CN105274230A - Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs and KRECs genes and its application - Google Patents
Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs and KRECs genes and its application Download PDFInfo
- Publication number
- CN105274230A CN105274230A CN201510734011.7A CN201510734011A CN105274230A CN 105274230 A CN105274230 A CN 105274230A CN 201510734011 A CN201510734011 A CN 201510734011A CN 105274230 A CN105274230 A CN 105274230A
- Authority
- CN
- China
- Prior art keywords
- real
- gene
- trecs
- krecs
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs and KRECs genes and its application. The kit comprises a real-time fluorescent quantitative PCR reaction system based on the real-time fluorescent PCR technique. The real-time fluorescent quantitative PCR reaction system comprises forward and reverse primers specific to TRECs, KRECs and beta-actin genes, and a specific fluorescent probe. The kit allows quick joint screening of neonatal immune system T-cell level and B-cell level, has high sensitivity and stability and provides excellent reproducibility, and this method is applicable to the joint quantitative detection of TRECs and KRECs and to functional screening of the neonatal immune system and is worthy of practical clinical application.
Description
Technical field
The invention belongs to external nucleic acid diagnostic field, relate to a kind of single stage method detection by quantitative to dissociate φt cell receptor resecting loop (T-cellreceptorexcisioncircles, and κ TRECs)-deletion restructuring resecting loop (κ-deletingrecombinationexcisioncircles, KRECs) Fluorescent quantitative PCR (PolymeraseChainReaction, the PCR) test kit of gene and application thereof.
Background technology
Primary immunodeficiency disease (PrimaryImmunodeficiencyDisease, PID) is that a class does not cause the immunodeficient disease caused by immune dysfunction entirely because of immunity system hereditary defect or congenital development, has found plant sick more than 200.PID often occurs in infantile period, can occur repeated infection, and serious can life-threatening.Wherein some may obtain effective treatment, and therefore diagnosis is still very important in time.Within 2008, U.S. CDC carries out severe combined immunodeficiency (SevereCombinedImmunodeficiencyDisease, SCID) neonatal screening at University of Wisconsin-Madison Xin Zhou.From 2009, Massachusetts, United States, Louisiana, New York, the sub-state of markon's welfare, Texas, Pennsylvania, the state of Michigan and Commonwealth of Puerto Rico etc. carry out newborn infant SCID examination successively, have and have carried out newborn infant SCID examination more than 21 states.Worldwide, multiple countries and regions such as the U.S., Sweden, Germany, Britain, France, Turkey, Japan, Saudi Arabia, Iran, Hong-Kong are had to carry out PID examination.Its total incidence is: the U.S. 1/10000, Australia 2.82/100000, Japan and Sweden 1/5000, China Hongkong 1/8000.The comprehensive statistical information of current domestic shortage, if the PID total incidence 1/10000 drawn according to correlative study is estimated, has 2500 PID cases newly sent out in 2,500 ten thousand newborn infants that China is born every year, involve case and reach 30,000-6 ten thousand examples Childhood of whole.
By the difference of immune deficiency character, primary immunodeficiency disease can be divided into specificity and non-specific two large classes, and wherein specificity PID accounts for the ratio of 80%.Specificity PID comprises humoral immune defect (namely antibody deficiency is main immune deficiency), cellular immunity deficiency and associating immune deficiency three major types that both have concurrently.Non-specific PID has complement defect, phagocytic cell defect etc.SCID is with T lymphopenia or dysfunction, companion or to reduce without bone-marrow-derived lymphocyte and NK cell quantity or functional defect is one group of disease of feature, Neonatal Morbidity is greatly about 1/50000 to 1/100000, this sick age of onset early, clinical manifestation weight, prognosis is poor, if do not obtain Diagnosis and Treat timely, how dead in 2 years old.SCID is a kind of serious severe combined immunodeficiency, if infant does not carry out effective immunologic reconstitution, often dead in infancy, the time of immunologic reconstitution and the in close relations of prognosis, if carry out hematopoietic stem cell transplantation in birth in 3 months, survival rate is close to 95%, and carry out hematopoietic stem cell transplantation survival rate after 3 months and be reduced to 76%, but, SCID infant because of the antibody carrying mother make its birth first few months look it is normal, until about 6 months time because occurring that repeated infection just shows exception, therefore SCID is included in neonatal screening very necessary.
At present, SCID is mainly divided into the large class of T-B+SCID and T-B-SCID two.Wherein the pathogenesis of T-B+SCID has γ c genetic flaw, JAK3 (JanusKinase3) genetic flaw, IL-7R ɑ genetic flaw, CD45 genetic flaw, CD3 δ/CD3 ε/CD3 ζ genetic flaw, Coronin-1A genetic flaw; The pathogenesis of T-B-SCID has RAG1/2 genetic flaw, DCLRE1C genetic flaw, ADA genetic flaw, DNAPKcs genetic flaw, reticular dysgenesis.In addition, SCID also comprises Omenn syndrome, DNA ligase VI, Cemunnos/XLF defect, CD40L defect, purine nucleotide phosphorylase (PNP) defect, CD3 γ defect, CD8 defect, ZAP-70 defect, MHCI quasi-molecule defect, mhc class ii molecular defect, calcium channel defect etc.Cause the reason of SCID various, diagnose very difficult, but the quantity that the common trait of all SCID is mature T cells significantly reduces.
T cell, when the process that thymus gland breaks up is the rearrangement occurring in φt cell receptor gene, is finally the combination of V, D and J gene fragment; In the process of each V, D and J gene segment rearrangements, there is cut cyclic DNA product in capital, the DNA be cut forms free φt cell receptor resecting loop (TRECs), and 70% T cell expressing ɑ β TCRs all produces δ Rec-φ J ɑ TREC in ripe late period.TRECs is highly stable in T cell, does not increase with the propagation of cell, but is constantly diluted, and the level of newborn infant TRECs is the highest, but the level of 5 years TRECs obviously reduces after birth.Utilize quantitative PCR detection δ Rec-φ J ɑ TREC can reflect the T lymphocyte quantity of the up-to-date generation of peripheral blood, TRECs shortage or minimizing in various degree in patient's T cell, can as the screening method of SCID, examination goes out the newborn infant of T cell maturation defect, be conducive to early diagnosing early treatment, reduce neonatal death.
