CN111139301B

CN111139301B - Breast cancer related gene ERBB2 site g.39397319C > A mutant and application thereof

Info

Publication number: CN111139301B
Application number: CN202010161716.5A
Authority: CN
Inventors: 顾娟; 张兵; 王玥苹; 王学东; 周道平; 吴怀国
Original assignee: Wuxi Fifth Peoples Hospital
Current assignee: Wuxi Fifth Peoples Hospital
Priority date: 2020-03-10
Filing date: 2020-03-10
Publication date: 2020-12-18
Anticipated expiration: 2040-03-10
Also published as: CN111139301A

Abstract

The invention discloses a mutant of ERBB2 locus g.393939739C > A of a breast cancer related gene, a specific primer for detecting the mutant and a kit containing the specific primer, which not only make the diagnosis of breast cancer more convenient and easy to implement, and facilitate clinicians to timely and accurately master the illness state of patients, but also can be used as an evaluation standard of clinical treatment effect and provide theoretical support for finding a novel small molecule drug target with potential treatment value.

Description

Breast cancer related gene ERBB2 site g.39397319C > A mutant and application thereof

Technical Field

The invention relates to a medical biotechnology, in particular to a g.39393939739C > A mutant of a breast cancer related gene ERBB2 site and application thereof.

Background

The breast cancer is known to belong to a systemic disease, the cause of the breast cancer is not clearly disclosed so far, with the development of tumor molecular genetics, tumor cytogenetics and molecular epidemiology, the common action of environmental factors and genetic factors is considered to influence the occurrence of the breast cancer, and in the hereditary cancer syndrome, the germline mutation of cancer-related genes determines the genetic susceptibility of tumors of the family; in sporadic cancers, the major risk factors are environmental factors, and genetic polymorphisms in the associated genes determine the susceptibility of individuals to these factors.

Research shows that the incidence risk of breast cancer of women carrying breast cancer genetic susceptibility genes is greatly improved, and in the case of BRCA1 and BRCA2 genes, the risk of the breast cancer of a carrier for the whole life is up to 80%, so that the secondary prevention (early discovery, early diagnosis and early treatment) of the breast cancer can be improved by detecting the susceptibility genes related to the breast cancer. Wherein, the breast cancer related gene ERBB2 is also called neu or HER-2 gene, is a cell-derived proto-oncogene, and the oncogene and the protein product (p185) thereof are overexpressed and amplified in various tumors. The pathological research on the ERBB2 oncogene protein product p185 is mostly seen in breast cancer at first, and the effect is also clear. It is currently believed that positive expression of the ERBB2 protein product can be used as an independent indicator for determining the prognosis of breast cancer.

Disclosure of Invention

The purpose of the invention is as follows: in order to overcome the defects in the prior art, the invention provides a g.393939739C > A mutant of a breast cancer related gene ERBB2, a specific primer for detecting the mutant and a kit containing the specific primer, so as to quickly and conveniently assist in judging breast cancer.

The technical scheme is as follows: in order to realize the purpose, the gene sequence of the wild type ERBB2 of the g.393923319C > A mutant of the breast cancer related gene ERBB2 is shown as SEQ ID NO. 1, and the gene sequence of the mutant type ERBB2 is shown as SEQ ID NO. 2; the mutant ERBB2 gene sequence and the wild-type ERBB2 gene sequence have g.3939739C > A site mutation.

Furthermore, the specific primer for detecting the g.393939397319C > A mutant of the ERBB2 locus is used for detecting the mutation of the ERBB2 locus, wherein the sequence of the upstream primer is shown as SEQ ID NO. 3, and the sequence of the downstream primer is shown as SEQ ID NO. 4; the ERBB2 gene site g.3939393939739C > A mutation means that the mutation site is A in the mutation of the 205 th base C of SEQ ID NO. 1 sequence.

Furthermore, a breast cancer auxiliary diagnosis kit is used for detecting a specific primer of the g.3939397619C > A mutant at the site of the gene ERBB 2.

Has the advantages that: the g.393939397619C > A mutant of the breast cancer related gene ERBB2, the specific primer for detecting the mutant and the kit containing the specific primer not only enable the diagnosis of the breast cancer to be more convenient and easy to implement, are convenient for a clinician to timely and accurately master the illness state of a patient, but also can be used as an evaluation standard of clinical treatment effect, and provide theoretical support for finding a novel micromolecule drug target with potential treatment value.

