CN110055258B

CN110055258B - Breast cancer related gene ERBB2 site g.3939700G > A mutant and application thereof

Info

Publication number: CN110055258B
Application number: CN201910331557.6A
Authority: CN
Inventors: 王学东; 王玥苹; 顾娟; 张兵; 周道平
Original assignee: Wuxi Fifth Peoples Hospital
Current assignee: Wuxi Fifth Peoples Hospital
Priority date: 2019-04-24
Filing date: 2019-04-24
Publication date: 2020-04-03
Anticipated expiration: 2039-04-24
Also published as: CN110055258A

Abstract

The invention discloses a g.393939700G > A mutant of a breast cancer related gene ERBB2 site and application thereof, and belongs to the fields of genetic engineering and tumor medicine. Wherein the mutant ERBB2 gene sequence and the wild ERBB2 gene sequence have g.3939700G > A site mutation, a specific primer for detecting the mutant and a kit containing the specific primer. A g.393939393979 20G > A mutant of breast cancer related gene ERBB2 and application thereof can assist in quickly and conveniently judging breast cancer.

Description

Breast cancer related gene ERBB2 site g.3939700G > A mutant and application thereof

Technical Field

The invention relates to a medical biotechnology, in particular to a g.393939700G > A mutant of a breast cancer related gene ERBB2 site and application thereof.

Background

The breast cancer is known to belong to a systemic disease, the cause of the breast cancer is not clearly disclosed so far, with the development of tumor molecular genetics, tumor cytogenetics and molecular epidemiology, the common action of environmental factors and genetic factors is considered to influence the occurrence of the breast cancer, and in the hereditary cancer syndrome, the germline mutation of cancer-related genes determines the genetic susceptibility of tumors of the family; in sporadic cancers, the major risk factors are environmental factors, and genetic polymorphisms in the associated genes determine the susceptibility of individuals to these factors.

Research shows that the incidence risk of breast cancer of women carrying breast cancer genetic susceptibility genes is greatly improved, and in the case of BRCA1 and BRCA2 genes, the risk of the breast cancer of a carrier for the whole life is up to 80%, so that the secondary prevention (early discovery, early diagnosis and early treatment) of the breast cancer can be improved by detecting the susceptibility genes related to the breast cancer. Wherein, the breast cancer related gene ERBB2 is also called neu or HER-2 gene, is a cell-derived proto-oncogene, and the oncogene and the protein product (p185) thereof are overexpressed and amplified in various tumors. The pathological research on the ERBB2 oncogene protein product p185 is mostly seen in breast cancer at first, and the effect is also clear. It is currently believed that positive expression of the ERBB2 protein product can be used as an independent indicator for determining the prognosis of breast cancer.

Disclosure of Invention

The purpose of the invention is as follows: in order to overcome the defects in the prior art, the invention provides a g.39397034G > A mutant of a breast cancer related gene ERBB2 site, a specific primer for detecting the mutant and a kit containing the specific primer, so as to quickly and conveniently assist in judging breast cancer.

The technical scheme is as follows: in order to achieve the purpose, the sequence of the wild type ERBB2 gene of the g.3939770G > A mutant of the breast cancer related gene ERBB2 is shown as SEQ ID NO. 1, the sequence of the mutant type ERBB2 gene of the mutant type ERBB2 gene of the mutant type ERBB2 gene of the invention is shown as SEQ ID NO. 2, and the g.393939700G > A site mutation exists between the sequence of the mutant type ERBB2 gene and the sequence of the wild type ERBB2 gene.

Further, a specific primer for detecting the g.393939770G > A mutant at the position of the breast cancer related gene ERBB2, wherein the sequence of an upstream primer of the specific primer is shown as SEQID NO. 3, and the sequence of a downstream primer of the specific primer is shown as SEQID NO. 4; used for detecting ERBB2 gene g.3939700G > A site mutation; the ERBB2 gene g.393939700G > A site mutation means that the mutation site is A in the 92 th base G of SEQ ID NO. 1 sequence.

Furthermore, the breast cancer auxiliary diagnosis kit comprises specific primers for detecting g.393939700G > A mutant at the ERBB2 site.