Antibody deficiency is that main immunodeficient disease belongs to cellular immunity deficiency class, it is one group of PID because B cell early development obstacle causes, due to humoral immune defect, easily repeatedly there is bacteriological infection, showing as B cell and immunoglobulin (Ig) minimizing in various degree, is the primary immunodeficiency disease that sickness rate is the highest.Be divided into following a few class at present: 1) serious hypogammaglobulinemia, pathogenesis has BTK genetic flaw, μ chain shortage, λ 5 chain shortage, Ig ɑ shortage, Ig β shortage, BLNK (BLNK) shortage, osteomyelodysplasia etc., wherein X linked agammaglobulinemia (XLA) is modal humoral immune defect disease, its cause of disease be Bruton Tyrosylprotein kinase (Bruton ' sTyrosineKinase, BTK) defect, shows as B cell and immunoglobulin (Ig) is significantly low; 2) severe of serum IgG and IgA reduce companion's B cell normal, reduce or significantly reduce, pathogenesis has Common Variable Immunodeficiency (CommonVariableImmunodeficiencyDisease, CVID), inducible co-stimulator (InducibleCo-Stimulator, ICOS) defect, CD19 defect, the chain lymphoproliferation syndromes (X-linkedLymphProliferativeDisease, XLP) of X; 3) severe of serum IgG and IgA reduces, IgM is normal or increase (high IgM syndromes), pathogenesis has CD40L defect, CD40 defect, activation induction cytidine deaminase (Activation-inducedCytidineDeaminase, AICDA) defect, uracil N-glycosylase (Uracil-N-Glycosylase, UNG) defect; 4) isotype or light chain lack, and pathogenesis has Ig heavy chain shortage, κ chain shortage, selectivity IgG subclass defect, selective IgA deficiency etc.Antibody deficiency is that the immunodeficient disease cause of disease of master is various, diagnoses very difficult, but common trait is bone-marrow-derived lymphocyte shortage or minimizing in various degree.
In B cell ripening process, the κ formed during the gene rearrangement that the λ chain of immunoglobulin (Ig) occurs-deletions is recombinated resecting loop (κ-deletingrecombinationexcisioncircles, KRECs), KRECs does not also increase along with the propagation of cell, but is constantly diluted.Occur in before κ-deletions recombinate because antibody deficiency is B cell maturation defect in main immunodeficient disease, KRECs shortage or minimizing in various degree in patient's B cell, utilizing quantitative PCR method to detect KRECs can as the neonatal screening method of antibody deficiency for main immunodeficient disease, therefore by examination going out suffer from the newborn infant of B cell maturation defect to the quantitative assay of KRECs.
United screening newborn infant primary T cell and B cell immune deficiency, newborn infant's T cell and b cell level can be detected, can examination SCID and antibody deficiency be not only main immunodeficient disease, and relevant primary immunodeficiency disease can be grown for other and T cell and B cell or other system disease provides clinical relevant indication, be conducive to early diagnosis and treatment.
Application number be 201210470713.5 Chinese patent provide real-time fluorescence quantitative PCR test kit and the application of detection by quantitative TRECs and KRECs gene.This patent comprises a PCR reaction system based on Nested PCR Technique and the real time fluorescent quantitative based on real-time fluorescence PCR technology (Realtime) PCR reaction system.This TRECs and KRECs gene tester is two-step approach.Relative to genomic dna, due to TRECs and KRECs be human genome grow in rearrangement process the cyclic group that cuts down because of, content is extremely low, therefore two-step approach is after DNA extraction, first round nested PCR amplification and second is adopted to take turns fluorescence real-time quantitative PCR amplification two-wheeled amplification altogether, greatly improve TRECs and KRECs gene DNA content, reach minimizing false negative result with this, improve specific object.
But, above-mentioned patent adopts the two-step approach comprising nested PCR amplification and real-time fluorescence quantitative PCR amplification, loaded down with trivial details, the consuming time length of complicated operation, crucially, the inadequate purity of DNA abundance that DNA extraction method used is extracted is not high, nest-type PRC brings the pipetting after amplification error, nest-type PRC to bring sample contamination, and the error that all too many levels add up finally causes undetected possibility large.As undetected in occurred in new sieved journey, infant will miss excellent diagnostics and therapic opportunity.
For the problems referred to above, especially the problem that the undetected critical positive sample possibility of two-step approach is larger, the object of the present invention is to provide one can reduce amplification error and sample contamination, have more highly sensitive and specific degree, single stage method TRECs fast easy and simple to handle and KRECs gene detecting kit fill up this blank domestic simultaneously.
Summary of the invention
Object of the present invention be to provide a kind of sensitivity and specific degree higher and fast and convenient by detection by quantitative TRECs and KRECs gene copy number, be used for the real-time fluorescence quantitative PCR test kit of examination newborn infant primary T cell and B cell immune deficiency, this test kit is applicable to all types of fluorescent quantitative PCR instrument in the market.The present invention can detect the level of newborn infant's T cell and B cell, judges that whether neonatal immune system function is normal, has good application prospect in Clinical Laboratory field.
Another object of the present invention is to provide the application in a kind of examination newborn infant T cell and B cell immune deficiency, sample acquisition needed for mentioned reagent box, transport, storage are conveniently, sensitivity and specificity high, detection method is easy, quick, and experimental result is accurately and reliably.
To achieve these goals, the invention provides:
A real-time fluorescence quantitative PCR test kit for single stage method detection by quantitative TRECs, KRECs gene, this test kit comprising DNA extraction liquid, the standard substance I comprising TRECs gene inserts, the standard substance II comprising KRECs gene inserts, the standard substance III comprising β-actin gene inserts, the real-time fluorescence primer comprising TRECs gene and probe Fluorescence PCR liquid I, comprise the real-time fluorescence primer of KRECs gene and the Fluorescence PCR liquid II of probe and comprise the real-time fluorescence primer of β-actin gene and the Fluorescence PCR liquid III of probe.