Drawings

FIG. 1 is a gel electrophoresis image of the gene ERBB2 site g.3939739C > A mutant;

FIG. 2 is a gene sequence chart of ERBB2 site g.39397319C > A mutant.

Detailed Description

The present invention will be further described with reference to the accompanying drawings.

As shown in the attached figures 1 and 2, the g.39393939739C > A mutant of the breast cancer related gene ERBB2 has a wild type ERBB2 gene sequence shown as SEQ ID NO. 1 and a mutant type ERBB2 gene sequence shown as SEQ ID NO. 2; the mutant ERBB2 gene and the wild-type ERBB2 gene have g.3939739C > A site mutation.

PCR amplification is carried out by using specific primers for the mutation sites of the ERBB2 gene, and the existence of the mutation product fragment of the ERBB2 gene is detected; and detecting whether the site base mutation exists or not by adopting a Sanger sequencing method, wherein the sequence of an upstream primer of a PCR amplification primer is shown as SEQ ID NO. 3, and the sequence of a downstream primer is shown as SEQ ID NO. 4, and the primer is used for detecting the mutation of ERBB2 gene sites g.393939739C & gtA; the ERBB2 gene site g.3939393939739C > A mutation means that the mutation site is A in the mutation of the 205 th base C of SEQ ID NO. 1 sequence.

The high-specificity mutation site related to the breast cancer is searched by researching the mutation in the peripheral blood DNA of the breast cancer patient and the healthy control matched with the breast cancer patient, so that the support is provided for the screening and diagnosis of the breast cancer. In this example, 118 patients with breast cancer with a family history of tumors and 300 normal control members, namely ERBB2 gene g.3939397311C > A mutation sites were screened, and 3 patients with ERBB2 gene g.39397311C > A mutation (2.5%) were found. The variation is a missense variation. This mutation was not found in 300 control groups, suggesting that this site of mutation may increase the risk of breast disease. The frequency of the mutation in breast cancer patients is significantly higher than that of normal controls, indicating that the mutation site is closely related to breast cancer.

The mutation site related to the auxiliary diagnosis of breast cancer found in the above study is g.3939397311C > A, and the mutation occurs at the g.397311C > A position on chromosome 17. The number of the gene in NCBl reference database GRCh38.p13 is NC-000017.11 (39688084-39728662). A partial base sequence containing a wild type of the site is listed in the database for reference, as shown by SEQIDNO:1, a sequence corresponding to ERBB2 gene mutation is shown by SEQIDNO:2, wherein the mutation site is mutated from a base C to an A at the 205 th site of the SEQIDNO:1 sequence. The wild type amino acid sequence of the ERBB2 gene coding sequence is shown as SEQ ID NO. 5, and the mutant type amino acid sequence is shown as SEQ ID NO. 6; wherein the mutation site is converted from serine (S) to arginine (R) at position 680 of the sequence represented by SEQ ID NO. 6.

SEQIDNO:1

GATTGCCTACAAGGAGTTTGGACTTTATTGTGGAGGCAGCGGGGAGCCAAGGCAGGTTTTAGAGTAGGAGAGGGTCCAAGCCTGTGGGTCACCCTTCCGACTTCCCTTTCCGAATGCCAAACACCTTCATGTCCCCCGTGGGCCCCCTTTGTCCCTCCCACCCCAAACTAGCCCTCAATCCCTGACCCTGGCTTCCGCCCCCAGCCCTCTGACGTCCATCATCTCTGCGGTGGTTGGCATTCTGCTGGTCGTGGTCTTGGGGGTGGTCTTTGGGATCCTCATCAAGCGACGGCAGCAGAAGATCCGGAAGTACACGATGCGGAGACTGCTGCAGGAAACGGAGGTGAGGCGGGGTGAAGTCCTCCCAGCCCGCGTGGGGTCTGCACCGGCCC

SEQIDNO:2

GATTGCCTACAAGGAGTTTGGACTTTATTGTGGAGGCAGCGGGGAGCCAAGGCAGGTTTTAGAGTAGGAGAGGGTCCAAGCCTGTGGGTCACCCTTCCGACTTCCCTTTCCGAATGCCAAACACCTTCATGTCCCCCGTGGGCCCCCTTTGTCCCTCCCACCCCAAACTAGCCCTCAATCCCTGACCCTGGCTTCCGCCCCCAGACCTCTGACGTCCATCATCTCTGCGGTGGTTGGCATTCTGCTGGTCGTGGTCTTGGGGGTGGTCTTTGGGATCCTCATCAAGCGACGGCAGCAGAAGATCCGGAAGTACACGATGCGGAGACTGCTGCAGGAAACGGAGGTGAGGCGGGGTGAAGTCCTCCCAGCCCGCGTGGGGTCTGCACCGGCCC

