CN103173535A - Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof - Google Patents
Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof Download PDFInfo
- Publication number
- CN103173535A CN103173535A CN2012104737179A CN201210473717A CN103173535A CN 103173535 A CN103173535 A CN 103173535A CN 2012104737179 A CN2012104737179 A CN 2012104737179A CN 201210473717 A CN201210473717 A CN 201210473717A CN 103173535 A CN103173535 A CN 103173535A
- Authority
- CN
- China
- Prior art keywords
- krecs
- gene
- real
- base sequence
- time fluorescence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof. The kit comprises a PCR system based on nested PCR technology and a real-time fluorescence quantitative PCR system based on real-time fluorescence PCR technology, wherein the nested PCR system comprises forward and reverse primers for KRECs and beta-actin genes; and the real-time fluorescence quantitative PCR system comprises forward and reverse primers and specific fluorescence probes for KRECs and beta-actin genes. The kit can be used for quickly screening the B-cell level of a neonatal immune system, and has the advantages of high sensitivity, high stability and excellent reproducibility. The method is suitable for quantitative detection of KRECs, can be used for screening functions of the neonatal immune system, and has practical clinical application value.
Description
Technical field
The invention belongs to external nucleic acid diagnostic field, relate to a kind of detection by quantitative κ-deletion restructuring resecting loop (κ-deleting recombination excision circles, KRECs) the real time fluorescent quantitative poly chain reaction of gene (Polymerase Chain Reaction, PCR) test kit and uses thereof.
Background technology
Primary immunodeficiency disease (Primary Immunodeficiency Disease, PID) be entirely not cause immunodeficient disease due to immune dysfunction because of immunity system hereditary defect or congenital development, its total incidence is: the U.S. 1/10000, Australia 2.82/100000 people, Japan and Sweden 1/5000 people, China's Hongkong 1/8000 people.If the comprehensive statistical information of domestic shortage according to 1/10000 sickness rate, has 2500 new PID cases in 2,500 ten thousand newborn infants of the annual birth of China, and the Childhood of whole, the accumulative total patient reaches 30,000-60,000 examples.Primary immunodeficiency disease with genetic correlation, often occurs in the infant, repeated infection can occur, but life-threatening when serious.Because wherein some may obtain effective treatment, therefore in time diagnosis is still very important.
November calendar year 2001, (the Centers for Disease Control and Prevention of U.S. CDC, CDC) hold symposium in Atlanta, the provincial capital, George Asia, foundation is for neonatal screening (Newborn Screening, NBS) scheme of experiment and EARLY RECOGNITION PID is so that can early diagnosis and therapy PID patient.U.S. CDC in 2009 carries out severe combined immunodeficiency (Severe Combined Immunodefieieney Disease, SCID) neonatal screening in U.S.'s Wei Sikang star state.
By the difference of immune deficiency character, it is that main (being that antibody deficiency is main immune deficiency), cellular immunity deficiency are associating immune deficiency three major types main and that both have concurrently that primary immunodeficiency disease can be divided into humoral immune defect.In addition, the non-specific immunity defective such as complement defect, phagocytic cell defective also belongs to this group.Antibody deficiency is that main immunodeficient disease is the one group of PID that causes due to B cell early development obstacle, due to humoral immune defect, bacterium easily occurs repeatedly to be infected, showing as the minimizing in various degree of B cell and immunoglobulin (Ig), is the highest primary immunodeficiency disease of sickness rate.Be divided at present following a few class: 1) serious hypogammag lobulinemia, pathogenesis has Bruton Tyrosylprotein kinase (Bruton's Tyrosine Kinase, BTK) genetic flaw, μ chain shortage, λ 5 chain shortages, Ig α shortage, Ig β shortage, BLNK (BLNK) shortage, osteomyelodysplasia etc., wherein the chain agammaglobulinemia of X (XLA) is modal humoral immune defect disease, its cause of disease is the BTK defective, shows as B cell and immunoglobulin (Ig) significantly low; 2) severe of serum IgG and IgA reduce companion B cell normal, reduce or significantly reduce, pathogenesis has Common Variable Immunodeficiency (Common Variable Immunodeficiency Disease, CVID), inducible co-stimulator (Inducible Co-Stimulator, ICOS) defective, CD19 defective, the chain Lymphoid tissue propagation of X syndromes (X-linked Lymph Proliferative Disease, XLP); 3) severe of serum IgG and IgA reduces, IgM is normal or increase (being high IgM syndromes), pathogenesis has CD40L defective, CD40 defective, activation to induce cytidine deaminase (Activation-induced Cytidine Deaminase, AICDA) defective, uridylic N-glycosylase (Uracil-N-Glycosylase, UNG) defective; 4) isotype or light chain lack, and pathogenesis has Ig heavy chain shortage, κ chain shortage, selectivity IgG subclass defective, selective IgA deficiency etc.Antibody deficiency is that the main immunodeficient disease cause of disease is various, diagnose very difficultly, but common trait is bone-marrow-derived lymphocyte shortage or minimizing in various degree.