In a scheme of the present invention, Fluorescence PCR liquid I is made up of TRECs fluorescence PCR primer and probe, 2.5 × realtimeMix, bovine serum albumin (BSA), 20 × PCREnhancer and aseptic ultrapure water.In a concrete scheme of the present invention, the fluorescent PCR forward primer (SEQNO:1) of TRECs gene is 5 '-TGAGAACGGTGAATGAAGAGC-3 ', and reverse primer (SEQNO:2) is 5 '-CCATGCTGACACCTCTGG-3 ' and probe (SEQNO:3) is FAM-ACGGTGATGCATAGGCACCTGCACC-TAMRA.
In a scheme of the present invention, Fluorescence PCR liquid II is made up of KRECs fluorescence PCR primer and probe, 2.5 × realtimeMix, BSA, 20 × PCREnhancer and aseptic ultrapure water.In a concrete scheme of the present invention, the fluorescent PCR forward primer (SEQNO:4) of KRECs gene is 5 '-GTGGCATTATTTGTATCACTGTGC-3 ', and reverse primer (SEQNO:5) is 5 '-CAGCTCTTACCCTAGAGTTTCTGC-3 ' and probe (SEQNO:6) is VIC-CACGGGAGCAGGTTGGCAGCGC-TAMRA.
In a scheme of the present invention, Fluorescence PCR liquid III is made up of β-actin fluorescence PCR primer and probe, 2.5 × realtimeMix, BSA, 20 × PCREnhancer and aseptic ultrapure water.In a concrete scheme of the present invention, the fluorescent PCR forward primer (SEQNO:7) of β-actin gene is 5 '-CTCATTTCCCTCTCAGGCATGG-3 ', and reverse primer (SEQNO:8) is 5 '-CCACGTCACACTTCATGATGGA-3 ' and probe (SEQNO:9) is VIC-CTGTGGCATCCACGAAACT-TAMRA.
In a scheme of the present invention, described in Fluorescence PCR liquid I, Fluorescence PCR liquid II and Fluorescence PCR liquid III, the specific probe of TRECs, KRECs and β-actin gene is Taqman probe, what label probe 5 ' was held is a kind of fluorescence radiation group, and it is the one in FAM, VIC, TET, JOE, ROX, CY3, CY5, HEX; What label probe 3 ' was held is a kind of quenching of fluorescence group, and it is the one in TAMRA, DABCYL, NFQ.In reaction system of the present invention, can use one or more fluorescent probe, the fluorescent reporter group marked can be a kind of or two kinds.In a concrete scheme of the present invention, 5 ' end of TRECs mark is FAM probe, and 3 ' end is TAMRA probe; 5 ' end of KRECs mark is VIC probe, and 3 ' end is TAMRA probe; 5 ' the end that β-actin marks is VIC probe, and 3 ' end is TAMRA probe.
In a scheme of the present invention, standard substance I connects into pUC57 vector plasmid containing inserting TRECs gene 131 nucleotide fragments.In a concrete scheme of the present invention, the insertion sequence of described TRECs gene is 5 '-TCGTGAGAACGGTGAATGAAGAGCAGACAGGGCCCGTGCCAGCTGCAGGGTTTAGG CACGGGGTGCAGGTGCCTATGCATCACCGTGCACAGGAGTGGGCACCTTTACAAAA ACCAGAGGTGTCAGCATGG-3 ' for (SEQNO:10).Standard substance I is quantitative with spectrophotometric measurement A260, and depositing concentration is 1.0 × 10
5copies/ μ l, 1.0 × 10
4copies/ μ l, 1.0 × 10
3copies/ μ l, 1.0 × 10
2copies/ μ l, 1.0 × 10
1copies/ μ l5 concentration gradient.
In a scheme of the present invention, standard substance II connects into pUC57 vector plasmid containing inserting KRECs gene 89 nucleotide fragments.In a concrete scheme of the present invention, the insertion sequence of described KRECs gene is 5 '-TCCCTTAGTGGCATTATTTGTATCACTGTGCACAGTGTGCGCTGCCAACCTGCTCC CGTGCAGAAACTCTAGGGTAAGAGCTGGCTCCT-3 ' for (SEQNO:11).Standard substance II is quantitative with spectrophotometric measurement A260, and depositing concentration is 1.0 × 10
5copies/ μ l, 1.0 × 10
4copies/ μ l, 1.0 × 10
3copies/ μ l, 1.0 × 10
2copies/ μ l, 1.0 × 10
1copies/ μ l5 concentration gradient.
In a scheme of the present invention, standard substance III connects into pUC57 vector plasmid containing inserting β-actin gene 70 nucleotide fragments.In a concrete scheme of the present invention, the insertion sequence of described β-actin gene is 5 '-ATTTCCCTCTCAGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCAT CATGAAGTGTGACG-3 ' for (SEQNO:12).Standard substance III is quantitative with spectrophotometric measurement A260, and depositing concentration is 1.0 × 10
5copies/ μ l, 1.0 × 10
4copies/ μ l, 1.0 × 10
3copies/ μ l, 1.0 × 10
2copies/ μ l, 1.0 × 10
1copies/ μ l5 concentration gradient.
In a scheme of the present invention, negative control is normal child's sample, its concentration copy TRECs>60-90copies/ μ l, KRECs>40-60copies/ μ l.
In a scheme of the present invention, blank is aseptic ultrapure water.
In another aspect of the present invention, additionally provide the copy number of a kind of detection by quantitative TRECs and KRECs gene, application in examination newborn infant T cell and B cell immune deficiency, real-time fluorescent PCR reagent case is to the detection method of newborn infant's T cell and B cell immune deficiency, and the method comprises the following steps: to use the dry blood spot DNA of post method to measuring samples to extract; The DNA of extraction is added real-time fluorescence quantitative PCR reaction system, carries out PCR detection with real time fluorescent quantitative detector; By comparing the cycle threshold of testing sample and standard substance, calculate initial TRECs, KRECs and β-actin gene copy number of testing sample according to typical curve.The DNA extraction kit that the present invention uses can select the QIAampDNAmini test kit of QIAGEN.