SEQIDNO:5

MPRGSWKPQVCTGTDMKLRLPASPETHLDMLRHLYQGCQVVQGNLELTYLPTNASLSFLQDIQEVQGYVLIAHNQVRQVPLQRLRIVRGTQLFEDNYALAVLDNGDPLNNTTPVTGASPGGLRELQLRSLTEILKGGVLIQRNPQLCYQDTILWKDIFHKNNQLALTLIDTNRSRACHPCSPMCKGSRCWGESSEDCQSLTRTVCAGGCARCKGPLPTDCCHEQCAAGCTGPKHSDCLVCASALCPMCSTPQDARGGHPAWYCPIAPGTPGQNSTVKASHLSPQACLHFNHSGICELHCPALVTYNTDTFESMPNPEGRYTFGASCVTACPYNYLSTDVGSCTLVCPLHNQEVTAEDGTQRCEKCSKPCARVCYGLGMEHLREVRAVTSANIQEFAGCKKIFGSLAFLPESFDGDPASNTAPLQPEQLQVFETLEEITGYLYISAWPDSLPDLSVFQNLQVIRGRILHNGAYSLTLQGLGISWLGLRSLRELGSGLALIHHNTHLCFVHTVPWDQLFRNPHQALLHTANRPEDECVGEGLACHQLCARGHCWGPGPTQCVNCSQFLRGQECVEECRVLQGLPREYVNARHCLPCHPECQPQNGSVTCFGPEADQCVACAHYKDPPFCVARCPSGVKPDLSYMPIWKFPDEEGACQPCPINCTHSCVDLDDKGCPAEQRASPLTSIISAVVGILLVVVLGVVFGILIKRRQQKIRKYTMR

SEQIDNO:6

MPRGSWKPQVCTGTDMKLRLPASPETHLDMLRHLYQGCQVVQGNLELTYLPTNASLSFLQDIQEVQGYVLIAHNQVRQVPLQRLRIVRGTQLFEDNYALAVLDNGDPLNNTTPVTGASPGGLRELQLRSLTEILKGGVLIQRNPQLCYQDTILWKDIFHKNNQLALTLIDTNRSRACHPCSPMCKGSRCWGESSEDCQSLTRTVCAGGCARCKGPLPTDCCHEQCAAGCTGPKHSDCLVCASALCPMCSTPQDARGGHPAWYCPIAPGTPGQNSTVKASHLSPQACLHFNHSGICELHCPALVTYNTDTFESMPNPEGRYTFGASCVTACPYNYLSTDVGSCTLVCPLHNQEVTAEDGTQRCEKCSKPCARVCYGLGMEHLREVRAVTSANIQEFAGCKKIFGSLAFLPESFDGDPASNTAPLQPEQLQVFETLEEITGYLYISAWPDSLPDLSVFQNLQVIRGRILHNGAYSLTLQGLGISWLGLRSLRELGSGLALIHHNTHLCFVHTVPWDQLFRNPHQALLHTANRPEDECVGEGLACHQLCARGHCWGPGPTQCVNCSQFLRGQECVEECRVLQGLPREYVNARHCLPCHPECQPQNGSVTCFGPEADQCVACAHYKDPPFCVARCPSGVKPDLSYMPIWKFPDEEGACQPCPINCTHSCVDLDDKGCPAEQRARPLTSIISAVVGILLVVVLGVVFGILIKRRQQKIRKYTMR

The method for detecting the g.393939397619C > A mutant of the breast cancer related gene ERBB2 selectively amplifies a target position containing a mutant gene by a gene amplification method, thereby detecting the existence of the mutant gene. The detection method comprises the following steps:

(1) extracting DNA in a sample to be detected;

(2) using the DNA as a template, and carrying out PCR reaction on a PCR primer designed aiming at the DNA sequence of the ERBB2 gene g.393939739C > A mutant region to obtain a PCR reaction product;

(3) measuring the nucleotide sequence composition of the PCR reaction product;

(4) the nucleotide sequence was compared with the sequence of the wild type gene of ERBB2 to determine whether there was a mutation at ERBB2 site g.393939739C > A. The nucleotide sequence composition of the PCR reaction product can be used for sequencing the PCR reaction product through a sequencer.