The detection of the chain agammaglobulinemia of X at present is generally by Flow cytometry CD19
+B cell＜2% or immunoglobulin (Ig) are lower than the diagnosis index more than corresponding age normal value 2S, but these two kinds of methods easily produce false negative, poor specificity.Under study for action, also adopt the method that detects BTK protein expression or BTK transgenation to detect primary immunodeficiency disease, but these two kinds of methods easily produce false positive, and high to technical requirements, only in the training laboratory study, be difficult to popularize.
In the B cell mature process, the κ that forms during gene rearrangement that the λ chain of immunoglobulin (Ig) occurs-deletion resecting loop (κ-deleting recombination excision circles that recombinates, KRECs), KRECs does not increase along with the propagation of cell yet, but constantly is diluted.Because antibody deficiency is the B cell maturation defective in main immunodeficient disease occur in κ-deletion and recombinate before, in patient B cell, KRECs lacks or minimizing in various degree, utilize quantitative PCR method to detect KRECs and can be used as the neonatal screening method that antibody deficiency is main immunodeficient disease, therefore by can examination to the quantitative assay of KRECs going out to suffer from the newborn infant of B cell maturation defective.But, also lack at present method and the test kit that can detect quantitative KRECs.
Summary of the invention
The objective of the invention is to be to provide a kind of copy number by detection by quantitative KRECs gene, be used for the real-time fluorescent PCR reagent case of examination neonatal B cellular immunity deficiency, this test kit is applicable to exist at present all types fluorescence quantitative gene extender on market.The present invention can detect the level of neonatal B cell, and normally whether judgement neonatal immune system function has good application prospect in the Clinical Laboratory field.
Another object of the present invention is the application that has been to provide in examination neonatal B cellular immunity deficiency, sample acquisition, storage convenience that the mentioned reagent box is required, and sensitivity and specificity are high, and detection method is easy, quick, and experimental result is reliable.
In order to realize above-mentioned purpose, the invention provides:
A kind of real-time fluorescence quantitative PCR test kit of detection by quantitative KRECs gene, this test kit comprise DNA extraction liquid, nest-type PRC reaction solution, comprise the standard substance I of KRECs gene insertion sequence, comprise β-the standard substance II of actin gene insertion sequence,, the Fluorescence PCR liquid I of negative control product, blank product, the real-time fluorescence primer that comprises the KRECs gene and probe and comprise the real-time fluorescence primer of β-actin gene and the Fluorescence PCR liquid II of probe.
In a preferred version of the present invention, the nest-type PRC reaction solution is PCR forward primer, the reverse primer by KRECs and β-Actin, 2 * taq PCR MasterMix, 1mM MgCl
2Form with aseptic ultrapure water.In a concrete scheme of the present invention, the nest-type PRC forward primer of KRECs gene (SEQ NO:1) is 5 '-GCTCAGCGCCCATTACGTTTCTG-3 ', and reverse primer (SEQ NO:2) is 5 '-CTGTGAGGGACACGCAGCCTG-3 '.The nest-type PRC forward primer of β-actin gene (SEQ NO:3) is 5 '-CTCATTTCCCTCTCAGGCATGG-3 ', and reverse primer (SEQ NO:4) is 5 '-CCACGTCACACTTCATGATGGA-3 '.