In another aspect of the present invention, the aseptic ultrapure water add-on DNA extraction thing add-on of measuring samples, positive control, negative control and blank being substituted DNA is adjusted to more than 2 times of standard substance DNA extraction thing add-on, such as 4 times.
Beneficial effect of the present invention:
1) sample acquisition, transport, storage are conveniently.The present invention's circular dry blood spot (blood volumes of about 9 μ l) drilling through three diameter 3mm that only needs to punch extracts the detection that DNA can complete this project, and blood using amount is little, is applicable to very much the neonatal screening that should not measure greatly blood.Meanwhile, dry blood spot sample properties is stablized the transport that is beneficial to the long period and is preserved for a long time, considerably reduces sample in the appearance obtaining, store and transport problem in all links, for the accuracy of last check result and stability have established good basis.
2) sensitivity and specificity high.The DNA abundance adopting the post method crossed after improving to extract, purity are high, and the copy number of normal sample TRECs and KRECs gene brings up to 60 to eight ten copies by tens 20 copies before improving.After PCR reaction system is adjusted, the copy number of normal sample TRECs and KRECs gene brings up to a hundreds of copy further, the employing of this series of improvement Auele Specific Primer and probe in addition, makes the sensitivity of detection method and specificity have than two-step approach and significantly promotes.After improvement as a result, definitely TRECs and the KRECs numerical value of positive sample be 0, the numerical value of TRECs and KRECs of critical positive sample extremely low (only have several copy tens 20 copies to).Like this, positive findings and negative findings significant difference, be highly susceptible to judging.Also very effectively reduce the appearance of false negative result, to avoid undetected generation simultaneously.
3) by selecting the house-keeping gene β-actin of sample self as internal reference, effectively reduce the appearance of false positive results, thus ensure the reliability of data.
4) method is simple, and detect time-histories short, detected result accurately and reliably, judges very clear.Be convenient to very much apply in hospital and laboratory.
5) defining of threshold value integrates with international standard.The threshold value of detection method is one of most important parameter.In PID examination field, the research level of American-European study group maintains the leading position at present.Each study group TRECs is not identical with the PCR detection method of KRECs gene screening, and the threshold value of TRECs with the KRECs gene that different experimental techniques draws is different.Comprehensive analysis, the threshold value of TRECs is defined in 25copies/ μ about l by most American-European study group, and the threshold value of KRECs is defined in 15copies/ μ about l, is included in the several study group the most well-known in this field interior.The threshold value numerical value of the TRECs that single stage method of the present invention obtains is 60-90copies/ μ l, the threshold value numerical value of KRECs is 40-60copies/ μ l, add-on because of sample DNA to be checked in reaction system is 4 times of standard substance DNA add-on, so by the threshold value obtained divided by 4, the initial copy number of TRECs is at 22.5copies/ μ about l, the initial copy number of KRECs is at 12.5copies/ μ about l, and the result according to most American-European study group is more close.
In a word, the present invention takes the single stage method detecting TRECs and KRECs gene, at extraction DNA circle joint, apply the DNA that can obtain stable very high purity after different DNA extraction approach also repeatedly improves, thus the first round nested PCR amplification link saved in two-step approach, directly carry out fluorescence real-time quantitative PCR amplification.Simplify flow process, save time cost and reagent cost, decrease because many one takes turns nested PCR amplification and the amplification error brought and move liquid and pollute simultaneously.In fluorescence real-time quantitative PCR amplification link, grope to have adjusted PCR reaction system, make negative findings and positive findings contrast significantly, be easy to the judgement of threshold value, reach minimizing false negative and improve specific object, this detects in the test of positive clinical sample in single stage method double blinding afterwards and obtains checking.Test kit of the present invention and apply highly sensitive, specificity is good, detection method simple and fast, experimental result is reliable, the generaI investigation of primary immunodeficiency disease and the blank of neonatal screening are filled up, can examination antibody deficiency be not only main immunodeficient disease, and relevant primary immunodeficiency disease can be grown for other and B cell or other system disease provides clinical relevant indication, be conducive to early diagnosis and treatment.
Accompanying drawing explanation
Figure 1A and 1B is TRECs standard substance real time PCR amplification curve and typical curve respectively.
Fig. 2 A and 2B is KRECs standard substance real time PCR amplification curve and typical curve respectively.
Fig. 3 A and 3B is β-actin standard substance real time PCR amplification curve and typical curve respectively.
Fig. 4 is the PCR in real time TRECs amplification curve of normal child's DNA sample.
Fig. 5 is the PCR in real time TRECs amplification curve of the positive children's DNA sample of SCID.
Fig. 6 is the PCR in real time KRECs amplification curve of normal child's DNA sample.
Fig. 7 is the PCR in real time KRECs amplification curve of the positive children's DNA sample of XLA.
Fig. 8 is the PCR in real time β-actin amplification curve of normal child's DNA sample.
Fig. 9 is the PCR in real time β-actin amplification curve of the SCID positive and the positive children's DNA sample of XLA.
Figure 10 A to 10D is positive control TRECs, KRECs and β-actin real time PCR amplification curve respectively.
Figure 11 A to 11C is blank product TRECs, KRECs and β-actin real time PCR amplification curve respectively.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Be to be understood that, these embodiments are only not used in restriction the scope of protection of present invention for illustration of the present invention, unreceipted specific experiment condition and method in the following example, usually conveniently condition is as follows: fine works Molecular Biology, F.M. the chief editor such as Ao Sibai, Science Press, 1995; Molecular Cloning: A Laboratory guide (third edition), D.L. Spector etc., Science Press, 2001; Cell experiment guide, Lv Hongsheng, Science Press, 1982, or according to the condition that manufacture business men is advised.
