulation thresholding of testing sample and standard substance, calculate initial TRECs, KRECs and the β-actin gene copy number of testing sample according to typical curve.

When the DNA amount of extracting is enough, also can without the nest-type PRC reaction system, directly add in the real-time quantitative PCR reaction system and go.

Beneficial effect of the present invention:

1) sample acquisition, storage are conveniently.The scraps of paper that the present invention only gets the 3mm diameter to the dried blood filter paper of newborn infant extract the detection that DNA can complete this project, dried blood filter paper is the conventional acquisition of newborn infant, and blood using amount seldom, reduce the blood volume that the newborn infant extracts, dried blood filter paper is conducive to prolonged preservation simultaneously, greatly reduces the appearance of the problems such as acquisition, storage and transportation of sample.

2) sensitivity and specificity are high.Take Auele Specific Primer, probe and nest-type PRC, and the DNA of sample extraction is carried out 18 circulations of regular-PCR amplification, effectively raise the copy number that detects gene, improved the susceptibility to pattern detection, and the TRECs in positive sample and KRECs almost do not have, and make the feminine gender of pattern detection result and the positive be easy to judge.

3) detection method is simple, and detection speed is fast, and result represents with copy number, and quantitative result accurately and reliably.Be conducive to apply in hospital and laboratory.

4) pass through to select the house-keeping gene β-actin of sample self as internal reference, if the copy number of the internal reference of amplification is in normal range, the copy number of TRECs and KRECs is very low, positive findings is reliable, otherwise need redeterminate, therefore can more effectively reduce the appearance of false positive results, thereby guarantee the reliability of data.

In a word, the present invention is highly sensitive, and specificity is good, the detection method Simple fast, and experimental result is reliable.The present invention has filled up the generaI investigation of primary immunodeficiency disease and the blank of neonatal screening, not only can examination SCID and the antibody defective be main immunodeficient disease, and can provide clinical relevant indication for other and T cell primary immunodeficiency disease or the other system disease relevant with the B cell development, be conducive to early stage disconnected and treatment.

Description of drawings

Fig. 1 .TRECs standard substance real time pcr amplification curve and typical curve.

Fig. 2 .KRECs standard substance real time pcr amplification curve and typical curve.

Fig. 3. β-actin standard substance real time pcr amplification curve and typical curve.

Fig. 4. the amplification curve of the real time PCR TRECs of normal child's DNA sample.

The amplification curve of the real time PCR TRECs of the positive children's DNA sample of Fig. 5 .SCID.

Fig. 6. the amplification curve of the real time PCR KRECs of normal child's DNA sample.

The amplification curve of the real time PCR KRECs of the positive children's DNA sample of Fig. 7 .XLA.

Fig. 8. the amplification curve of blank product.

Fig. 9. the amplification curve of the real time PCR β-actin of normal child's DNA sample.

The amplification curve of the real time PCR β-actin of the positive children's DNA sample of Figure 10 .SCID and XLA.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Be to be understood that, these embodiment only are used for explanation the present invention and are not used in restriction the scope of protection of present invention, unreceipted concrete experiment condition and method in the following example, usually according to normal condition as fine works molecular biology guide, F.M. the chief editor such as Ao Sibai, Science Press, 1995, molecular cloning experiment guide (third edition); D.L. Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, 1982, or connect the condition of advising according to manufacturer.

Embodiment 1: the preparation of test kit

1. the design of primer and probe is with synthetic

according to UCSC Human Gene Sorter inquiry TRECs on the UCSC website, KRECs and β-actin gene order (http://genome.ucsc.edu/cgi-bin/hgNear), utilize Primer3.0 at TRECs, upstream and downstream primer and quantitative fluorescent PCR upstream and downstream primer and the probe of design nest-type PRC on KRECs and β-actin gene, TRECs wherein, the nest-type PRC upstream primer of KRECs and β-actin and the binding site of its gene are in the upstream of its real-time fluorescence quantitative PCR upstream primer and this gene binding site, TRECs, the nest-type PRC downstream primer of KRECs and β-actin and the binding site of its gene are in the downstream of its real-time fluorescence quantitative PCR downstream primer and this gene binding site.Selected primer has higher pcr amplification efficient for the good specificity of being combined with of gene.Primer and probe all entrust Life Technologies company to synthesize, and wherein primer is the PAGE purifying, and probe is the HPLC purifying.Probe 5 ' the end of TRECs is labeled as the FAM fluorophor, and 3 ' end is labeled as the TAMRA fluorophor; Probe 5 ' the end of KRECs is labeled as the VIC fluorophor, and 3 ' end is labeled as the TAMRA fluorophor; Probe 5 ' the end of β-actin is labeled as the VIC fluorophor, and 3 ' end is labeled as the TAMRA fluorophor.Primer sequence such as table 1.