In a preferred version of the present invention, Fluorescence PCR liquid I is comprised of KRECs fluorescence PCR primer and probe, 2.5 * real time Mix, BSA, 20xPCR Enhancer and sterilized water.In a concrete scheme of the present invention, the fluorescent PCR forward primer of KREC gene (SEQ NO:5) is 5 '-GTGGCATTATTTGTATCACTGTGC-3 ', and reverse primer (SEQ NO:6) is that 5 '-CAGCTCTTACCCTAGAGTTTCTGC-3 ' and probe (SEQ NO:7) are FAM-CACGGGAGCAGGTTGGCAGCGC-TRAMA.
In a preferred version of the present invention, Fluorescence PCR liquid II is comprised of β-Actin fluorescence PCR primer and probe, 2.5 * real time Mix, bovine serum albumin (BSA), 20xPCREnhancer and aseptic ultrapure water.In a concrete scheme of the present invention, the fluorescent PCR forward primer of β-actin gene (SEQ NO:8) is 5 '-CTCATTTCCCTCTCAGGCATGG-3 ', and reverse primer (SEQ NO:9) is that 5 '-CCACGTCACACTTCATGATGGA-3 ' and probe (SEQ NO:10) are VIC-CTGTGGCATCCACGAAACT-TRAMA.
In a preferred version of the present invention, the specific probe of the KREC described in Fluorescence PCR liquid I and Fluorescence PCR liquid II and β-actin gene is the Taqman probe, label probe 5 ' end be a kind of fluorescence report group, a kind of in FAM, VIC, TET, JOE, ROX, CY3, CY5, HEX; 3 ' end is for the fluorescent quenching group, is a kind of in TAMRA, DABCYL, NFQ.In reaction system of the present invention, can use one or more fluorescent probe, the fluorescence report group of institute's mark can be for a kind of or two kinds.In a concrete scheme of the present invention, KRECs label probe 5 ' end is the FAM probe, and 3 ' end is the TAMRA probe; β-actin label probe 5 ' end is the VIC probe, and 3 ' end is the TAMRA probe.
In a preferred version of the present invention, the standard substance I is to contain 89 nucleotide fragments of insertion KRECs gene to connect into the pUC57 vector plasmid.The insertion sequence of this KRECs gene (SEQ NO:11) is 5 '-TCCCTTAGTGGCA TTATTTGTATCACTGTGCACAGTGTGCGCTGCCAACCTGCTCCCGTGCAGAAACTC TAGGGTAAGAGCTGGCTCCT-3 '.Standard substance I spectrophotometric instrumentation A
260Quantitatively, depositing concentration is 1.0 * 10
8Copy/ul, 1.0 * 10
7Copy/ul, 1.0 * 10
6Copy/ul, 1.0 * 10
5Copy/ul, 1.0 * 10
4Copy/ul, 1.0 * 10
36 concentration gradients of copy/ul.
In a preferred version of the present invention, the standard substance II is to contain insertion β-70 of actin genes nucleotide fragments to connect into the pUC57 vector plasmid.The insertion sequence (SEQNO:12) of this β-actin gene is: 5 '-ATTTCCCTCTCAGGCATGGAGTCCTGTG GCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACG-3 '.Standard substance II spectrophotometric instrumentation A
260Quantitatively, depositing concentration is 1.0 * 10
8Copy/ul, 1.0 * 10
7Copy/ul, 1.0 * 10
6Copy/ul, 1.0 * 10
5Copy/ul, 1.0 * 10
4Copy/ul, 1.0 * 10
36 concentration gradients of copy/ul.