Embodiment 1: the preparation of test kit
1, the Design and synthesis of primer and probe
Inquire about TRECs, KRECs and β-actin gene order (http://genome.ucsc.edu/cgi-bin/hgNear) according to UCSCHumanGeneSorter on UCSC website, utilize Primer3.0 to design quantitative fluorescent PCR upstream and downstream primer and probe on TRECs, KRECs and β-actin gene.Selected primer is combined with good specificity for gene, has higher pcr amplification efficiency.Primer and probe all entrust LifeTechnologies company to synthesize, and wherein primer is PAGE purifying, and probe is HPLC purifying.5 ' end of TRECs probe is FAM fluorophor, and 3 ' end is TAMRA fluorophor; 5 ' end of KRECs probe is VIC fluorophor, and 3 ' end is TAMRA fluorophor; 5 ' end of β-actin probe is VIC fluorophor, and 3 ' end is TAMRA fluorophor.Primer sequence is as table 1.
Table 1 inserts gene, Auele Specific Primer and probe sequence
2, the structure of TRECs, KRECs and β-actin standard substance
TRECs, KRECs and β-actin standard substance are synthesized by Shanghai Bo Shang Bioisystech Co., Ltd, and carrier is pUC57 carrier, and recipient bacterium is bacillus coli DH 5 ɑ bacterial strain, is identified by the recombinant plasmid of acquisition through two-way DNA sequencing.Extract positive DNA micro-spectrophotometer and measure its concentration and purity, according to formula copy number/μ l=(concentration μ g/ml × 10
-9× 6.02 × 10
23)/(324.5 × 2 × bp number) calculate the copy number of recombinant plasmid, and dilute according to the copy number measured, obtain 1.0 × 10
5copies/ μ l, 1.0 × 10
4copies/ μ l, 1.0 × 10
3copies/ μ l, 1.0 × 10
2copies/ μ l, 1.0 × 10
1copies/ μ l5 concentration gradient recombinant plasmid standard substance, namely obtain the standard substance II of standard substance I, KRECs gene inserts containing TRECs gene inserts and the standard substance III containing β-actin gene inserts, are placed in-20 DEG C of preservations.
3, the preparation of positive reference substance
With SCID and the XLA children sample of the clinical absolute positive, cross post method and extract DNA as positive reference substance.TRECs and KRECs gene test result copy number is without numerical value, β-actin gene copy number >1.0 × 10
3copies/ μ l, in-20 DEG C of preservations.
4, the preparation of negative controls
With the negative children's sample of all normal clinical SCID and XLA of TRECs, KRECs and β-actin gene test result, cross post method and extract DNA as negative controls.Concentration copy TRECs>90copies/ μ l, TRECs average=379copies/ μ l, KRECs>60copies/ μ l, KRECs average=240copies/ μ l, in-20 DEG C of preservations.
5, the preparation of blank product
Blank is through 121 DEG C of high pressure moist heat sterilizations milli-Q water of 20 minutes.
6, the composition of Fluorescence PCR liquid I, as table 2.
The composition of table 2 Fluorescence PCR liquid I
| Material name | Final concentration |
| 2.5×real time Mix | 1× |
| TRECs fluorescence PCR primer | 0.5μM |
| TRECs probe | 0.15μM |
| BSA | 0.4μg/μL |
| 20×PCR Enhancer | 1× |
| ddH 2O | In right amount |
| DNA profiling | 2.0μL |
| Cumulative volume | 20μL |
Wherein 2.5 × realtimeMix and 20 × PCREnhancer is prepared by Tian Gen biochemical technology company limited (TIANGEN).
7, the composition of Fluorescence PCR liquid II, as table 3.
The composition of table 3 Fluorescence PCR liquid II
| Material name | Final concentration |
| 2.5×real time Mix | 1× |
| KRECs fluorescence PCR primer | 0.5μM |
| KRECs probe | 0.15μM |
| BSA | 0.4μg/μL |
| 20×PCR Enhancer | 1× |
| ddH 2O | In right amount |
| DNA profiling | 2.0μL |
| Cumulative volume | 20μL |
8, the composition of Fluorescence PCR liquid III, as table 4.
The composition of table 4 Fluorescence PCR liquid III
| Material name | Final concentration |
| 2.5×real time Mix | 1× |
| β-actin fluorescence PCR primer | 0.25μM |
| β-actin probe | 0.2μM |
| BSA | 0.4μg/μL |
| 20×PCR Enhancer | 1× |
| ddH 2O | In right amount |
| DNA profiling | 2.0μL |
| Cumulative volume | 20μL |
Embodiment 2: the use of test kit
1. the extraction of sample dry blood spot DNA to be checked
Operation steps is as follows:
A. by the dry blood spot three of the sample to be checked of the diameter 3mm with punch tool punching acquisition, put into the 1.5ml centrifuge tube of sterilizing, add 180 μ l cell pyrolysis liquids 1;
B.85 DEG C incubation 10min.Drop in pipe lid is got rid of in pipe gently;
C. add 20 μ l Proteinase K storing solutions, slowly inhale with rifle head and beat, 56 DEG C of incubation 1h.Drop in pipe lid is got rid of in pipe gently;
D. add 200 μ l cell pyrolysis liquids 2, slowly inhale with rifle head and beat thoroughly to mix, 70 DEG C of incubation 10min.Drop in pipe lid is got rid of in pipe gently;
E. add 200 μ l dehydrated alcohols, slowly inhale with rifle head and beat thoroughly to mix.Drop in pipe lid is got rid of in pipe gently.