Table 1 inserts gene, Auele Specific Primer and probe sequence

2.TRECs, the structure of KRECs and β-actin standard substance

With TRECs, KRECs and β-actin gene through the theoretical sequence of nest-type PRC primer amplified product by Shanghai Bo Shang Bioisystech Co., Ltd synthetic, it is cloned on the pUC57 carrier, recipient bacterium is e.colistraindh5α, and the recombinant plasmid that obtains is identified through two-way DNA sequencing.Extract positive recombinant plasmid, use the DNA micro-spectrophotometer to measure its concentration and purity, according to formula copy number/μ l=(concentration μ g/ml * 10 ^-9* 6.02 * 10 ²³)/(324.5 * 2 * bp number) calculate the copy number of recombinant plasmid, and carry out gradient dilution according to the copy number of measuring, obtain 1.0 * 10 ⁸Copy/ul, 1.0 * 10 ⁷Copy/ul, 1.0 * 10 ⁶Copy/ul, 1.0 * 10 ⁵Copy/ul, 1.0 * 10 ⁴Copy/ul, 1.0 * 10 ³6 concentration gradient recombinant plasmid standard substance of copy/ul, namely obtain to contain TRECs gene insertion sequence the standard substance I, contain the standard substance II of KRECs gene insertion sequence and contain the standard substance III of β-actin gene insertion sequence, in-20 ℃ of preservations.

3. the preparation of negative control product

E.colistraindh5α with the recombinant plasmid that contains respectively TRECs, KRECs and β-actin gene of Shanghai Bo Shang Bioisystech Co., Ltd preparation, extract respectively plasmid, use the DNA micro-spectrophotometer to measure its concentration and purity, and dilute according to the copy number of measuring, obtain 5.0 * 10 ⁵The negative control product of copy/ul are in-20 ℃ of preservations.

4. the preparation of blank product

The blank product are through 121 ℃ of high pressure moist heat sterilizations milli-Q water of 20 minutes.

5. the nest-type PRC reaction solution forms, as table 2.

Table 2 nest-type PRC reaction solution forms

Wherein 2 * taq PCR MasterMix is prepared by sky root biochemical technology company limited (TIANGEN).

6. Fluorescence PCR liquid I forms, as table 3.

Table 3 Fluorescence PCR liquid I forms

Wherein 2.5 * real time Mix and 20 * PCR Enhancer are prepared by sky root biochemical technology company limited (TIANGEN).

7. Fluorescence PCR liquid II forms, as table 4.

Table 4 Fluorescence PCR liquid II forms

7. Fluorescence PCR liquid III forms, as table 5.

Table 5 Fluorescence PCR liquid III forms

Embodiment 2: the use of test kit

1. the extraction of dried blood filter paper DNA

Operation steps is as follows:

A. obtain the dried blood filter paper of diameter 3mm with punch tool, put into the 1.5ml centrifuge tube of sterilization, add the Generation DNA purif.Soln I of 90 μ l, centrifugal 30 seconds of 3700rpm is immersed in solvent filter paper;

B. after standing 15 minutes, centrifugal 5 minutes of 3700rpm sucks solution as far as possible;

C. repeat the A-B step, wherein time of repose is 10 minutes;

D. add aseptic milli-Q water, centrifugal 30 seconds of 3700rpm sucks milli-Q water as far as possible;

E. add 30 μ l Generation DNA Elution Soln II, centrifugal 1 minute of 3700rpm was placed in 99 ℃ of water-baths 25 minutes;

F. to be cooled to the room temperature centrifugal 30 seconds of 3700rpm, the same day, use can be placed in 4 ℃, used every other day to be placed in refrigeration under-20 ℃.

