CN111172297A - RhD blood type gene RHD993C > T allele and application - Google Patents

Abstract

The invention discloses a RhD blood group gene RHD993C > T allele and application thereof, wherein the wild type RHD gene sequence is shown as SEQ ID NO. 1, and the mutant type RHD gene sequence is shown as SEQ ID NO. 2; the upstream primer sequence of the specific primer for detecting RHD993C > T allele is SEQ ID NO. 3, and the downstream primer sequence is SEQ ID NO. 4. The RhD blood group gene RHD993C > T allele and the application thereof can detect the existence of mutant genes doped in a gene bank with high sensitivity and high precision.

Description

RhD blood type gene RHD993C & gtT allele and application thereof

Technical Field

The invention relates to the technical field of molecular biology, in particular to a RhD blood group gene RHD993C > T allele and application thereof.

Background

The Rh blood group is the most complex and polymorphic system of the human erythrocyte blood group system and is also the main erythrocyte blood group causing clinical transfusion reactions and severe neonatal hemolytic disease. More than 50 Rh blood group antigens are found, wherein RhD antigens have strong immunogenicity, are coded by RHD genes and are the key points of blood group research. Clinically, Rh blood group antigens are classified into two main types, namely RhD positive and RhD negative, according to whether D antigen is detected on the surface of an erythrocyte membrane.

Currently, the conventional method for detecting Rh blood group D antigen is to identify by adopting a serological saline method, an indirect anti-human globulin test and an absorption and diffusion test. Serological techniques, however, have certain limitations. The results of some individuals when serotyped are difficult to determine due to disease or other factors; serological results of chronic long-term transfusion patients sometimes exhibit a phenomenon of "mixed visual field"; serological tests also fail to obtain correct results when samples cannot be obtained or when there are insufficient red blood cells or red blood cell samples, such as fetal blood grouping, forensic remains, etc.

The detection of RhD blood type by means of immunoserology depends mainly on the specificity of the anti-D antibodies and the amount of antigen expressed. Currently, with the development of molecular biotechnology, RhD mutants increase year by year, and the antigen expression amount and the gene mutation site thereof are different. The detection of the gene mutants mainly determines the Rh blood group D antigen genotype by a molecular biological method, has important clinical practical significance on making up the defects of a serology technology, and also has wide scientific research and application values. The research group recently found 1 RhD blood type RHD993C > T allele, and established a corresponding detection method aiming at the newly found RHD993C > T allele.

Disclosure of Invention

The purpose of the invention is as follows: the invention discloses a RhD blood group gene RHD993C > T allele and application thereof, and provides a RhD blood group gene RHD993C > T allele and a detection method thereof, wherein Rh blood group genotype analysis is carried out by detecting RHD993C > T allele.

The technical scheme is as follows: a RhD blood group gene RHD993C > T allele, the sequence of wild type RHD gene is shown in SEQ ID NO:1, the sequence of mutant type RHD gene is shown in SEQ ID NO: 2; compared with the wild RHD gene sequence, the mutant RHD gene has g.25306649C > T site mutation, namely the 281 th base C of the wild RHD gene sequence is mutated into T.

A specific primer for detecting RHD993C > T allele is disclosed, wherein the upstream sequence of the specific primer is shown as SEQ ID NO. 1, and the downstream sequence of the specific primer is shown as SEQ ID NO. 1.

The beneficial effects of the invention are as follows: the RhD blood group gene RHD993C > T allele and the application thereof adopt a molecular biology method to detect the gene level, and can detect the existence of the mutant gene doped in a gene library with high sensitivity and high precision. Due to the difference of RHD genes among different nationalities, on the basis of related research, the RHD993C & gt T allele which is newly discovered is specially designed according to the molecular background of the RHD gene of Chinese. The invention not only has important clinical practical significance in making up the defects of the serology technology, but also has wide scientific research application value.

Drawings

FIG. 1 is a gel electrophoresis chart of the RHD993C > T allele detection in the example;

FIG. 2 is a sequence diagram of the mutation of the RHD993C > T allele in the examples.

Detailed Description

The invention will be further described with reference to the accompanying figures 1 to 2.

The RhD blood group gene RHD993C > T allele site g.25306649C > T mutation. This mutation occurs at position 25306649 in chromosome 1, the gene numbered NC _000001.11 in the NCBl reference database grch38.p13 (25272393-25330445). Partial base sequences containing the wild type of the site in the database are listed here for reference, as shown in SEQ ID NO:1, the mutation site is that the 281 th position of the SEQ ID NO. 1 sequence is mutated from a base C to a base T. The corresponding sequence of the RHD gene mutation is shown as SEQ ID NO:2, respectively.

SEQ ID NO:1

TTAGAAATGCTGTTAGACCCCACCCCACATCCACTAAAGCCAGCTCTTCATTTCAACAAACTCCCCGATGATGTGAGTGCACATTCAAGTCTGAGAAGGGCTTCTTTGAGGTGAGCCTTAGTGCCCATCCCCCTTTGGTGGCCCCGGATACCAAGGGTGTGTGAAAGGGGTGGGTAGGGAATATGGGTCTCACCTGCCAATCTGCTTATAATAACACTTGTCCACAGGGGTGTTGTAACCGAGTGCTGGGGATTCCCCACAGCTCCATCATGGGCTACAACTTCAGCTTGCTGGG

SEQ ID NO:2

TTAGAAATGCTGTTAGACCCCACCCCACATCCACTAAAGCCAGCTCTTCATTTCAACAAACTCCCCGATGATGTGAGTGCACATTCAAGTCTGAGAAGGGCTTCTTTGAGGTGAGCCTTAGTGCCCATCCCCCTTTGGTGGCCCCGGATACCAAGGGTGTGTGAAAGGGGTGGGTAGGGAATATGGGTCTCACCTGCCAATCTGCTTATAATAACACTTGTCCACAGGGGTGTTGTAACCGAGTGCTGGGGATTCCCCACAGCTCCATCATGGGCTACAATTTCAGCTTGCTGGG

The method for detecting the allele of the RhD blood group gene RHD993C > T selectively amplifies a target part containing a mutant gene by gene amplification so as to detect the existence of the mutant gene. The detection method comprises the following steps:

(1) extracting DNA in a sample to be detected;

(2) carrying out PCR reaction by using the DNA as a template and a PCR primer designed aiming at a coding region near the RHD993C & gtT mutant gene to obtain a PCR reaction product;

(3) measuring the nucleotide sequence composition of the PCR reaction product;

(4) the nucleotide sequence was compared to the sequence of the RHD wild-type gene to determine if there was a 993C → T mutation. The nucleotide sequence composition of the PCR reaction product can be used for sequencing the PCR reaction product through a sequencer.

And (3) detecting the RhD blood group gene RHD993C > T allele. The method comprises the following specific steps:

(1) designing a primer: designing primers through Oligo 6.0 primer software according to RHD gene (sequence number: NC-000001.11) recorded by the GenBank of National Center for Biotechnology Information (NCBI), and finally determining 1 pair of specific oligonucleotide primer sequences, wherein the sequence of the upstream primer is shown as SEQID NO. 3 in Table 1; the sequence of the downstream primer is shown as SEQID NO. 4, and the length of the amplified product fragment is 176 bp.

TABLE 1 RHD993C > T allele detection primer sequences and reaction specificity

Note: the position of the exon base sequence referred to by the oligonucleotide primer sequence refers to the entire arrangement of 10 exons starting from the ATG start codon; the position of the base sequence of the intron in question refers to the single order of arrangement of each intron.

(2)RHD993C>Amplification of the T allele: the total volume of the reaction system is 50 mu L; wherein the PCR reaction solution contains 10 μ L of PCR 5 × buffer solution, 5.0 μ L of DNA template, 1.0 μ L of Taq polymerase and 1.0 μ L MgCl₂The final concentration is 2.0mmol/L, the final concentration of dNTP is 200nmol/L, and the final concentrations of the specificity forward primer and the specificity reverse primer are both 200 nmol/L; adding sterilized double distilled water to the total volume of the reaction system to be 50 mu L; and (3) reacting the reaction system in a PCR instrument. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, then denaturation at 94 ℃ for 30s in sequence, annealing at 62 ℃ for 40s, and extension at 72 ℃ for 1min for 35 cycles;

(3) RHD993C > T allele detection: and (3) carrying out electrophoresis on the amplified product obtained in the step (2) by using an agarose gel to detect whether the amplified product contains the target fragment.

The preparation method of the DNA template comprises the following steps:

the method adopts a purchased kit to extract the whole blood genome DNA, and comprises the following specific steps:

(1) taking one sterile 2.0mL centrifuge tube, and adding 1mL cell lysate;

(2) gently shaking the whole blood sample anticoagulated by EDTA until the whole blood sample is thoroughly mixed; then, adding 500 mu L of blood sample into the centrifuge tube containing the cell lysate, slightly pouring the centrifuge tube for 5-6 times, and uniformly mixing;

(3) incubate for 10 minutes at room temperature (during which the tube is inverted for 2-3 rounds of mixing);

(4) centrifuging at 12000rpm for 5 minutes at room temperature;

(5) the supernatant is removed as far as possible slowly by a liquid shifter, and the white substance at the interface of the two phases is not sucked out;

(6) mix vigorously using a vortex shaker (Votex) until the leukocytes are resuspended (10-15 seconds);

(7) to the resuspended cell solution was added 300. mu.L of the lysis solution. Sucking and discharging the solution by using a pipette tip for 5-6 times to crack the white blood cells; at which point the solution should become very viscous. If cell clumps are visible after mixing, incubating the solution at 37 ℃ until clumps dissipate; if cell clumps remain visible after 1 hour of incubation, an additional 100. mu.L of lysis buffer was added and incubation at 37 ℃ repeated;

(8) adding 100 mu L of protein precipitation solution into the nuclear lysate, and violently shaking for 10-20 seconds by using a vortex oscillator;

(9) centrifuging at 12000rpm for 5 minutes at room temperature;

(10) transferring the supernatant to a corresponding number of 2.0mL centrifuge tube added with 300 μ L of room temperature isopropanol;

(11) gently invert to mix the solution until white linear DNA forms a precipitate;

(12) centrifuging at 12000rpm for 1min at room temperature;

(13) discarding the supernatant, adding room-temperature 70% ethanol with the volume equal to that of the sample, and slightly inverting the centrifuge tube for several times;

(14) the ethanol solution was removed as slowly as possible by pipette. Baking the centrifugal tube at 50 ℃ for 5-10 minutes to completely volatilize residual ethanol liquid as much as possible;

(15) adding 50-100 mu L of DNA solution into a centrifuge tube, and gently mixing uniformly;

(16) the DNA extraction effect was evaluated by 1% agarose gel electrophoresis, and the content was quantified by Nanodrop nucleic acid analyzer and stored at-20 ℃.

The technical scheme for detecting the RHD993C T allele comprises the following specific steps:

the instrument comprises the following steps: veriti 96 type PCR instrument, BIO-RAD Gel Doc XR + type Gel imager (Berle, USA), Gel electrophoresis instrument (Hex, Beijing).

Reagent: QIAamp DNA extraction kit (Qiagen, Germany); DNAIsolation Kit extraction Kit (PELFREEZ corporation, beijing); PCR buffer, dNTP, Taq enzyme (ABI, USA); primers and probes were synthesized by Shanghai Biotechnology Ltd.

(1)RHD993C>Amplification of the T allele: total volume of reaction: 50 μ L, 10 μ L of PCR-containing 5 Xbuffer, 5.0 μ L of DNA template, 1.0 μ L of Taq polymerase (1U/. mu.L), MgCl₂Final concentration 2.0mmol/L, dNTP endConcentration of 200nmol/L, and final concentration of 200nmol/L of specific upper and lower primers, and sterile double distilled water was added to a total volume of 50. mu.L. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, followed by subsequent denaturation at 94 ℃ for 30 sec, followed by annealing at 62 ℃ for 40 sec, and extension at 72 ℃ for 1min for 35 cycles;

(2) RHD993C > T allele detection: the amplified product obtained in step (1) was subjected to electrophoresis using 1.5% agarose gel to detect the presence or absence of the desired fragment. And observing and photographing the result by a gel imager, and displaying the PCR product as a single band after electrophoresis without a miscellaneous band, thus prompting that the PCR product is single and has no non-specific amplification. If the position of the stripe is in a position with proper size, the target segment is obtained. As shown in fig. 1, M: 50bp gradient molecular weight markers, 1: blank control, 2: wild-type control, 3: RHD993C > T mutant samples.

(3) And (3) purifying an amplification product: in this study, the PCR product after Agarose Gel electrophoresis was purified and recovered using the Agarose Gel DNA purification kit from Takara, Inc., and prepared for sequencing.

(4) Sanger sequencing and result judgment: the purified PCR product was sequenced on an ABI3730 type fully automatic DNA sequencer. The sequencing results were aligned with the RHD wild-type Reference Sequence (NCBI Reference Sequence: NC-000001.11) and the results were reported as a function of the actual mutation. The pattern of the detected gene mutation is shown in FIG. 2, in which the RHD gene shows a g.25306649C > T mutation as indicated by an arrow.

Sequence listing

<110> fifth people hospital in Wuxi city

<120> RhD blood group gene RHD993C > T allele and application

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>295

<212>DNA

<213>Homo sapiens

<400>1

ttagaaatgc tgttagaccc caccccacat ccactaaagc cagctcttca tttcaacaaa 60

ctccccgatg atgtgagtgc acattcaagt ctgagaaggg cttctttgag gtgagcctta 120

gtgcccatcc ccctttggtg gccccggata ccaagggtgt gtgaaagggg tgggtaggga 180

atatgggtct cacctgccaa tctgcttata ataacacttg tccacagggg tgttgtaacc 240

gagtgctggg gattccccac agctccatca tgggctacaa cttcagcttg ctggg 295

<210>2

<211>295

<212>DNA

<213>Homo sapiens

<400>2

ttagaaatgc tgttagaccc caccccacat ccactaaagc cagctcttca tttcaacaaa 60

ctccccgatg atgtgagtgc acattcaagt ctgagaaggg cttctttgag gtgagcctta 120

gtgcccatcc ccctttggtg gccccggata ccaagggtgt gtgaaagggg tgggtaggga 180

atatgggtct cacctgccaa tctgcttata ataacacttg tccacagggg tgttgtaacc 240

gagtgctggg gattccccac agctccatca tgggctacaa tttcagcttg ctggg 295

<210>3

<211>28

<212>DNA

<213>Homo sapiens

<400>3

tccccacagc tccatcatgg gctacaat 28

<210>4

<211>27

<212>DNA

<213>Homo sapiens

<400>4

tctgcacaca tttcttcctg agttgga 27

Claims (2)

1. An RhD blood group gene RhD993C > T allele characterized by: the sequence of the wild type RHD gene is shown as SEQ ID NO. 1, and the sequence of the mutant type RHD gene is shown as SEQ ID NO. 2; compared with the wild RHD gene sequence, the mutant RHD gene has g.25306649C > T site mutation, namely the 281 th base C of the wild RHD gene sequence is mutated into T.

2. A specific primer for the detection of the RHD993C > T allele, characterized in that: the upstream sequence of the specific primer is shown as SEQ ID NO. 1, and the downstream sequence of the specific primer is shown as SEQ ID NO. 1.

Images