F. liquid step e obtained and the scraps of paper carefully move in the centrifugal column be contained in 2ml collection tube, edge of not getting wet.Stopped pipe, the centrifugal 1min of 8000rpm.Centrifugal column is changed to new 2ml collection tube, throw aside former pipe;
G. carefully open centrifugal column lid, add 500 μ lBuffer elutriants 1, edge of not getting wet.Stopped pipe, the centrifugal 1min of 8000rpm.Centrifugal column is changed to new 2ml collection tube, throw aside former pipe;
H. carefully open centrifugal column lid, add 500 μ lBuffer elutriants 2, edge of not getting wet.Stopped pipe, the centrifugal 3min of 14000rpm;
I. centrifugal column is changed to new 2ml collection tube, throw aside former pipe.The centrifugal 3min of 14000rpm;
J. centrifugal column is changed to new 1.5ml centrifuge tube, throw aside former pipe.Open centrifugal column lid, leave standstill 5min.Add 75 μ l elutriants 3.Under room temperature, (15 DEG C-25 DEG C) place 1min.The centrifugal 2min of 8000rpm.By the extracting solution recentrifuge obtained.The same day, use can be placed in 4 DEG C, used at should being placed in-20 DEG C freezing every other day.
The DNA extraction kit that the present embodiment uses is selected from the QIAampDNAmini test kit of QIAGEN, and the DNA extraction method that the present embodiment adopts completes after making improvement to the original extracting method of this test kit.
2. pattern detection
1) real-time fluorescence quantitative PCR detects the copy number of TRECs gene
Form according to Fluorescence PCR liquid I, preparation real-time fluorescence quantitative PCR reaction system, get sample to be checked, positive reference substance, the DNA extraction liquid of negative controls and each 8.0 μ l of blank product, 5 standard substance 2.0 μ l that restructuring TRECs plasmid is mixed with, system composition is as follows:
Real-time fluorescence quantitative PCR response procedures:
Arrange the fluorescence detection channel of collecting FAM fluorescent signal, reaction tubes is put into ABI7300 fluorescent PCR instrument and start amplification, response procedures is as follows:
Table 5 real-time fluorescence quantitative PCR response procedures
2) real-time fluorescence quantitative PCR detects the copy number of KRECs gene
Form according to Fluorescence PCR liquid II, preparation real-time fluorescence quantitative PCR reaction system, get sample to be checked, positive reference substance, the DNA extraction liquid of negative controls and each 8.0 μ l of blank product, 5 standard substance 2.0 μ l that restructuring KRECs plasmid is mixed with, system composition is as follows:
Real-time fluorescence quantitative PCR response procedures:
Arrange the fluorescence detection channel of collecting VIC fluorescent signal, reaction tubes is put into ABI7300 fluorescent PCR instrument and start amplification, response procedures is with table 5.
3) real-time fluorescence quantitative PCR detects the copy number of β-actin gene
Form according to Fluorescence PCR liquid III, preparation real-time fluorescence quantitative PCR reaction system, get 5 standard substance 2.0 μ l that sample to be checked, positive reference substance, the DNA extraction liquid of negative controls and each 8.0 μ l, the recombinant beta-actin plasmid of blank product are mixed with, system composition is as follows:
Real-time fluorescence quantitative PCR response procedures:
Arrange the fluorescence detection channel of collecting VIC fluorescent signal, reaction tubes is put into ABI7300 fluorescent PCR instrument and start amplification, response procedures is with table 5.
4) result judges
The C of baseline range
tvalue (cycle number) is selected automatically for 6-15 or by software, and setting threshold value exceedes the maximum of random amplification curve.Fluorescent PCR instrument is different, the C of gained baseline range
tbe worth different.
5) quality control standard
All kinds of contrast quality control product judged result is as following table:
Table 6 quality control product standard testing result
| Quality control product | Standard testing result |
| TRECs negative control | >60-90copies/μl |
| TRECs blank | Without amplified signal |
| KRECs negative control | >40-60copies/μl |
| KRECs blank | Without amplified signal |
| β-actin negative control | >1.0×10 3copies/μl |
| β-actin blank | Without amplified signal |
Trigenic recombinant plasmid makes typical curve as standard substance through amplification, when relation conefficient >0.99 can be used for the quantitative analysis of TRECs, KRECs and β-actin copy number, otherwise will again test.Figure 1A is the amplification curve of TRECs recombinant plasmid standard substance, and Figure 1B is the typical curve obtained according to this curve.Fig. 2 A is the amplification curve of KRECs recombinant plasmid standard substance, and Fig. 2 B is the typical curve obtained according to this curve.Fig. 3 A is the amplification curve of β-actin recombinant plasmid standard substance, and Fig. 3 B is the typical curve obtained according to this curve.
6) report the test
Fig. 4 is the TRECs real-time fluorescence quantitative PCR amplification curve of multiple clinical SCID negative sample, institute's test sample C originally
tvalue is between 12-31, and within the linearity range of standard substance, quantitative result is the copy number >60-90copies/ μ L of TRECs, is negative sample.
Fig. 5 is the TRECs real-time fluorescence quantitative PCR amplification curve of multiple clinical SCID positive sample, and result display copy number is extremely low or without amplified signal, is positive sample.
Fig. 6 is the amplification curve of multiple Clinical X LA negative sample KRECs, institute's test sample C originally
tvalue is between 12-34, and within the linearity range of standard substance, quantitative result is the copy number >40-60copies/ μ L of KRECs, is negative sample.
Fig. 7 is the KRECs real-time fluorescence quantitative PCR amplification curve of multiple Clinical X LA positive sample, and result display copy number is extremely low or without amplified signal, is positive sample.
Fig. 8 is the amplification curve of the β-actin of multiple normal child's DNA sample, institute's test sample C originally
tvalue is between 12-26, and within the linearity range of standard substance, quantitative result is copy number >1.0 × 10 of β-actin
3copies/ μ L.
Fig. 9 is the amplification curve of the β-actin of multiple TRECs (SCID) and the positive children's sample of KRECs (XLA), result and Fig. 8 basically identical.
Figure 10 A to 10D is respectively the amplification curve of positive control TRECs, KRECs and β-actin.
Figure 11 A to 11C is respectively the amplification curve of blank product TRECs, KRECs and β-actin, and result is all without amplified signal.