In a preferred version of the present invention, the negative control product are KRECs and β-actin recombinant plasmid, and its concentration is 5.0 * 10
5Copy/ul.
In a preferred version of the present invention, the blank product are aseptic ultrapure water.
In another aspect of the present invention, a kind of copy number by detection by quantitative KRECs gene also is provided, application in examination neonatal B cellular immunity deficiency, the detection method of real-time fluorescent PCR reagent case to the neonatal B cellular immunity deficiency, the method comprises the following steps:
1) with DNA extraction liquid, dried blood filter paper DNA is extracted:
2) standard substance and testing sample are added the nest-type PRC reaction solution, with the PCR detector, KRECs and β-actin gene are increased;
3) the PCR product after increasing adds the real-time fluorescence quantitative PCR reaction system, detects with fluorescent quantitative detector and carries out PCR and detect;
4) by comparing the circulation thresholding of testing sample and standard substance, calculate initial KRECs and the β-actin gene copy number of testing sample according to typical curve.
When the DNA amount of extracting is enough, also can without the nest-type PRC reaction system, directly add in the real-time quantitative PCR reaction system and go.
Beneficial effect of the present invention:
1) sample acquisition, storage are conveniently.The scraps of paper that the present invention only gets the 3mm diameter to the dried blood filter paper of newborn infant extract the detection that DNA can complete this project, dried blood filter paper is the conventional acquisition of newborn infant, and blood using amount seldom, reduce the blood volume that the newborn infant extracts, dried blood filter paper is conducive to prolonged preservation simultaneously, greatly reduces the appearance of the problems such as acquisition, storage and transportation of sample.
2) sensitivity and specificity are high.Take Auele Specific Primer, probe and nest-type PRC, and the DNA of sample extraction is carried out 18 circulations of regular-PCR amplification, effectively raise the copy number that detects gene, improved the susceptibility to pattern detection, and the KRECs in positive sample does not almost have, and makes the feminine gender of pattern detection result and the positive be easy to judge.
3) detection method is simple, and detection speed is fast, and result represents with copy number, and quantitative result accurately and reliably.Be conducive to apply in hospital and laboratory.
4) pass through to select the house-keeping gene β-actin of sample self as internal reference, if the copy number of the internal reference of amplification is in normal range, the copy number of KRECs is very low, positive findings is reliable, otherwise need redeterminate, therefore can more effectively reduce the appearance of false positive results, thereby guarantee the reliability of data.
The present invention is highly sensitive in a word, and specificity is good, the detection method Simple fast, and experimental result is reliable.The present invention has filled up the generaI investigation of primary immunodeficiency disease and the blank of neonatal screening, can examination antibody defective be not only main immunodeficient disease, and can provide clinical relevant indication for other primary immunodeficiency disease relevant to the B cell development or other system disease, be conducive to early diagnosis and treatment.
Description of drawings
Amplification curve and the typical curve of Fig. 1 .KRECs standard substance.
Fig. 2. amplification curve and the typical curve of β-actin standard substance.
Fig. 3. the amplification curve of normal child's DNA sample KRECs gene.
The amplification curve of the positive children's DNA sample of Fig. 4 .XLA KRECs gene.
Fig. 5. the amplification curve of blank product.
Fig. 6. the amplification curve of normal child's DNA sample β-actin gene.
The amplification curve of the positive children's DNA sample of Fig. 7 .XLA β-actin gene.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Be to be understood that, these embodiment only are used for explanation the present invention and are not used in restriction the scope of protection of present invention, unreceipted concrete experiment condition and method in the following example, usually according to normal condition as fine works molecular biology guide, F.M. the chief editor such as Ao Sibai, Science Press, 1995, molecular cloning experiment guide (third edition); D.L. Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, 1982, or connect the condition of advising according to manufacturer.