The beneficial effects of the invention are as follows: the g.39393939700G > A mutant of the breast cancer related gene ERBB2, the specific primer for detecting the mutant and the kit containing the specific primer can make the diagnosis of breast cancer more convenient and easier, lay a foundation for a clinician to quickly and accurately master the disease condition of a patient, and provide help for finding a novel micromolecule drug target with potential treatment value.

Drawings

FIG. 1 is a gel electrophoresis diagram of detection of g.393939700G > A mutant at the position of breast cancer related gene ERBB 2;

FIG. 2 is a gene sequencing diagram of g.393939700G > A mutant at the position of breast cancer related gene ERBB 2.

Detailed Description

The present invention will be further described with reference to the accompanying drawings.

The g.393939770G > A mutant of the breast cancer related gene ERBB2 site is shown in the attached drawings 1 to 2, the sequence of the wild type ERBB2 gene is shown as SEQ ID NO. 1, the sequence of the mutant type ERBB2 gene is shown as SEQ ID NO. 2, and the sequence of the mutant type ERBB2 gene and the sequence of the wild type ERBB2 gene have g.39393939693G > A site mutation.

In this example, 8 patients with ERBB2 g.3939700G > A mutation (6.7%) were found by screening 120 breast cancer patients with family history of tumors and 300 normal control members, ERBB2 gene g.3939700G > A mutation sites. The variation is a missense variation. This variation was carried by only 3 out of 300 control groups (1.0%), suggesting that this site of variation increases the risk of breast disease. The frequency of the mutation in breast cancer patients is significantly higher than that of normal controls, indicating that the mutation site is closely related to breast cancer.

The mutation site related to the breast cancer auxiliary diagnosis found in the above research is g.393939700G > A, the mutation occurs at position 39717320 of chromosome 17, the number of the gene in NCBl reference database GRCh38.p12 is NC _000017.11 (39688084-39728662), a partial base sequence containing a wild type of the site in the database is listed for reference, as shown in SEQ ID NO:1, and a sequence corresponding to the ERBB21 gene mutation is shown in SEQ ID NO:2, wherein the mutation site is mutated from base G to A at position 92 of the sequence in SEQ ID NO: 1.

SEQID NO:1

GAAGCACAAAGGGGACCCAACTAAGGGCCTGATCCTACTGCCCTGGGGGTGTCAGTGCC AGCCCCCCACAAATCTTTTCTGCCCCCCCCAGGAGGCTGACCAGTGTGTGGCCTGTGCCCACT ATAAGGACCCTCCCTTCTGCGTGGCCCGCTGCCCCAGCGGTGTGAAACCTGACCTCTCCTACA TGCCCATCTGGAAGTTTCCAGATGAGGAGGGCGCATGCCAGCCTTGCCCCATCAACTGCACCC ACTCGTGAGTCCAACGG

SEQID NO:2

GAAGCACAAAGGGGACCCAACTAAGGGCCTGATCCTACTGCCCTGGGGGTGTCAGTGCC AGCCCCCCACAAATCTTTTCTGCCCCCCCCAGAAGGCTGACCAGTGTGTGGCCTGTGCCCACT ATAAGGACCCTCCCTTCTGCGTGGCCCGCTGCCCCAGCGGTGTGAAACCTGACCTCTCCTACA TGCCCATCTGGAAGTTTCCAGATGAGGAGGGCGCATGCCAGCCTTGCCCCATCAACTGCACCC ACTCGTGAGTCCAACGG

The mutation site is found in Chinese Han family female breast cancer patients for the first time in the research, and the database shows that the mutation site is not found in the scanning of the region of European and American people. By inclusion in a prospective cohort study, it was demonstrated that patients carrying this mutation eventually developed breast cancer, demonstrating that this site is a causative factor in breast cancer.

According to the invention, by controlling the influence factors of age on disease development, the application prospect of the mutation site in breast cancer auxiliary diagnosis is researched, the influence of the mutation site on breast cancer progress is explained, and the diagnosis value of the mutation site is disclosed.

A specific primer for detecting g.3939700G > A mutant at the site of breast cancer related gene ERBB2, wherein the sequence of an upstream primer of the specific primer is shown as SEQID NO. 3, and the sequence of a downstream primer of the specific primer is shown as SEQID NO. 4; used for detecting ERBB2 gene g.3939700G > A site mutation; the ERBB2 gene g.393939700G > A site mutation means that the mutation site is A in the 92 th base G of SEQ ID NO. 1 sequence.

A breast cancer auxiliary diagnosis kit comprises the specific primer for detecting the g.393939700G > A mutant at the ERBB2 site.

The detection method in this embodiment is completed by designing a primer sequence for the mutation site by using the change of the specific sequence site of different genotypes of the human ERBB2 gene and performing polymerase chain reaction.

The invention adopts a Sanger sequencing method and uses PCR amplification primers to carry out mutation detection on ERBB2 gene; wherein the sequence of the upstream primer of the PCR amplification primer is shown as SEQID NO. 3, and the sequence of the downstream primer is shown as SEQID NO. 4.

Specifically, the preparation of DNA template, the detection of ERBB2 gene g.3939700G > A mutant gene, and the preparation of mutation site kit for breast cancer auxiliary diagnosis are as follows.

Preparing a DNA template, extracting whole blood genome DNA by adopting a purchased kit, and specifically comprising the following steps:

(1) taking one sterile 2.0mL centrifuge tube, and adding 1mL cell lysate;

(2) gently shaking the whole blood sample anticoagulated by EDTA until the whole blood sample is thoroughly mixed; then, adding 500 mu L of blood sample into the centrifuge tube containing the cell lysate, slightly pouring the centrifuge tube for 5-6 times, and uniformly mixing;

(3) incubating for 10 minutes at room temperature, and turning over the centrifuge tube for 2-3 times during the incubation period to uniformly mix;

(4) centrifuging at 12000rpm for 5 minutes at room temperature;

(5) the supernatant is removed as far as possible slowly by a liquid shifter, and the white substance at the interface of the two phases is not sucked out;

(6) vigorously mixing by using a vortex oscillator (Votex) until the white blood cells are resuspended for 10-15 seconds;

(7) to the resuspended cell solution was added 300. mu.L of the lysis solution. And sucking and discharging the solution by using a pipette tip for 5-6 times to crack the white blood cells. At which point the solution should become very viscous. If cell clumps are visible after mixing, incubating the solution at 37 ℃ until the clumps dissipate, and if cell clumps are still visible after incubating for 1 hour, adding 100 mu L of lysis buffer and repeatedly incubating at 37 ℃;

(8) adding 100 mu L of protein precipitation solution into the nuclear lysate, and violently shaking for 10-20 seconds by using a vortex oscillator;

(9) centrifuging at 12000rpm for 5 minutes at room temperature;

(10) transferring the supernatant to a corresponding number of 2.0mL centrifuge tube added with 300 μ L of room temperature isopropanol;

(11) gently invert to mix the solution until white linear DNA forms a precipitate;

(12) centrifuging at 12000rpm for 1 min at room temperature;

(13) discarding the supernatant, adding room-temperature 70% ethanol with the volume equal to that of the sample, and slightly inverting the centrifuge tube for several times;

(14) the ethanol solution was removed as slowly as possible by pipette. Baking the centrifugal tube at 50 ℃ for 5-10 minutes to completely volatilize residual ethanol liquid as much as possible;

(15) adding 50-100 mu L of DNA dissolving solution into a centrifuge tube, and gently mixing uniformly;

(16) and (3) evaluating the DNA extraction effect by using 1% agarose gel electrophoresis, detecting the content by using a Nanodrop nucleic acid instrument, quantifying to 20-50 ng/. mu.L, and storing at-20 ℃.

ERBB2 gene g.39393979G > A mutant gene detection technical scheme:

the instrument comprises the following steps: veriti96 PCR instrument, BIO-RAD Gel Doc XR + Gel imager (Berle, USA), and Gel electrophoresis instrument (Hex, Beijing).

Reagent: QIAamp DNA extraction kit (Qiagen, Germany); DNAIsolationKit extraction kit (PELFREEZ corporation, beijing); PCR buffer, dNTP, Taq enzyme (ABI, USA); the primers were synthesized by Shanghai Biometrics, Inc.

(1) Designing a primer: designing primers by virtue of Oligo6.0 primer software according to ERBB2 gene (sequence number: NC-000017.11) recorded by GenBank of National Center for Biotechnology Information (NCBI), finally determining that 1 pair of specific oligonucleotide primer sequences are F: 5'-ATCTTTTCTGCCCCCCCCAGA-3' (SEQ ID NO:3) and R: 5'-CTGCAGAAAAGACCGTTGGAC-3' (SEQ ID NO:4), and the length of an amplification product fragment is 206 bp;

(2) total volume of reaction: 50 μ L containing PCR 5 Xbuffer 10 μ L, DNA template 5.0 μ L, Taq polymerase (1U/. mu.L) 1.0 μ L, MgCl2 final concentration 2.0mmol/L, dNTP final concentration 200nmol/L, and specificity upper and lower primer final concentration 200nmol/L, and adding sterile double distilled water to total volume 50 μ L;

reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min, followed by denaturation at 95 ℃ for 30 sec, followed by annealing at 56 ℃ for 30 sec, and extension at 72 ℃ for 30 sec for 35 cycles;

(3) ERBB2 gene g.3939700G > A mutant gene detection: the amplified product obtained in step (2) was electrophoresed using 1.5% agarose gel to detect the intended fragment. And observing and photographing the result by a gel imager, displaying the PCR product as a single band after electrophoresis, wherein the PCR product has no impurity band, indicating that the PCR product is single and has no non-specific amplification, and if the position of the band is at a position with proper size, the PCR product is the target fragment. As shown in fig. 1, M: 50bp gradient molecular weight markers, 1: blank control, 2: wild-type control, 3: ERBB2 gene g.3939700G > A mutant sample;

(4) and (3) purifying an amplification product: the research adopts an Agarose Gel DNApurification Kit of Takara company to purify and recycle PCR products after Agarose Gel electrophoresis, and prepares for sequencing;

(5) sanger sequencing and result judgment: the purified PCR product was sequenced on an ABI3730 type fully automatic DNA sequencer. The sequencing results were aligned with the wild-type Reference Sequence of ERBB2 (NCBI Reference Sequence: NC-000017.11), and the results were reported based on the actual mutation. The gene mutation pattern obtained by the detection is shown in FIG. 2, in which the arrow indicates that ERBB2 gene shows g.3939700G > A mutation.

The manufacturing and operation process of the mutation site kit is based on PCR amplification and Sanger sequencing scanning detection technology. The kit contains a batch of mutation site specific primers (including the following primers: g.3939700G > A mutation site primer sequences are SEQID NO:3 and SEQID NO:4), and the kit can also comprise reagents commonly used in PCR reaction, such as Taq enzyme, dNTP mixed solution, MgCl2 solution, deionized water and the like; these conventional reagents are well known to those skilled in the art and may additionally contain standards and/or controls (e.g., genotyping standards and blanks, etc.). The kit has the value that only peripheral blood is needed without other tissue samples, mutation sites are detected through the simplest and most specific primer pairs, and breast cancer is judged in an auxiliary mode through a mutation site spectrum, so that the kit is stable, convenient to detect and accurate, and sensitivity and specificity of disease diagnosis are greatly improved.

The relevant mutation site oligonucleotide primer sequences, as shown in table 1;

TABLE 1

Wherein F ═ forward primer sequence; r ═ reverse primer sequence.

The above description is only of the preferred embodiments of the present invention, and it should be noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the invention and these are intended to be within the scope of the invention.

Claims

1. A g.39393939700G > A mutant of breast cancer related gene ERBB2 site is characterized in that: the sequence of the wild type ERBB2 gene is shown as SEQ ID NO. 1, the mutant type ERBB2 gene is shown as SEQ ID NO. 2, and the mutant type ERBB2 gene sequence and the wild type ERBB2 gene sequence have g.3939700G > A site mutation.

2. A specific primer for detecting the g.393939700G > A mutant of the breast cancer related gene ERBB2 site, which is disclosed by claim 1, wherein the specific primer comprises the following components in percentage by weight: the sequence of the upstream primer of the specific primer is shown as SEQID NO. 3, and the sequence of the downstream primer of the specific primer is shown as SEQID NO. 4; used for detecting ERBB2 gene g.3939700G > A site mutation; the ERBB2 gene g.393939700G > A site mutation means that the mutation site is A in the 92 th base G of SEQ ID NO. 1 sequence.

3. A breast cancer auxiliary diagnosis kit is characterized in that: comprises the specific primer which is used for detecting the g.393939700G > A mutant at the ERBB2 site and is disclosed by claim 2.