The judging criterion of sample results is as follows:
Table 7 pattern detection result
This test kit clinical sample detected result and this sample use the T cell in flow cytomery sample blood, B cell quantity, gene sequencing result and clinical symptom consistent, this method reliable results is described, highly sensitive, reproducible, for Clinical screening newborn infant SCID and XLA provides effective diagnostic means.
Claims (11)
1. a real-time fluorescence quantitative PCR test kit for single stage method detection by quantitative TRECs and KRECs gene, comprising DNA extraction liquid, the standard substance I comprising TRECs gene inserts, the standard substance II comprising KRECs gene inserts, the standard substance III comprising β-actin gene inserts, the real-time fluorescence primer comprising TRECs gene and probe Fluorescence PCR liquid I, comprise the real-time fluorescence primer of KRECs gene and the Fluorescence PCR liquid II of probe and comprise the real-time fluorescence primer of β-actin gene and the Fluorescence PCR liquid III of probe.
2. test kit according to claim 1, wherein
Described Fluorescence PCR liquid I comprises:
1) forward primer of real-time PCR detection TRECs gene, its base sequence is as shown in SEQNO:1;
2) reverse primer of real-time PCR detection TRECs gene, its base sequence is as shown in SEQNO:2;
3) for detecting the probe of TRECs gene, its base sequence is as shown in SEQNO:3;
Wherein said Fluorescence PCR liquid II comprises:
1) forward primer of real-time PCR detection KRECs gene, its base sequence is as shown in SEQNO:4;
2) reverse primer of real-time PCR detection KRECs gene, its base sequence is as shown in SEQNO:5;
3) for detecting the probe of KRECs gene, its base sequence is as shown in SEQNO:6;
Wherein said Fluorescence PCR liquid III comprises:
1) forward primer of real-time PCR detection β-actin gene, its base sequence is as shown in SEQNO:7;
2) reverse primer of real-time PCR detection β-actin gene, its base sequence is as shown in SEQNO:8;
3) for detecting the probe of β-actin gene, its base sequence is as shown in SEQNO:9.
3. test kit according to claim 1, the base sequence of wherein said standard substance I is as shown in SEQNO:10; The base sequence of wherein said standard substance II is as shown in SEQNO:11; The base sequence of wherein said standard substance III is as shown in SEQNO:12.
4. the test kit described in claims 1 to 3, described probe for detecting TRECs gene, for detecting the probe of KRECs gene and the probe for detecting β-actin gene is Taqman probe, what label probe 5 ' was held is a kind of fluorescence radiation group, and it is the one in FAM, VIC, TET, JOE, ROX, CY3, CY5, HEX; What label probe 3 ' was held is a kind of quenching of fluorescence group, and it is the one in TAMRA, DABCYL, NFQ.
5. the test kit described in claims 1 to 3, described Taqman probe 5 ' end flag F AM or VIC, 3 ' end mark TAMRA.
6. the application of the test kit described in claim 1 to 5 in newborn infant's T cell and B cell immune deficiency detect.
7. the application of test kit according to claim 6 in newborn infant's T cell and B cell immune deficiency detect, it comprises the following steps:
Extract with crossing the dry blood spot DNA of post method to measuring samples;
The DNA of extraction is added real-time fluorescence quantitative PCR reaction system, carries out PCR detection with real time fluorescent quantitative detector;
By the cycle threshold of more described testing sample and standard substance, calculate initial TRECs, KRECs and β-actin gene copy number of testing sample according to typical curve.
8. the application of test kit according to claim 7 in newborn infant's T cell and B cell immune deficiency detect, described DNA extraction step comprises following operation:
A. by the dry blood spot three of sample to be checked, put into the centrifuge tube of sterilizing, add 180 μ l cell pyrolysis liquids 1;
B.85 DEG C incubation 10min;
C. add 20 μ l Proteinase K storing solutions, slowly inhale with rifle head and beat, 56 DEG C of incubation 1h;
D. add 200 μ l cell pyrolysis liquids 2, slowly inhale with rifle head and beat thoroughly to mix, 70 DEG C of incubation 10min;
E. add 200 μ l dehydrated alcohols, slowly inhale with rifle head and beat thoroughly to mix;
F. liquid step e obtained and the scraps of paper move in the centrifugal column in collection tube, and the centrifugal 1min of 8000rpm, changes to new collection tube by centrifugal column, throw aside former pipe;
G. add the centrifugal 1min of 500 μ l elutriant 1,8000rpm, centrifugal column is changed to new collection tube, throw aside former pipe;
H. the centrifugal 3min of 500 μ l elutriant 2,14000rpm is added;
I. centrifugal column is changed to new collection tube, throw aside former pipe, the centrifugal 3min of 14000rpm; And
J. centrifugal column is changed to new centrifuge tube, throw aside former pipe; Open centrifugal column lid, leave standstill 5min; Add 75 μ l elutriants 3; Ambient temperatare puts 1min; The centrifugal 2min of 8000rpm; By the extracting solution recentrifuge obtained.
9. the application of test kit according to claim 8 in newborn infant's T cell and B cell immune deficiency detect, wherein, after the operation of each carried out in described step B, C, D and E, gets rid of in pipe gently by drop in pipe lid.
10. the application of test kit according to claim 7 in newborn infant's T cell and B cell immune deficiency detect, wherein, more than the twice of the amount of the standard substance that the amount adding the DNA of the extraction of real-time fluorescence quantitative PCR reaction system described in adds for the described typical curve of making.
The application of 11. test kits according to claim 10 in newborn infant's T cell and B cell immune deficiency detect, wherein, four times of the amount of the standard substance DNA that the amount adding the DNA extraction product of real-time fluorescence quantitative PCR reaction system described in adds for the described typical curve of making.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510734011.7A CN105274230A (en) | 2015-11-02 | 2015-11-02 | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs and KRECs genes and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510734011.7A CN105274230A (en) | 2015-11-02 | 2015-11-02 | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs and KRECs genes and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105274230A true CN105274230A (en) | 2016-01-27 |
Family
ID=55144057
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510734011.7A Pending CN105274230A (en) | 2015-11-02 | 2015-11-02 | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs and KRECs genes and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105274230A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108913770A (en) * | 2018-07-31 | 2018-11-30 | 朱智 | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application |
| CN108977529A (en) * | 2018-07-31 | 2018-12-11 | 朱智 | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application |
| CN108998511A (en) * | 2018-07-31 | 2018-12-14 | 朱智 | It is a kind of detect TRECs and KRECs gene real-time fluorescence quantitative PCR kit and its application |
| CN110408713A (en) * | 2019-05-16 | 2019-11-05 | 重庆医科大学附属儿童医院 | A kind of kit and method detecting newborn TREC and KREC |
| CN110468193A (en) * | 2019-08-03 | 2019-11-19 | 北京致谱医学检验实验室有限公司 | A kind of kit for immunologic deficiency disease detection |
| CN112725439A (en) * | 2021-02-05 | 2021-04-30 | 苏州赛福医学检验有限公司 | High-throughput measurement method, primer and combination, kit and sample judgment method |
| CN115449549A (en) * | 2022-10-27 | 2022-12-09 | 上海捷易生物科技有限公司 | Kit for screening immunodeficiency diseases of newborn and preparation method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103173533A (en) * | 2012-11-20 | 2013-06-26 | 无锡联合利康临床检验所有限公司 | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting TRECs and KRECs genes and application thereof |
| CN103173534A (en) * | 2012-11-20 | 2013-06-26 | 无锡联合利康临床检验所有限公司 | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting TRECs gene and application thereof |
| CN103173535A (en) * | 2012-11-20 | 2013-06-26 | 上海领检科技有限公司 | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof |
-
2015
- 2015-11-02 CN CN201510734011.7A patent/CN105274230A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103173533A (en) * | 2012-11-20 | 2013-06-26 | 无锡联合利康临床检验所有限公司 | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting TRECs and KRECs genes and application thereof |
| CN103173534A (en) * | 2012-11-20 | 2013-06-26 | 无锡联合利康临床检验所有限公司 | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting TRECs gene and application thereof |
| CN103173535A (en) * | 2012-11-20 | 2013-06-26 | 上海领检科技有限公司 | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108913770A (en) * | 2018-07-31 | 2018-11-30 | 朱智 | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application |
| CN108977529A (en) * | 2018-07-31 | 2018-12-11 | 朱智 | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application |
| CN108998511A (en) * | 2018-07-31 | 2018-12-14 | 朱智 | It is a kind of detect TRECs and KRECs gene real-time fluorescence quantitative PCR kit and its application |
| CN110408713A (en) * | 2019-05-16 | 2019-11-05 | 重庆医科大学附属儿童医院 | A kind of kit and method detecting newborn TREC and KREC |
| CN110468193A (en) * | 2019-08-03 | 2019-11-19 | 北京致谱医学检验实验室有限公司 | A kind of kit for immunologic deficiency disease detection |
| CN110468193B (en) * | 2019-08-03 | 2020-09-25 | 北京致谱医学检验实验室有限公司 | Kit for detecting immunodeficiency diseases |
| CN112725439A (en) * | 2021-02-05 | 2021-04-30 | 苏州赛福医学检验有限公司 | High-throughput measurement method, primer and combination, kit and sample judgment method |
| CN115449549A (en) * | 2022-10-27 | 2022-12-09 | 上海捷易生物科技有限公司 | Kit for screening immunodeficiency diseases of newborn and preparation method thereof |
| CN115449549B (en) * | 2022-10-27 | 2023-12-26 | 上海捷易生物科技有限公司 | Kit for screening neonatal immunodeficiency disease and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105274230A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs and KRECs genes and its application | |
| CN103173533B (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting TRECs and KRECs genes and application thereof | |
| CN103173534B (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting TRECs gene and application thereof | |
| JP5317430B2 (en) | Probe set, probe carrier, and fungal discrimination identification method | |
| CN102146476B (en) | Fluorescent quantitative PCR kit for detecting alpha-globin gene deletion | |
| CN104328169B (en) | A kind of scoliotic product of Diagnosis of Congenital and its application | |
| CN106521023B (en) | A kind of kit and method detecting Chinese HPFH and δ β-thalassemia | |
| CN108998511A (en) | It is a kind of detect TRECs and KRECs gene real-time fluorescence quantitative PCR kit and its application | |
| CN108977529A (en) | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application | |
| CN105274232A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs gene and its application | |
| CN104212910A (en) | Single-tube amplification kit for simultaneously detecting alpha and beta thalassemia genes | |
| CN103173535B (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof | |
| CN105274231A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of KRECs gene and its application | |
| Lawler et al. | Adenovirus 12 E1A gene detection by polymerase chain reaction in both the normal and coeliac duodenum. | |
| Tristezza et al. | An optimized protocol for the production of interdelta markers in Saccharomyces cerevisiae by using capillary electrophoresis | |
| CN108642156A (en) | A kind of the digital pcr detection kit and its detection method of T790M gene mutations | |
| Lemmer et al. | Molecular typing of Cryptococcus neoformans by PCR fingerprinting, in comparison with serotyping and Fourier transform infrared-spectroscopy-based phenotyping | |
| CN106282384A (en) | A kind of detect specific primer, probe, detection kit and method micro-deleted for 22q11.2 | |
| CN108913770A (en) | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application | |
| CN109112200A (en) | It is a kind of for detecting the genetic chip, amplifing reagent and kit of alpha Thalassemia | |
| CN110438219B (en) | Primers, probes, kit and method for noninvasive prenatal diagnosis of Papanic edema fetuses based on microdroplet digital PCR | |
| CN108707548B (en) | Nonfunctional pituitary adenoma detection device and application | |
| CN105177156A (en) | Human EGFR gene mutation detection kit and application thereof | |
| CN113667673A (en) | Fut1236delG allele of Bombay-like blood group and detection method and application thereof | |
| CN112322711A (en) | Primer group, kit and method for detecting copy number of human CAR-T cells in mouse model |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160127 |
|
| RJ01 | Rejection of invention patent application after publication |