Embodiment 1: the preparation of test kit
1. the design of primer and probe is with synthetic
according to UCSC Human Gene Sorter inquiry KRECs and β-actin gene order (http://genome.ucsc.edu/cgi-bin/hgNear) on the UCSC website, utilize Primer3.0 to design the upstream and downstream primer of nest-type PRC on the gene of KRECs, wherein the binding site of the nest-type PRC upstream primer of KRECs and β-actin and this gene is in the upstream of its real-time fluorescence quantitative PCR upstream primer and this gene binding site, the nest-type PRC downstream primer of KRECs and β-actin and the binding site of this gene are in the downstream of its real-time fluorescence quantitative PCR downstream primer and this gene binding site.Selected primer has higher pcr amplification efficient for the good specificity of being combined with of gene.Primer and probe all entrust Life Technologies company to synthesize, and wherein primer is the PAGE purifying, and probe is the HPLC purifying.Probe 5 ' the end of KRECs is labeled as the FAM fluorophor, and 3 ' end is labeled as the TAMRA fluorophor; Probe 5 ' the end of β-actin is labeled as the VIC fluorophor, and 3 ' end is labeled as the TAMRA fluorophor.Primer sequence such as table 1.
Table 1 inserts gene, Auele Specific Primer and probe sequence
2.KRECs and the structure of β-actin standard substance
With KRECs gene and β-actin gene through the theoretical sequence of nest-type PRC primer amplified product by Shanghai Bo Shang Bioisystech Co., Ltd synthetic, it is cloned on the pUC57 carrier, recipient bacterium is e.colistraindh5α, and the recombinant plasmid that obtains is identified through two-way DNA sequencing.Extract positive recombinant plasmid, use the DNA micro-spectrophotometer to measure its concentration and purity, according to formula copy number/μ l=(concentration μ g/ml * 10
-9* 6.02 * 10
23)/(324.5 * 2 * bp number) calculate the copy number of recombinant plasmid, and carry out gradient dilution according to the copy number of measuring, obtain 1.0 * 10
8Copy/ul, 1.0 * 10
7Copy/ul, 1.0 * 10
6Copy/ul, 1.0 * 10
5Copy/ul, 1.0 * 10
4Copy/ul, 1.0 * 10
36 concentration gradient recombinant plasmid standard substance of copy/ul namely obtain standard substance I and standard substance II, in-20 ℃ of preservations.
3. the preparation of negative control product
E.colistraindh5α with the recombinant plasmid that contains respectively KRECs gene and β-actin gene of Shanghai Bo Shang Bioisystech Co., Ltd preparation, extract respectively plasmid, use the DNA micro-spectrophotometer to measure its concentration and purity, and dilute according to the copy number of measuring, obtain 5.0 * 10
5The negative control product of copy/ul are in-20 ℃ of preservations.
4. the preparation of blank product
The blank product are through 121 ℃ of high pressure moist heat sterilizations milli-Q water of 20 minutes.
5. the nest-type PRC reaction solution forms, as table 2.
Table 2 nest-type PRC reaction solution forms
Wherein 2 * taq PCR MasterMix is prepared by sky root biochemical technology company limited (TIANGEN).
6. Fluorescence PCR liquid I forms, as table 3.
Table 3 Fluorescence PCR liquid I forms
Wherein 2.5 * real time Mix and 20 * PCR Enhancer are prepared by sky root biochemical technology company limited (TIANGEN).
7. Fluorescence PCR liquid II forms, as table 4.
Table 4 Fluorescence PCR liquid II forms
Embodiment 2: the use of test kit
1. the extraction of dried blood filter paper DNA
Operation steps is as follows:
A. obtain the dried blood filter paper of diameter 3mm with punch tool, put into the 1.5ml centrifuge tube of sterilization, add the Generation DNA purif.Soln I of 90 μ l, centrifugal 30 seconds of 3700rpm is immersed in solvent filter paper;
B. after standing 15 minutes, centrifugal 5 minutes of 3700rpm sucks solution as far as possible;
C. repeat the A-B step, wherein time of repose is 10 minutes;
D. add aseptic milli-Q water, centrifugal 30 seconds of 3700rpm sucks milli-Q water as far as possible;
E. add 30 μ l Generation DNA Elution Soln II, centrifugal 1 minute of 3700rpm was placed in 99 ℃ of water-baths 25 minutes;
F. to be cooled to the room temperature centrifugal 30 seconds of 3700rpm, the same day, use can be placed in 4 ℃, used every other day to be placed in refrigeration under-20 ℃.