The detection of the g.39393939393939397319C > A mutant of the breast cancer related gene ERBB2 site comprises the following specific steps:

(1) designing a primer: designing primers through Oligo 6.0 primer software according to ERBB2 gene (sequence number: NC-000017.11) recorded by the GenBank of National Center for Biotechnology Information (NCBI), and finally determining 1 pair of specific oligonucleotide primer sequences, wherein the sequence of an upstream primer is shown as SEQID NO. 3 in Table 1; the sequence of the downstream primer is shown as SEQID NO. 4, and the length of the amplified product fragment is 217 bp.

TABLE 1 related mutation site oligonucleotide primer sequences

Note: the base sequence represented by SEQ ID NO. 3 is a forward primer sequence; SEQ ID NO. 4 is a reverse primer sequence

(2) Amplification of ERBB2 gene g.39393939739C > A mutant: the total volume of the reaction system is 50 mu L; wherein the PCR contained 5 Xbuffer solution 10 μ L, DNA template 5.0 μ L, 1U/μ L Taq polymerase 1.0 μ L, MgCl2 final concentration of 2.0mmol/L, dNTP final concentration of 200nmol/L, specificity forward primer and reverse primer final concentration of 200 nmol/L; adding sterilized double distilled water to the total volume of the reaction system to be 50 mu L; and (2) reacting the reaction system in a PCR instrument under the following reaction conditions: pre-denaturation at 95 ℃ for 5min, then denaturation at 94 ℃ for 30s in sequence, annealing at 58 ℃ for 40s, and extension at 72 ℃ for 1min for 32 cycles;

(3) detection of ERBB2 gene g.3939393939739c > a mutant: and (3) carrying out electrophoresis on the amplified product obtained in the step (2) by using an agarose gel to detect whether the amplified product contains the target fragment.

Preparation of DNA template:

the method adopts a purchased kit to extract the whole blood genome DNA, and comprises the following specific steps:

(1) one sterile 2.0mL centrifuge tube was added to 1mL of cell lysate.

(2) Gently shaking the whole blood sample anticoagulated by EDTA until the whole blood sample is thoroughly mixed; and then, sucking 500 mu L of blood sample, adding the blood sample into the centrifuge tube containing the cell lysate, and slightly pouring the centrifuge tube for 5-6 times to mix uniformly.

(3) Incubate for 10 minutes at room temperature (during which the tube is inverted for 2-3 times and mixed).

(4) Centrifuge at 12000rpm for 5 minutes at room temperature.

(5) The supernatant was removed as slowly as possible with a pipette, taking care not to aspirate the white material at the interface between the two phases.

(6) Mix vigorously using a vortex shaker (Votex) until the leukocytes are resuspended (10-15 seconds).

(7) To the resuspended cell solution was added 300. mu.L of the lysis solution. And sucking and discharging the solution by using a pipette tip for 5-6 times to crack the white blood cells. At which point the solution should become very viscous. If a clump of cells is visible after mixing, the solution is incubated at 37 ℃ until the clump dissipates. If cell clumps remain visible after 1 hour of incubation, an additional 100. mu.L of nuclear lysate is added and incubation at 37 ℃ is repeated.

(8) And adding 100 mu L of protein precipitation solution into the nuclear lysate, and violently shaking for 10-20 seconds by using a vortex oscillator.

(9) Centrifuge at 12000rpm for 5 minutes at room temperature.

(10) The supernatant was transferred to a correspondingly numbered 2.0mL centrifuge tube to which 300. mu.L of room temperature isopropanol had been added.

(11) The solution was mixed by gentle inversion until a white linear DNA precipitate formed.

(12) Centrifuge at 12000rpm for 1min at room temperature.

(13) The supernatant was discarded, and a volume of room temperature 70% ethanol equal to the volume of the sample was added, and the tube was gently inverted several times.

(14) The ethanol solution was removed as slowly as possible by pipette. And (3) baking the centrifugal tube at 50 ℃ for 5-10 minutes to completely volatilize the residual ethanol solution as much as possible.

(15) Adding 50-100 mu L of DNA dissolving solution into a centrifuge tube, and gently mixing uniformly.

(16) And (3) evaluating the DNA extraction effect by using 1% agarose gel electrophoresis, detecting the content by using a Nanodrop nucleic acid instrument, quantifying to 20-50 ng/. mu.L, and storing at-20 ℃.