2. pattern detection

1) nest-type PRC amplification TRECs, KRECs and β-actin gene

Get DNA sample that step 1 extracts and be mixed with the nest-type PRC reaction system according to the composition of the reaction solution of nest-type PRC shown in table 2, each main component of system is as follows:

The nest-type PRC response procedures:

The nest-type PRC reaction tubes that configures is put into the regular-PCR instrument begin amplification, response procedures is as follows:

Table 6 nest-type PRC response procedures

2) real-time fluorescence quantitative PCR detects the copy number of the TRECs gene after nest-type PRC increases

Form according to Fluorescence PCR liquid I, preparation real-time fluorescence quantitative PCR reaction system, get steps A amplification afterreaction liquid 2.0 μ l, and 6 standard substance that are mixed with by restructuring TRECs plasmid and negative control product, each 2.0 μ l of blank product, each main component of system is as follows:

The real-time fluorescence quantitative PCR response procedures:

The fluorescence detection channel of collecting the FAM fluorescent signal is set, reaction tubes is put into fluorescent PCR instrument (ABI 7300) begin amplification, response procedures is as follows:

Table 7 real-time fluorescence quantitative PCR response procedures

3) real-time fluorescence quantitative PCR detects the copy number of the KRECs gene after nest-type PRC increases

Form according to Fluorescence PCR liquid II, preparation real-time fluorescence quantitative PCR reaction system, get steps A amplification afterreaction liquid 2.0 μ l, and 6 standard substance that are mixed with by restructuring KRECs plasmid and negative control product, each 2.0 μ l of blank product, each main component of system is as follows:

The real-time fluorescence quantitative PCR response procedures:

The fluorescence detection channel of collecting the VIC fluorescent signal is set, reaction tubes is put into fluorescent PCR instrument (ABI 7300) begin amplification, response procedures is identical with table 7.

4) copy number of the β after the amplification of real-time fluorescence quantitative PCR detection nest-type PRC-actin gene

Form according to Fluorescence PCR liquid III, preparation real-time fluorescence quantitative PCR reaction system, get the diluent 2.0 μ ls of steps A amplification afterreaction liquid after sterilized water dilutes 1000 times, with 6 standard substance that are mixed with by recombinant beta-actin plasmid and negative control product, each 2.0 μ l of blank product, each main component of system is as follows:

The real-time fluorescence quantitative PCR response procedures:

5) result judgement

The Ct value (cycle number) of baseline scope is 6-15 or automatically selected by software, and setting threshold surpasses the maximum of random amplification curve.The fluorescent PCR instrument is different, and the Ct value of gained baseline scope is different.

6) quality control standard

All kinds of contrast quality control product judged results such as following table:

Table 8 quality control product standard testing result

Trigenic recombinant plasmid is made typical curve as standard substance through amplification amplification, works as relation conefficient〉0.99 can be used for the quantitative analysis of TRECs, KRECs and β-actin copy number, otherwise will again test.Fig. 1 is the amplification curve of the standard substance of TRECs recombinant plasmid, and the typical curve that obtains according to this curve.Fig. 2 is the amplification curve of the standard substance of KRECs recombinant plasmid, and the typical curve that obtains according to this curve.Fig. 3 is the amplification curve of the standard substance of β-actin recombinant plasmid, and the typical curve that obtains according to this curve.

7) report the test

Fig. 4 is the TRECs real-time fluorescence quantitative PCR amplification curve of clinical SCID negative sample, and institute's test sample Ct value originally is between 12-28, and within the linearity range of standard substance, quantitative result is that the copy number of TRECs is 10 ⁴~ 10 ⁵Copy/μ l left and right, negative sample.Fig. 5 is the TRECs real-time fluorescence quantitative PCR amplification curve of clinical SCID positive sample, and result shows without amplified signal.Fig. 6 is the amplification curve of the negative DNA sample KRECs of Clinical X LA, and institute's test sample Ct value originally is between 12-30, and within the linearity range of standard substance, quantitative result is that the copy number of KRECs is 10 ⁴~ 10 ⁵Copy/μ l left and right, negative sample.Fig. 7 is the amplification curve of the KRECs of hypogammag lobulinemia children DNA sample, and result shows without amplified signal.Fig. 8 is for to be the amplification curve of blank product, and result is without amplified signal.Fig. 9 is the amplification curve of the β-actin of normal child's DNA sample, and institute's test sample Ct value originally is between 14-30, and within the linearity range of standard substance, quantitative result is that the copy number of β-actin is 10 ⁴~ 10 ⁵Copy/μ l left and right.Figure 10 is the amplification curve of the β-actin of TRECs and the positive children's DNA sample of KRECs, and result and Fig. 9 are basically identical.