2. pattern detection
1). nest-type PRC amplification KRECs and β-actin gene
Get DNA sample that step 1 extracts and be mixed with the nest-type PRC reaction system according to the composition of nest-type PRC reaction solution, each main component of system is as follows:
The nest-type PRC response procedures:
The nest-type PRC reaction tubes that configures is put into the regular-PCR instrument begin amplification, response procedures is as follows:
Table 5 nest-type PRC response procedures
2). real-time fluorescence quantitative PCR detects the copy number of the KRECs gene after the nest-type PRC amplification
Form according to Fluorescence PCR liquid I, preparation real-time fluorescence quantitative PCR reaction system, get step 1) afterreaction liquid 2.0 μ l, and 6 standard substance that are mixed with by restructuring KRECs plasmid and negative control product, each 2.0 μ l of blank product, each main component of system is as follows:
The real-time fluorescence quantitative PCR response procedures:
The fluorescence detection channel of collecting the FAM fluorescent signal is set, reaction tubes is put into fluorescent PCR instrument (ABI 7300) begin amplification, response procedures is as follows:
Table 6 real-time fluorescence quantitative PCR response procedures
3). the copy number of the β after the amplification of real-time fluorescence quantitative PCR detection nest-type PRC-actin gene
Form according to Fluorescence PCR liquid II, preparation real-time fluorescence quantitative PCR reaction system, get the diluent 2.0 μ l after steps A amplification afterreaction liquid dilutes 1000 times, with 6 standard substance that are mixed with by recombinant beta-actin plasmid and negative control product, each 2.0 μ l of blank product, each main component of system is as follows:
The real-time fluorescence quantitative PCR response procedures:
The fluorescence detection channel of collecting the VIC fluorescent signal is set, reaction tubes is put into fluorescent PCR instrument (ABI 7300) begin amplification, response procedures is as 2) step is identical.
4) result judgement
The Ct value (cycle number) of baseline scope is 6-15 or automatically selected by software, and setting threshold surpasses the maximum of random amplification curve.The fluorescent PCR instrument is different, and the Ct value of gained baseline scope is different.
5) quality control standard
All kinds of contrast quality control product judged results such as following table:
Table 7 quality control product standard testing result
Recombinant plasmid is made typical curve as standard substance through amplification amplification, works as relation conefficient〉0.99 can be used for the quantitative analysis of KRECs and β-actin copy number, otherwise will again test.Fig. 1 is the amplification curve of the standard substance of KREC recombinant plasmid, and the typical curve that obtains according to this curve.Fig. 2 is the amplification curve of the standard substance of β-actin recombinant plasmid, and the typical curve that obtains according to this curve.
6) report the test
Fig. 3 is the KRECs real-time fluorescence quantitative PCR amplification curve of Clinical X LA negative sample, and institute's test sample Ct value originally is between 12-30, and within the linearity range of standard substance, quantitative result is that the copy number of KRECs is 10
4~ 10
5Copy/μ l left and right, negative sample.Fig. 4 is the KRECs real-time fluorescence quantitative PCR amplification curve of Clinical X LA positive sample, and result shows without amplified signal.Fig. 5 is the amplification curve of blank product, and result is without amplified signal.Fig. 6 is the β-actin amplification curve of Clinical X LA negative sample, and this Ct value of institute's test sample is between 14-30, and within the linearity range of standard substance, quantitative result is that the copy number of β-actin is 10
4~ 10
5Copy/μ l left and right.Fig. 7 be Clinical X LA positive sample β-actin amplification curve, result is consistent with Fig. 6.