ERBB2 gene g.393939739C > A mutant gene detection scheme:

the instrument comprises the following steps: veriti96 PCR instrument, BIO-RADGELDocXR + gel imager (Berle, USA), and gel electrophoresis instrument (Hexay, Beijing).

Reagent: QIAampDNA extraction kit (Qiagen, Germany); DNAIsolationKit extraction kit (PELFREEZ corporation, beijing); PCR buffer, dNTP, Taq enzyme (ABI, USA); the primers were synthesized by Shanghai Biometrics, Inc.

(1) Amplification of ERBB2 gene g.39393939739C > A mutant: total volume of reaction: 50 μ L, containing PCR5 Xbuffer 10 μ L, DNA template 5.0 μ L, Taq polymerase (1U/. mu.L) 1.0 μ L, MgCl2 final concentration of 2.0mmol/L, dNTP final concentration of 200nmol/L, and specific upper and lower primer final concentration of 200nmol/L, and adding sterile double distilled water to a total volume of 50 μ L.

Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min followed by subsequent denaturation at 95 ℃ for 30 sec, followed by annealing at 58 ℃ for 40 sec, and extension at 72 ℃ for 1min for 32 cycles.

(2) ERBB2 gene g.393939739C > A mutant gene detection: the amplified product obtained in step (1) was subjected to electrophoresis using 1.5% agarose gel to detect the presence or absence of the desired fragment. And observing and photographing the result by a gel imager, and displaying the PCR product as a single band after electrophoresis without a miscellaneous band, thus prompting that the PCR product is single and has no non-specific amplification. If the position of the stripe is in a position with proper size, the target segment is obtained. As shown in fig. 1, M: 50bp gradient molecular weight markers, 1: blank control, 2: wild-type control, 3: ERBB2 gene g.393939739C > A mutation sample.

(3) And (3) purifying an amplification product: the PCR product after Agarose Gel electrophoresis is purified and recovered by using an Agarose Gel DNAPurification Kit of Takara company, and sequencing is prepared.

(4) Sanger sequencing and result judgment: the purified PCR product was sequenced on an ABI3730 type full-automatic DNA sequencer, the sequencing result was compared with the wild-type Reference Sequence (NCBI Reference Sequence: NC-000017.11) of ERBB2, and the results were reported based on the actual mutation status. The detected gene mutation is shown in FIG. 2, and the arrow in the figure shows the ERBB2 gene g.3939397311C > A mutation.

The above description is only of the preferred embodiments of the present invention, and it should be noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the invention and these are intended to be within the scope of the invention.

Sequence listing

<110> fifth people hospital in Wuxi city

<120> breast cancer related gene ERBB2 site g.397319C > A mutant and application thereof

<130> 4

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 392

<212> DNA

<213> Homo sapiens

<400> 1

gattgcctac aaggagtttg gactttattg tggaggcagc ggggagccaa ggcaggtttt 60

agagtaggag agggtccaag cctgtgggtc acccttccga cttccctttc cgaatgccaa 120

acaccttcat gtcccccgtg ggcccccttt gtccctccca ccccaaacta gccctcaatc 180

cctgaccctg gcttccgccc ccagccctct gacgtccatc atctctgcgg tggttggcat 240

tctgctggtc gtggtcttgg gggtggtctt tgggatcctc atcaagcgac ggcagcagaa 300

gatccggaag tacacgatgc ggagactgct gcaggaaacg gaggtgaggc ggggtgaagt 360

cctcccagcc cgcgtggggt ctgcaccggc cc 392

<210> 2

<211> 392

<212> DNA

<213> Homo sapiens

<400> 2

gattgcctac aaggagtttg gactttattg tggaggcagc ggggagccaa ggcaggtttt 60

agagtaggag agggtccaag cctgtgggtc acccttccga cttccctttc cgaatgccaa 120

acaccttcat gtcccccgtg ggcccccttt gtccctccca ccccaaacta gccctcaatc 180

cctgaccctg gcttccgccc ccagacctct gacgtccatc atctctgcgg tggttggcat 240

tctgctggtc gtggtcttgg gggtggtctt tgggatcctc atcaagcgac ggcagcagaa 300

gatccggaag tacacgatgc ggagactgct gcaggaaacg gaggtgaggc ggggtgaagt 360

cctcccagcc cgcgtggggt ctgcaccggc cc 392

<210> 3

<211> 26

<212> DNA

<213> Homo sapiens

<400> 3

ccctgaccct ggcttccgcc cccaga 26

<210> 4

<211> 25

<212> DNA

<213> Homo sapiens

<400> 4

ccgggggccg gtgcagaccc cacgc 25

<210> 5

<211> 719

<212> PRT

<213> Homo sapiens

<400> 5

Met Pro Arg Gly Ser Trp Lys Pro Gln Val Cys Thr Gly Thr Asp Met

1 5 10 15

Lys Leu Arg Leu Pro Ala Ser Pro Glu Thr His Leu Asp Met Leu Arg

20 25 30

His Leu Tyr Gln Gly Cys Gln Val Val Gln Gly Asn Leu Glu Leu Thr

35 40 45

Tyr Leu Pro Thr Asn Ala Ser Leu Ser Phe Leu Gln Asp Ile Gln Glu

50 55 60

Val Gln Gly Tyr Val Leu Ile Ala His Asn Gln Val Arg Gln Val Pro

65 70 75 80

Leu Gln Arg Leu Arg Ile Val Arg Gly Thr Gln Leu Phe Glu Asp Asn

85 90 95

Tyr Ala Leu Ala Val Leu Asp Asn Gly Asp Pro Leu Asn Asn Thr Thr

100 105 110

Pro Val Thr Gly Ala Ser Pro Gly Gly Leu Arg Glu Leu Gln Leu Arg

115 120 125

Ser Leu Thr Glu Ile Leu Lys Gly Gly Val Leu Ile Gln Arg Asn Pro

130 135 140

Gln Leu Cys Tyr Gln Asp Thr Ile Leu Trp Lys Asp Ile Phe His Lys

145 150 155 160

Asn Asn Gln Leu Ala Leu Thr Leu Ile Asp Thr Asn Arg Ser Arg Ala

165 170 175

Cys His Pro Cys Ser Pro Met Cys Lys Gly Ser Arg Cys Trp Gly Glu

180 185 190

Ser Ser Glu Asp Cys Gln Ser Leu Thr Arg Thr Val Cys Ala Gly Gly

195 200 205

Cys Ala Arg Cys Lys Gly Pro Leu Pro Thr Asp Cys Cys His Glu Gln

210 215 220

Cys Ala Ala Gly Cys Thr Gly Pro Lys His Ser Asp Cys Leu Val Cys

225 230 235 240

Ala Ser Ala Leu Cys Pro Met Cys Ser Thr Pro Gln Asp Ala Arg Gly

245 250 255

Gly His Pro Ala Trp Tyr Cys Pro Ile Ala Pro Gly Thr Pro Gly Gln

260 265 270

Asn Ser Thr Val Lys Ala Ser His Leu Ser Pro Gln Ala Cys Leu His

275 280 285

Phe Asn His Ser Gly Ile Cys Glu Leu His Cys Pro Ala Leu Val Thr

290 295 300

Tyr Asn Thr Asp Thr Phe Glu Ser Met Pro Asn Pro Glu Gly Arg Tyr

305 310 315 320

Thr Phe Gly Ala Ser Cys Val Thr Ala Cys Pro Tyr Asn Tyr Leu Ser

325 330 335

Thr Asp Val Gly Ser Cys Thr Leu Val Cys Pro Leu His Asn Gln Glu

340 345 350

Val Thr Ala Glu Asp Gly Thr Gln Arg Cys Glu Lys Cys Ser Lys Pro

355 360 365

Cys Ala Arg Val Cys Tyr Gly Leu Gly Met Glu His Leu Arg Glu Val

370 375 380

Arg Ala Val Thr Ser Ala Asn Ile Gln Glu Phe Ala Gly Cys Lys Lys

385 390 395 400

Ile Phe Gly Ser Leu Ala Phe Leu Pro Glu Ser Phe Asp Gly Asp Pro

405 410 415

Ala Ser Asn Thr Ala Pro Leu Gln Pro Glu Gln Leu Gln Val Phe Glu

420 425 430

Thr Leu Glu Glu Ile Thr Gly Tyr Leu Tyr Ile Ser Ala Trp Pro Asp

435 440 445

Ser Leu Pro Asp Leu Ser Val Phe Gln Asn Leu Gln Val Ile Arg Gly

450 455 460

Arg Ile Leu His Asn Gly Ala Tyr Ser Leu Thr Leu Gln Gly Leu Gly

465 470 475 480

Ile Ser Trp Leu Gly Leu Arg Ser Leu Arg Glu Leu Gly Ser Gly Leu

485 490 495

Ala Leu Ile His His Asn Thr His Leu Cys Phe Val His Thr Val Pro

500 505 510

Trp Asp Gln Leu Phe Arg Asn Pro His Gln Ala Leu Leu His Thr Ala

515 520 525

Asn Arg Pro Glu Asp Glu Cys Val Gly Glu Gly Leu Ala Cys His Gln

530 535 540

Leu Cys Ala Arg Gly His Cys Trp Gly Pro Gly Pro Thr Gln Cys Val

545 550 555 560

Asn Cys Ser Gln Phe Leu Arg Gly Gln Glu Cys Val Glu Glu Cys Arg

565 570 575

Val Leu Gln Gly Leu Pro Arg Glu Tyr Val Asn Ala Arg His Cys Leu

580 585 590

Pro Cys His Pro Glu Cys Gln Pro Gln Asn Gly Ser Val Thr Cys Phe

595 600 605

Gly Pro Glu Ala Asp Gln Cys Val Ala Cys Ala His Tyr Lys Asp Pro

610 615 620

Pro Phe Cys Val Ala Arg Cys Pro Ser Gly Val Lys Pro Asp Leu Ser

625 630 635 640

Tyr Met Pro Ile Trp Lys Phe Pro Asp Glu Glu Gly Ala Cys Gln Pro

645 650 655

Cys Pro Ile Asn Cys Thr His Ser Cys Val Asp Leu Asp Asp Lys Gly

660 665 670

Cys Pro Ala Glu Gln Arg Ala Ser Pro Leu Thr Ser Ile Ile Ser Ala

675 680 685

Val Val Gly Ile Leu Leu Val Val Val Leu Gly Val Val Phe Gly Ile

690 695 700

Leu Ile Lys Arg Arg Gln Gln Lys Ile Arg Lys Tyr Thr Met Arg

705 710 715

<210> 6

<211> 719

<212> PRT

<213> Homo sapiens

<400> 6

Met Pro Arg Gly Ser Trp Lys Pro Gln Val Cys Thr Gly Thr Asp Met

1 5 10 15

Lys Leu Arg Leu Pro Ala Ser Pro Glu Thr His Leu Asp Met Leu Arg

20 25 30

His Leu Tyr Gln Gly Cys Gln Val Val Gln Gly Asn Leu Glu Leu Thr

35 40 45

Tyr Leu Pro Thr Asn Ala Ser Leu Ser Phe Leu Gln Asp Ile Gln Glu

50 55 60

Val Gln Gly Tyr Val Leu Ile Ala His Asn Gln Val Arg Gln Val Pro

65 70 75 80

Leu Gln Arg Leu Arg Ile Val Arg Gly Thr Gln Leu Phe Glu Asp Asn

85 90 95

Tyr Ala Leu Ala Val Leu Asp Asn Gly Asp Pro Leu Asn Asn Thr Thr

100 105 110

Pro Val Thr Gly Ala Ser Pro Gly Gly Leu Arg Glu Leu Gln Leu Arg

115 120 125

Ser Leu Thr Glu Ile Leu Lys Gly Gly Val Leu Ile Gln Arg Asn Pro

130 135 140

Gln Leu Cys Tyr Gln Asp Thr Ile Leu Trp Lys Asp Ile Phe His Lys

145 150 155 160

Asn Asn Gln Leu Ala Leu Thr Leu Ile Asp Thr Asn Arg Ser Arg Ala

165 170 175

Cys His Pro Cys Ser Pro Met Cys Lys Gly Ser Arg Cys Trp Gly Glu

180 185 190

Ser Ser Glu Asp Cys Gln Ser Leu Thr Arg Thr Val Cys Ala Gly Gly

195 200 205

Cys Ala Arg Cys Lys Gly Pro Leu Pro Thr Asp Cys Cys His Glu Gln

210 215 220

Cys Ala Ala Gly Cys Thr Gly Pro Lys His Ser Asp Cys Leu Val Cys

225 230 235 240

Ala Ser Ala Leu Cys Pro Met Cys Ser Thr Pro Gln Asp Ala Arg Gly

245 250 255

Gly His Pro Ala Trp Tyr Cys Pro Ile Ala Pro Gly Thr Pro Gly Gln

260 265 270

Asn Ser Thr Val Lys Ala Ser His Leu Ser Pro Gln Ala Cys Leu His

275 280 285

Phe Asn His Ser Gly Ile Cys Glu Leu His Cys Pro Ala Leu Val Thr

290 295 300

Tyr Asn Thr Asp Thr Phe Glu Ser Met Pro Asn Pro Glu Gly Arg Tyr

305 310 315 320

Thr Phe Gly Ala Ser Cys Val Thr Ala Cys Pro Tyr Asn Tyr Leu Ser

325 330 335

Thr Asp Val Gly Ser Cys Thr Leu Val Cys Pro Leu His Asn Gln Glu

340 345 350

Val Thr Ala Glu Asp Gly Thr Gln Arg Cys Glu Lys Cys Ser Lys Pro

355 360 365

Cys Ala Arg Val Cys Tyr Gly Leu Gly Met Glu His Leu Arg Glu Val

370 375 380

Arg Ala Val Thr Ser Ala Asn Ile Gln Glu Phe Ala Gly Cys Lys Lys

385 390 395 400

Ile Phe Gly Ser Leu Ala Phe Leu Pro Glu Ser Phe Asp Gly Asp Pro

405 410 415

Ala Ser Asn Thr Ala Pro Leu Gln Pro Glu Gln Leu Gln Val Phe Glu

420 425 430

Thr Leu Glu Glu Ile Thr Gly Tyr Leu Tyr Ile Ser Ala Trp Pro Asp

435 440 445

Ser Leu Pro Asp Leu Ser Val Phe Gln Asn Leu Gln Val Ile Arg Gly

450 455 460

Arg Ile Leu His Asn Gly Ala Tyr Ser Leu Thr Leu Gln Gly Leu Gly

465 470 475 480

Ile Ser Trp Leu Gly Leu Arg Ser Leu Arg Glu Leu Gly Ser Gly Leu

485 490 495

Ala Leu Ile His His Asn Thr His Leu Cys Phe Val His Thr Val Pro

500 505 510

Trp Asp Gln Leu Phe Arg Asn Pro His Gln Ala Leu Leu His Thr Ala

515 520 525

Asn Arg Pro Glu Asp Glu Cys Val Gly Glu Gly Leu Ala Cys His Gln

530 535 540

Leu Cys Ala Arg Gly His Cys Trp Gly Pro Gly Pro Thr Gln Cys Val

545 550 555 560

Asn Cys Ser Gln Phe Leu Arg Gly Gln Glu Cys Val Glu Glu Cys Arg

565 570 575

Val Leu Gln Gly Leu Pro Arg Glu Tyr Val Asn Ala Arg His Cys Leu

580 585 590

Pro Cys His Pro Glu Cys Gln Pro Gln Asn Gly Ser Val Thr Cys Phe

595 600 605

Gly Pro Glu Ala Asp Gln Cys Val Ala Cys Ala His Tyr Lys Asp Pro

610 615 620

Pro Phe Cys Val Ala Arg Cys Pro Ser Gly Val Lys Pro Asp Leu Ser

625 630 635 640

Tyr Met Pro Ile Trp Lys Phe Pro Asp Glu Glu Gly Ala Cys Gln Pro

645 650 655

Cys Pro Ile Asn Cys Thr His Ser Cys Val Asp Leu Asp Asp Lys Gly

660 665 670

Cys Pro Ala Glu Gln Arg Ala Arg Pro Leu Thr Ser Ile Ile Ser Ala

675 680 685

Val Val Gly Ile Leu Leu Val Val Val Leu Gly Val Val Phe Gly Ile

690 695 700

Leu Ile Lys Arg Arg Gln Gln Lys Ile Arg Lys Tyr Thr Met Arg

705 710 715

Claims

1. A breast cancer related gene ERBB2 site g.3939397319C > A mutant is characterized in that: the gene sequence of the wild type ERBB2 is shown as SEQ ID NO. 1, and the gene sequence of the mutant type ERBB2 is shown as SEQ ID NO. 2; the mutant ERBB2 gene sequence and the wild-type ERBB2 gene sequence have g.3939739C > A site mutation.

2. A specific primer for detecting the g.393939397619C > A mutant of the breast cancer related gene ERBB2 as claimed in claim 1, wherein the specific primer comprises: the sequence of the upstream primer of the specific primer is shown as SEQ ID NO. 3, the sequence of the downstream primer is shown as SEQ ID NO. 4, and the specific primer is used for detecting the g.39393939739C > A mutation of the ERBB2 gene site; the ERBB2 gene site g.3939393939739C > A mutation means that the mutation site is A in the mutation of the 205 th base C of SEQ ID NO. 1 sequence.