The judging criterion of sample results is as follows:

Table 9 report pattern detection result

It is consistent that this test kit clinical sample detected result and this sample use flow cytometer to detect in sample blood T cell, B cell quantity and clinical symptom, this method reliable results is described, highly sensitive and good reproducibility is for examination newborn infant SCID and XLA provide effective diagnostic means clinically.

Claims

1. the real-time fluorescence quantitative PCR test kit of a detection by quantitative TRECs and KRECs gene, comprising DNA extraction liquid, the nest-type PRC reaction solution, the standard substance I that comprises TRECs gene insertion sequence, the standard substance II that comprises KRECs gene insertion sequence, the standard substance III that comprises β-actin gene insertion sequence, comprise the real-time fluorescence primer of TRECs gene and the Fluorescence PCR liquid I of probe, comprise the Fluorescence PCR liquid II of the real-time fluorescence primer of KRECs gene and probe and comprise the real-time fluorescence primer of β-actin gene and the Fluorescence PCR liquid III of probe.

2. test kit claimed in claim 1, wherein said nest-type PRC reaction solution comprises:

1) forward primer of nest-type PRC amplification TRECs gene, its base sequence is as shown in SEQNO:1;

2) reverse primer of nest-type PRC amplification TRECs gene, its base sequence is as shown in SEQNO:2;

3) forward primer of nest-type PRC amplification KRECs gene, its base sequence is as shown in SEQNO:3;

4) reverse primer of nest-type PRC amplification KRECs gene, its base sequence is as shown in SEQNO:4;

5) forward primer of nest-type PRC amplification β-actin gene, its base sequence is as shown in SEQ NO:5;

6) reverse primer of nest-type PRC amplification β-actin gene, its base sequence is as shown in SEQ NO:6.

3. test kit claimed in claim 1, wherein said Fluorescence PCR liquid I comprises:

1) real-time fluorescence PCR detects the forward primer of TRECs gene, and its base sequence is as shown in SEQ NO:7;

2) real-time fluorescence PCR detects the reverse primer of TRECs gene, and its base sequence is as shown in SEQNO:8;

3) for detection of the probe of TRECs gene, its base sequence is as shown in SEQ NO:9;

Wherein said Fluorescence PCR liquid II comprises:

1) real-time fluorescence PCR detects the forward primer of KRECs gene, and its base sequence is as shown in SEQNO:10;

2) real-time fluorescence PCR detects the reverse primer of KRECs gene, and its base sequence is as shown in SEQNO:11;

3) for detection of the probe of KRECs gene, its base sequence is as shown in SEQ NO:12;

Wherein said Fluorescence PCR liquid III comprises:

1) real-time fluorescence PCR detects the forward primer of β-actin gene, and its base sequence is as shown in SEQNO:13;

2) real-time fluorescence PCR detects the reverse primer of β-actin gene, and its base sequence is as shown in SEQNO:14;

3) for detection of the probe of β-actin gene, its base sequence is as shown in SEQ NO:15.

4. test kit claimed in claim 1, wherein said standard substance I, its base sequence is as shown in SEQ NO:16; Wherein said standard substance II, its base sequence is as shown in SEQ NO:17; Wherein said standard substance III, its base sequence is as shown in SEQ NO:18.

5. the described test kit of claim 1 to 4, described specificity fluorescent probe is the Taqman probe, label probe 5 ' end be a kind of fluorescence radiation group, be a kind of in FAM, VIC, TET, JOE, ROX, CY3, CY5, HEX; Label probe 3 ' end be a kind of fluorescent quenching group, be a kind of in TAMRA, DABCYL, NFQ.

6. the described test kit of claim 1 to 4, described Taqman probe 5 ' end flag F AM or VIC, 3 ' end mark TAMRA.

7. the application of the described test kit of claim 1 to 6 in newborn infant T cell and the detection of B cellular immunity deficiency.