The judging criterion of sample results is as follows: table 8 report pattern detection result
It is consistent that this test kit clinical sample detected result and this sample use flow cytometer to detect in sample blood B cell quantity and clinical symptom, this method reliable results is described, highly sensitive and good reproducibility is for examination newborn infant XLA clinically provides effective diagnostic means.
Claims (7)
1. the real-time fluorescence quantitative PCR test kit of a detection by quantitative KRECs gene is comprising the Fluorescence PCR liquid I of DNA extraction liquid, nest-type PRC reaction solution, the standard substance I that comprises KRECs gene insertion sequence, the standard substance II that comprises β-actin gene insertion sequence, the real-time fluorescence primer that comprises the KRECs gene and probe with comprise the real-time fluorescence primer of β-actin gene and the Fluorescence PCR liquid II of probe.
2. test kit claimed in claim 1, wherein said nest-type PRC reaction solution comprises:
1) forward primer of nest-type PRC amplification KRECs gene, its base sequence is as shown in SEQNO:1;
2) reverse primer of nest-type PRC amplification KRECs gene, its base sequence is as shown in SEQNO:2;
3) forward primer of nest-type PRC amplification β-actin gene, its base sequence is as shown in SEQ NO:3;
4) reverse primer of nest-type PRC amplification β-actin gene, its base sequence is as shown in SEQ NO:4.
3. test kit claimed in claim 1, wherein said Fluorescence PCR liquid I comprises:
1) real-time fluorescence PCR detects the forward primer of KRECs gene, and its base sequence is as shown in SEQNO:5;
2) real-time fluorescence PCR detects the reverse primer of KRECs gene, and its base sequence is as shown in SEQNO:6;
3) for detection of the probe of KRECs gene, its base sequence is as shown in SEQ NO:7;
Wherein said Fluorescence PCR liquid II comprises:
1) real-time fluorescence PCR detects the forward primer of β-actin gene, and its base sequence is as shown in SEQNO:8;
2) real-time fluorescence PCR detects the reverse primer of β-actin gene, and its base sequence is as shown in SEQNO:9;
3) for detection of the probe of β-actin gene, its base sequence is as shown in SEQ NO:10.
4. test kit claimed in claim 1, wherein said standard substance I, its base sequence is as shown in SEQ NO:11; Wherein said standard substance II, its base sequence is as shown in SEQ NO:12.
5. the described test kit of claim 1 to 4, described specificity fluorescent probe is the Taqman probe, label probe 5 ' end be a kind of fluorescence radiation group, be a kind of in FAM, VIC, TET, JOE, ROX, CY3, CY5, HEX; Label probe 3 ' end be a kind of fluorescent quenching group, be a kind of in TAMRA, DABCYL, NFQ.
6. the described test kit of claim 1 to 4, described Taqman probe 5 ' end flag F AM, 3 ' end mark TAMRA.
7. the application of the described test kit of claim 1 to 6 in the neonatal B cellular immunity deficiency detects.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210473717.9A CN103173535B (en) | 2012-11-20 | 2012-11-20 | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210473717.9A CN103173535B (en) | 2012-11-20 | 2012-11-20 | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103173535A true CN103173535A (en) | 2013-06-26 |
| CN103173535B CN103173535B (en) | 2014-10-22 |
Family
ID=48633722
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210473717.9A Active CN103173535B (en) | 2012-11-20 | 2012-11-20 | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103173535B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274230A (en) * | 2015-11-02 | 2016-01-27 | 上海领检科技有限公司 | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs and KRECs genes and its application |
| CN105274231A (en) * | 2015-11-02 | 2016-01-27 | 上海领检科技有限公司 | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of KRECs gene and its application |
| CN105274232A (en) * | 2015-11-02 | 2016-01-27 | 上海领检科技有限公司 | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs gene and its application |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109872777B (en) * | 2019-03-14 | 2020-09-29 | 江苏省中国科学院植物研究所 | Method for screening real-time fluorescence quantitative PCR (polymerase chain reaction) reference gene of hibiscus hamabo |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006046860A1 (en) * | 2004-10-25 | 2006-05-04 | Erasmus Universiteit Rotterdam | Determining the replicative history of lymphocytes |
| WO2007123392A1 (en) * | 2006-04-24 | 2007-11-01 | Erasmus Universiteit Rotterdam | Determining the replicative history of lymphocytes |
-
2012
- 2012-11-20 CN CN201210473717.9A patent/CN103173535B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006046860A1 (en) * | 2004-10-25 | 2006-05-04 | Erasmus Universiteit Rotterdam | Determining the replicative history of lymphocytes |
| WO2007123392A1 (en) * | 2006-04-24 | 2007-11-01 | Erasmus Universiteit Rotterdam | Determining the replicative history of lymphocytes |
Non-Patent Citations (1)
| Title |
|---|
| 付玉静 等: "婴儿免疫缺陷的早期识别研究", 《中国初级卫生保健》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274230A (en) * | 2015-11-02 | 2016-01-27 | 上海领检科技有限公司 | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs and KRECs genes and its application |
| CN105274231A (en) * | 2015-11-02 | 2016-01-27 | 上海领检科技有限公司 | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of KRECs gene and its application |
| CN105274232A (en) * | 2015-11-02 | 2016-01-27 | 上海领检科技有限公司 | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs gene and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103173535B (en) | 2014-10-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103173533B (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting TRECs and KRECs genes and application thereof | |
| CN103173534B (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting TRECs gene and application thereof | |
| CN110453011A (en) | A kind of method and application based on CRISPR/Cas12a fast accurate detection African swine fever virus | |
| CN102206715B (en) | Kit and method for detecting porcine circovirus type-2 (PCV-2) and subtypes thereof | |
| CN102071259B (en) | Multiplex real-time fluorescence PCR (polymerase chain reaction) detection primer and method for porcine rabies virus, porcine parvovirus and porcine circovirus type 2 | |
| CN110093413A (en) | Detect the primer sets and kit of beta Thalassemia | |
| CN102010894B (en) | Nucleotide sequence, method and kit for detecting exons 12, 13 mutation of human K-ras gene | |
| CN104293916B (en) | A kind of G6PD deficiency disease gene detecting kit | |
| CN102925562B (en) | Kit and method for detecting aminoglycoside drug-induced deafness-sensitive gene | |
| CN104894118A (en) | Primer, probe and kit for detecting bovine viral diarrhea virus | |
| CN104862419A (en) | Primer, probe and kit for detecting infectious bovine rhinotracheitis viruses | |
| CN103173535B (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof | |
| CN105274230A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs and KRECs genes and its application | |
| CN106978511A (en) | A kind of method for detecting feline herpetovirus | |
| CN108977529A (en) | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application | |
| CN108998511A (en) | It is a kind of detect TRECs and KRECs gene real-time fluorescence quantitative PCR kit and its application | |
| CN109762942A (en) | A kind of dual isothermal nucleic acid amplification method containing internal reference of quick detection Respiratory Syncytial Virus(RSV) | |
| CN105779644B (en) | The real-time fluorescence nucleic acid isothermal amplification detection kit of human cytomegalovirus | |
| CN103122387B (en) | Rapid circulating tumor cell (CTCs) fluorescence PCR (Polymerase Chain Reaction) hypersensitivity detection kit and application thereof | |
| CN102952897A (en) | RT-PCR (Reverse Transcription-Polymerase Chain Reaction) fluorescence detection kit for rubella virus and detection method thereof | |
| EP3973532A1 (en) | Methods for detecting a level of h. pylori in a fecal sample | |
| CN102943116A (en) | Gene detection kit for Thailand type alpha-thalassemia | |
| CN105274232A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs gene and its application | |
| CN105274231A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of KRECs gene and its application | |
| CN103805717A (en) | Dual Eva Green real-time fluorescence quantification PCR (Polymerase Chain Reaction) detection kit for detecting equine herpesviruses I and IV and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |