CN110354279A - Application of the tumor suppressor gene ZCCHC10 in pulmonary cancer diagnosis and Index for diagnosis and therapeutic agent - Google Patents
Application of the tumor suppressor gene ZCCHC10 in pulmonary cancer diagnosis and Index for diagnosis and therapeutic agent Download PDFInfo
- Publication number
- CN110354279A CN110354279A CN201810309239.5A CN201810309239A CN110354279A CN 110354279 A CN110354279 A CN 110354279A CN 201810309239 A CN201810309239 A CN 201810309239A CN 110354279 A CN110354279 A CN 110354279A
- Authority
- CN
- China
- Prior art keywords
- zcchc10
- gene
- diagnosis
- cell
- drug
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57423—Specifically defined cancers of lung
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Public Health (AREA)
- Oncology (AREA)
- Food Science & Technology (AREA)
- Hospice & Palliative Care (AREA)
- General Physics & Mathematics (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Epidemiology (AREA)
Abstract
The invention discloses the applications of the protein of new a tumor suppressor gene ZCCHC10 gene and its coding, and in particular to application of the albumen of ZCCHC10 gene and/or its coding in the drug of preparation anti-lung cancer and/or the drug of raising lung cancer chemotherapy sensibility；Application of the kit and method of the mRNA or protein level that detect ZCCHC10 gene in the drug of lung cancer auxiliary diagnosis and/or Index for diagnosis.The research of the invention finds that ZCCHC10 gene is a kind of new tumor suppressor gene, especially plays a significant role during the occurrence and development of lung cancer, provide novel targets and new method for the diagnosis of cancer, Index for diagnosis, treatment and drug screening.
Description
Technical field
The invention belongs to the treatment technology fields of tumour, and in particular to new a tumor suppressor gene ZCCHC10 and its coding
The application of albumen.
Background technique
Lung cancer is to one of human health and the maximum malignant tumour of life threat.Male lung cancer morbidity and mortality
First of all malignant tumours is accounted for, lung cancer morbidity rate and the death rate also account for second in women.Lung cancer can be divided into small
Cell lung cancer and non-small cell lung cancer, wherein non-small cell lung cancer accounts for 85% of lung cancer or so.Lung Small Cell Lung Cancer has and can be divided into lung
Gland cancer, lung squamous cancer and maxicell lung cancer.
Cancer is the disease of malignancy caused by normal cell growth and proliferation out of control, and leads to this normal life
The reason of long and proliferation out of control, be on the one hand the activation and overexpression of proto-oncogene, be on the other hand tumor suppressor gene (also known as
For tumor suppressor gene) inactivation and expression deletion.Tumor suppressor gene is a kind of Inhibit proliferaton, promotes differentiation, mature, aging or withers
The gene died can lead to generation, the development of cell deterioration and cancer when its inactivation or expression deletion.Therefore, to tumor suppressor gene
Further investigation can provide theoretical foundation for the prevention of cancer, diagnosis, treatment and Index for diagnosis, mentioned for the exploitation of anticancer drug
For target spot.Presently found tumor suppressor gene has more than ten, such as RB1, p53, BRAC1/2, APC etc..According to statistics, about 50% people
There is p53 mutation in class cancer.Even if at those, there is no in the cancer of p53 gene mutation, p53 function is often
Due to other factors (e.g., the overexpression of p53 negative regulatory factor, the positive regulatory factor of p53 missing) influence and inactivate.At present
Have the drug for being intended to restore p53 activity or expressing and enters clinical test.ZCCHC10 is that Stelzl et al. (2005) passes through at first
The albumen that may be interacted with p53 that extensive yeast-two hybrid technique screens.We show early-stage study
ZCCHC10 albumen by with p53 interact promote p53 transcriptional activity (Sun Wei, Hunan Normal University's Master's thesis,
2010), inhibit the proliferation (Zhuo Yiming, Hunan Normal University's Master's thesis, 2013) of cervical cancer cell HeLa.But it is related
Expression, function and its relationship with cancer patient prognosis of the ZCCHC10 gene in the cancers such as lung cancer, there is not been reported.
Summary of the invention
The purpose of the present invention is to provide a kind of new tumor suppressor genes in pulmonary cancer diagnosis, Index for diagnosis and therapeutic agent
Using.
To achieve the above object, the present invention is to be achieved through the following technical solutions.
The present invention has found lung cancer by the analysis of the detection of human lung cancer tissue samples and cancer expression and life cycle database
The expression of ZCCHC10 gene is substantially less than Carcinoma side normal tissue in tissue；In cancerous lung tissue the expression of ZCCHC10 gene with
The prognosis of patient is closely related, and the overall survival of the high patients with lung cancer of ZCCHC10 gene expression dose in cancerous tissue is in progress for the first time
Survival rate, which is all higher than, after survival rate and progress expresses low patient.
The present invention experiments prove that, ZCCHC10 expression deletion lung cancer cell line (A549 and H460) in restore
The expression of ZCCHC10 gene, can inhibit cancer cell multiplication, Clone formation, cancer cell migration and invasion, and to improve lung cancer thin
Sensibility of the born of the same parents to chemotherapeutic drugs Cisplatin.
Invention further discloses the mechanism of tumor suppressor of ZCCHC10, one of mechanism is that ZCCHC10 passes through activation tumour
Inhibiting factor p53 albumen and play cancer suppressing action.
According to result above, the present invention confirms that ZCCHC10 is a tumor suppressor gene for the first time, finds that ZCCHC10 can make for the first time
For the target of the molecular labeling and lung cancer therapy drug of pulmonary cancer diagnosis and Index for diagnosis.
Present aspect provides the albumen of ZCCHC10 gene and/or its coding in preparation treatment and/or enhancing chemosensitivity
Drug in application.It is characterized in that, the drug is for expressing the lung carcinoma cell or group lowering or lack in ZCCHC10
It knits the middle expression for restoring ZCCHC10 gene and reaches treatment and/or enhancingization by inhibiting tumor cell proliferation, migration and invasion
Treat the effect of sensibility.
The present invention provides a kind of for pulmonary cancer diagnosis and/or the Real_time quantitative detection kit and method of Index for diagnosis,
It is characterized in that, it includes at least the primer of a pair of of specific amplification ZCCHC10 gene, primer sequence is
CCGGAGACAAGCTGAAGCAAATA (upstream primer), GGTTTCTCCAATGCTTTGTTGC (downstream primer).
The present invention provides a kind of detection of immunohistochemistry or immunoblotting for pulmonary cancer diagnosis and/or Index for diagnosis examinations
Agent box and method, which is characterized in that it includes at least the antibody of specific recognition ZCCHC10 albumen.
The present invention provides the kit and method of a kind of antibody for preparing specific recognition ZCCHC10 albumen, features
It is, it includes at least a small peptide containing 15 amino acid residues, and sequence is for IARRQAEANKQHVRC, the small peptide
It has been coupled to KLH (hemocyanin), on BSA (bovine serum albumin(BSA)) or OVA (chicken ovalbumin).
In conclusion inventor has found that ZCCHC10 gene is a new tumor suppressor gene, which can inhibit lung cancer thin
Growth, migration and the invasion of born of the same parents improve lung carcinoma cell to the sensibility of chemotherapeutic drugs Cisplatin.Inventor also found in cancerous lung tissue
ZCCHC10 gene expression dose can be used as a pulmonary cancer diagnosis and prognostic indicator, and ZCCHC10 gene expression missing or reduction are pre-
Show patient's poor prognosis.
Detailed description of the invention
ZCCHC10, which expresses high patients overall survival and leads, in Figure 1A display cancerous lung tissue is higher than the low patient of expression.
Figure 1B shows in cancerous lung tissue that ZCCHC10 expresses the high patient survival rate that is in progress for the first time and is higher than and expresses low patient.
Survival rate is higher than the low patient of expression after ZCCHC10 expresses high patient progress in Fig. 1 C display cancerous lung tissue.
ZCCHC10 protein expression missing in Fig. 2A display lung cell A549, H460 and endometrial carcinoma cell HeLa.
Fig. 2 B shows that the ZCCHC10 albumen of cancerous lung tissue (T) is lower than cancer beside organism (N) (except No. 5 samples).
Fig. 2 C shows in 31 pairs of lung cancer samples (including 23 pairs of gland cancer and 8 pairs of squamous carcinomas) that cancerous tissue ZCCHC10 albumen is put down
It is horizontal to be substantially less than corresponding cancer beside organism.
Fig. 2 D shows in 23 pairs of adenocarcinoma of lung samples that the average level of cancerous tissue ZCCHC10 albumen is substantially less than corresponding cancer
Side tissue.
Fig. 2 E shows in 8 pairs of lung squamous cancer cancer samples, the average level of cancerous tissue ZCCHC10 albumen and group by corresponding cancer
It is not significant to knit middle ZCCHC10 protein level difference.
Fig. 3 shows that ZCCHC10 is overexpressed slow virus and can effectively infect lung cell A549 and H460, and can high efficient expression
ZCCHC10 albumen.Mock indicates that the cell not handled, Vec indicate to have infected the stable cell line of empty carrier slow virus in figure,
Zh10 indicates to have infected the stable cell line that ZCCHC10 is overexpressed slow virus.It is the same below.
Fig. 4 is shown in overexpression ZCCHC10 in lung cell A549 and H460 and significantly inhibits cell Proliferation.
Fig. 5 is shown in overexpression ZCCHC10 in lung cell A549 and H460 cell and significantly inhibits cell clonal formation.
Fig. 5 A is the representative diagram of cell clone, and Fig. 5 B is the result that 3 time clonings form experiment statistics analysis.
Fig. 6 is shown in and is overexpressed the migration that ZCCHC10 significantly affects cell in lung cell A549 or H460 cell.Figure
6A is the representative diagram of different time scratch healing, and Fig. 6 B is the statistic analysis result of scratch experiment three times.
Fig. 7 is shown in and is overexpressed the invasion that ZCCHC10 significantly affects cell in lung cell A549 or H460 cell.Figure
7A is the representative diagram of invasion cell, and Fig. 7 B is the statistic analysis result of Matrigel three times.
Fig. 8 show is shown in lung cell A549 or H460 cell be overexpressed ZCCHC10 after, cis-platinum it is half-suppressed
Concentration (IC50) significantly reduces, and illustrates to be overexpressed the sensibility that ZCCHC10 significantly improves cell to chemotherapeutic drugs Cisplatin.
Fig. 9 A shows the increase expressed with ZCCHC10, and the level of p53 albumen also increases as.
The stability of Fig. 9 B ZCCHC10 increase p53.
Specific embodiment
Below with reference to specific embodiment and Figure of description, it is more particularly described the contents of the present invention.It should be appreciated that these
Embodiment is merely to illustrate the present invention, and the invention is not limited to the following examples.If embodiment uses without specializing
Method be technology generally in the art；If the experimental method without special noted provisos, usually routinely condition, such as " molecular cloning
Experiment guide " (fourth edition) (Green M.R, Sambrook J. writes；He Fu is elementary to be translated, Science Press, 2017) in
The condition, or according to the normal condition proposed by manufacturer.
In following example, all Starting reagents and material are commercially available, and main agents and material are as follows:
Lung cancer cell line A549 and H460, endometrial carcinoma cell HeLa, colon-cancer cell system HCT116 (p53+) and HCT116
(p53+), breast cancer cell MCF7, galactophore epithelial cell HBL100 and human embryonic kidney cells HEK293 etc. are public from U.S. ATCC
Department, condition of culture press the condition of culture culture that ATCC recommends.The cancer beside organism of the primary cancerous lung tissue of 31 people and pairing has Central-South
Refined two hospital in university Hunan provides.
Organization chip is purchased from US Biomax company.DNA primer is synthesized in Shanghai Sangon Biotech Company, Peptide systhesis and KLH coupling
It is carried out in Shanghai Tao Pu biotech firm.Slow virus is packaged in the progress of Ji Kai company.
Trizol reagent, Lipofectamine 2000 are purchased from Invitrogen company.Taq archaeal dna polymerase, dNTP and
Reverse transcription reagent box (PrimeScript RT reagent Kit with gDNA Eraser) is purchased from TaKaRa company.Limit
Property restriction endonuclease processed is purchased from Thermo Fisher company.Cis-platinum is purchased from Sigma company.Other common biological chemical reagents are purchased from
Shanghai Sangon Biotech Company.
The correlation analysis of the mRNA expression and prognosis of ZCCHC10 gene in 1 tumor tissues of embodiment
1. materials and methods
Choose 8 comprising cancerous lung tissue gene expression data and patients clinical data database (GEO database accession number:
GSE19188, GSE29013, GSE30219, GES31210, GSE3141, GSE37745, GSE50081), according to
Patient is divided into two groups (ZCCHC10 high, ZCCHC10 are low) by expression of the ZCCHC10 gene in each database, and
Using Kaplan Meier Plotter online software (http://kmplot.com) to 1145 patients in these databases
The mRNA expression of ZCCHC10 gene and patient analyze life cycle in cancerous lung tissue, and the behaviour of the website is pressed in concrete operations
Make guide progress.
2. result
Analysis the result shows that, the overall survival (overall of ZCCHC10 gene expression dose and patient in cancerous lung tissue
Survival, OS) (Figure 1A), survival rate after being in progress survival rate (first progression, FP) (Figure 1B) and be in progress for the first time
(post-progression survival, PPS) (Fig. 1 C) significant correlation.ZCCHC10 gene expression water in cancerous lung tissue
The high patient patient good prognosis lower than expressing is equalled, the high patient of ZCCHC10 gene expression dose is lower than expressing in cancerous lung tissue
Patient have higher overall survival (Hazard ratio=0.67, p=0.0000029), for the first time be in progress survival rate (Hazard ratio=0.71, p=
0.011) and progress after survival rate (Hazard ratio=0.57, p=0.011) (Fig. 1)
3. conclusion: the expression of ZCCHC10 gene can be used as a diagnosis and prognostic indicator in cancerous lung tissue.
The detection of mRNA expression in 2 tumor tissues of embodiment
1. the preservation of tissue
Operation excision or the tissue for puncturing acquisition are put into cryopreservation tube, are then placed in liquid nitrogen cryopreservation or RNA Sample preservation liquid is added
It is saved.RNA reports liquid storage, such as the RNA later of QIAGEN company, the RNAstore Sample preservation liquid of Tiangeng company, JaRa
The RNAfixer etc. of company.It is a kind of water phase, nontoxic tissue preserration liquid, can rapidly permeate into the born of the same parents of fresh tissue cells
In slurry, RNA enzyme in rapid inactivation histocyte protects intracellular RNA.
2. RNA is extracted
1) group, frozen is woven in liquid nitrogen to be fully ground in liquid nitrogen, and it is mixed that suitable Trizol reagent (50-100mg/mL) is added
It is even.Flesh tissue is then added after Trizol reagent (50-100mg/ml) and carries out homogenized with Syrup-homogenizing instrument.2) sample will, be homogenized
Product are placed 5 minutes at room temperature after acutely shaking.3) 1/5 volume of chloroform, is added in Xiang Shangshu lysate.Cover tightly centrifuge tube
Lid, acutely shakes 15sec, is stored at room temperature 2-3min.4), 4 DEG C, 12000g is centrifuged 10-15min.5) it is carefully drawn after, being centrifuged
1/2 volume isopropanol is added into new centrifuge tube in upper strata aqueous phase.10min is placed at room temperature for after being mixed by inversion.6), 4 DEG C, 12000g
It is centrifuged 10min.It carefully discards supernatant, isometric 75% ethyl alcohol (preparation of DEPC water) is added.Be vortexed sufficiently washing, and flicks pipe
Bottom allows precipitating to suspend.7), 4 DEG C, 7500g is centrifuged 5min, abandons supernatant, is careful not to lose RNA precipitate.8), room temperature is put
It sets and is air-dried 5-10min.30-100 μ L is added and dissolves RNA without RNase water, until completely dissolved, takes a small amount of detection RNA complete
Whole property and purity, -70 DEG C of remaining solution preservations.
3. reverse transcription synthesizes cDNA
It is inverted using the PrimeScript RT reagent Kit with gDNA Eraser kit of TaKaRa company
Record.Operating procedure is as follows: (1): taking 2 μ g total serum IgEs, 2 μ L 5x gDNA Eraser Buffer, 1 μ L gDNA are added
Eraser, RNase free dH2O polishing to total system are 10ul, 42 DEG C of water-baths, 2 minutes removing gDNA.(2) above-mentioned reaction solution
4 μ L 5x Primescript Buffer, 1 μ L Primescript RT Enzyme Mix, 4 μ L RT of middle addition
Primer Mix, RNase free dH2O polishing to 20 μ L, 37 DEG C water-bath 15 minutes, 85 DEG C 5 seconds, -20 DEG C of preservation cDNA
It is spare.
4. design of primers and synthesis
Using online freeware Primer-BLAST(https: //www.ncbi.nlm.nih.gov/tools/primer-
Blast it) is designed.Since there are two isomers, long isomers (ZCCHC10-L, 192 amino for ZCCHC10 albumen
Sour residue) and short isomers (ZCCHC10-S, 170 amino acid residues, the protein isomer in ncbi database
Accession number is NP_060135, and the mRNA accession number for encoding the isomers is NM_017665), and our research indicate that mainly
Short isomers plays cancer suppressing action, therefore I designs the mRNA(GenBank accession number of specific amplification ZCCHC10-S: NM_
017665) primer.ZCCHC10 primer sequence is as follows: CCGGAGACAAGCTGAAGCAAATA (upstream primer),
GGTTTCTCCAATGCTTTGTTGC (downstream primer).
The primer sequence of internal reference GAPDH are as follows: GGAGCGAGATCCCTCCAAAAT (upstream primer),
GGCTGTTGTCATACTTCTCATGG (downstream primer).
5. real-time quantitative PCR
Using TaKaRa company SYBR Green PCR kit for fluorescence quantitative, it is carried out according to kit specification operation.Reaction
System are as follows: 5 μ L 2x SYBR Green, upstream and downstream primer each 0.5 μ L, ROXI 0.2 μ L, cDNA 1 μ L, ddH2O
2.8ul, total system are 10 μ L.Reaction condition: 95 degree initial denaturation 2 minutes, then carry out 40 circular responses, each reaction
Including 95 DEG C of 10 s, 60 DEG C of 1 min.PCR instrument be Applied Biosystems company thermal cycler (model: 7500),
Three parallel repetitions are arranged in each sample, are loaded onto 384 orifice plates.Operation and interpretation of result are carried out by instrument specification.
The preparation of the rabbit polyclonal antibody of 3 people's ZCCHC10 albumen of embodiment
1. the design and synthesis of antigen sequence
Since there are two isomers, a long isomers (ZCCHC10-L, 192 amino acid residues) and one for ZCCHC10 albumen
A short isomers (ZCCHC10-S, 170 amino acid residues), and our research indicate that mainly short isomers plays suppression
Cancer effect, therefore, we go out the antigen of specific recognition ZCCHC10-S albumen using DNAstar software design, and sequence is
IARRQAEANKQHVRC.In the present invention, unless stated otherwise, all ZCCHC10 are to refer to short isomers, that is,
ZCCHC10-S。
2. synthetic antigen: in Shanghai, Tao Pu biotech firm synthesizes aforementioned polypeptides and is coupled KLH(keyhole limpet
Hemacyanin) albumen, and purify.
3. immune:
Choose the new zealand rabbit of health.Every injection animal will first collect it is immune before blood sample, with for later immune blood
Sample compares.Using the subcutaneous injection method of multiple location, antigen is mixed before injection with Freund's adjuvant, is placed in and is visited on ice with ultrasound
Head emulsification.Initial immunity, every rabbit injects 0.5 mg antigen (adding Freund's complete adjuvant), then laggard at 14,35,56 days respectively
Row booster immunization three times, every rabbit injects 0.5 mg antigen (adding incomplete Freund's adjuvant) when booster immunization.
4. putting to death immune rabbit after initial immunity 70 days, and collect serum.Using antigen affinity purification method into
The purifying of row antiserum.
The immune-blotting method of 4 ZCCHC10 albumen of embodiment
1. protein extraction in tissue
Cutting tissue, be added appropriate RIPA buffer (per gram of tissue adds 3 mL RIPA) under the conditions of 4 DEG C with tissue homogenizer into
Row homogenate, until sufficiently cracking.After cracking, 10000-14000g is centrifuged 3-5 minutes, takes supernatant, as protein solution.
RIPA cracks formula of liquid: NaCl 7.5ml, the SDS 0.2g, TritonX-100 of the Tris-HCl 10ml, 4M of 1M pH 7.2
2ml, the PMSF 2ml of NaTDC 2g, 0.1M, adds water constant volume to 200 mL.
2. measuring protein concentration using Coomassie blue or BSA method.80u g albumen is therefrom taken, is added on appropriate 6 × SDS
Sample buffer, 105 DEG C of 5 min of denaturation.
3. the PAGE gel of preparation 10%.
4. prerunning: using 8mA electric current prerunning 30-45min before loading.
5. electrophoresis: by the albumen loading after denaturation, carrying out sds polyacrylamide gel electrophoresis (SDS-PAGE) under current stabilization
2-3h, sample can appropriate high currents after running to lower layer's glue.
6. transferring film: pvdf membrane being soaked in 1 min in methanol in advance, is then moved in transfering buffering liquid, is then pressed from both sides by transferring film
White anode above, is successively put sponge, filter paper, pvdf membrane, gel, filter paper, sponge, black cathode bottom wherein, is placed in
On ice, 90v, 300mA work 70min.
7. closing: with the TBS close membrane 45-60min for containing 5% skimmed milk power.
8. incubating primary antibody: resisting ZCCHC10 more by the ratio of 1:500 and be diluted in TBS, film is placed in one, is incubated at 4 DEG C
Overnight or 3 ~ 4h of room temperature is educated, washes film three times with TTBS later, it is every all over 10 min.
9. incubating secondary antibody: in TBS, film is placed in one by 1:2000 dilution proportion for secondary antibody goat-anti rabbit, combines 1 ~ 2 at room temperature
H washes film three times with TTBS later, every all over 10 min.
10. being developed with ECL developer solution (Amersham company), and (e.g., with chemiluminescence scanner method in darkroom
The LAS-3000 of FUJIFILM company) instrument scanning, take pictures.
11. using ImageJ software to the carry out gray analysis of Western blot result, and with EXCEL software to every
A sample ZCCHC10 expression quantity (relative to its internal reference ACTB) is for statistical analysis.
12. as the result is shown:
1), ZCCHC10 protein expression missing (Fig. 2A) in display lung cell A549, H460 and endometrial carcinoma cell HeLa.
2), the ZCCHC10 albumen of cancerous lung tissue (T) is lower than cancer beside organism (N) (except No. 5 samples) (Fig. 2 B).
3), in 31 pairs of lung cancer samples (including 23 pairs of gland cancer and 8 pairs of squamous carcinomas), the average level of cancerous tissue ZCCHC10 albumen
Substantially less than corresponding cancer beside organism (Fig. 2 C)；In 23 pairs of adenocarcinoma of lung samples, the average water head up display of cancerous tissue ZCCHC10 albumen
It writes and is lower than corresponding cancer beside organism (Fig. 2 D)；In 8 pairs of lung squamous cancer cancer samples, the average level and phase of cancerous tissue ZCCHC10 albumen
ZCCHC10 protein level difference is not significant (Fig. 2 E) in the cancer beside organism answered.
4) cancerous lung tissue and its cancer beside organism sample analysis of the present invention to 31 patients, the results showed that ZCCHC10 albumen
Expression and Gender, age, differentiation and TNM stage, tumor size there is no a significant correlation, but with the significant phase of Lung Cancer Types
It closes (p=0.049) (table 1).
Relationship between 1 ZCCHC10 protein expression level of table and pathological features in lung carcinoma
P < 0.05 a Chi-square Test *.
The immunohistochemistry of ZCCHC10 protein level in 5 tumor tissues of embodiment detects
1. paraffin section is placed in 60 DEG C of baking ovens and bakes 2 hours, dewaxing to water.
2. a certain amount of 1mM Tris-EDTA (PH8.0) buffer is added in solution tank, microwave heating to boiling.It will
Histotomy after dewaxing aquation is put into the buffer to have boiled together with glass frame, microwave treatment 10 minutes, takes out microwave box
It is cooled to room temperature, is washed 3 times, every time 5 minutes with PBS buffer solution.
3. slice plus 1 3% H202- methanol of drop, close endogenous peroxydase, room temperature 10 minutes, then PBS was slow
Fliud flushing is washed 2 times, is washed every time 5 minutes.
4. every slice plus 1 drop ZCCHC10 rabbit polyclonal antibody (1:50), 4 DEG C of refrigerator overnights.
5. being washed 3 times, every time 5 minutes with 0.1%Tween-20 PBS.
6. the goat-anti rabbit secondary antibody of HRP coupling is added dropwise, it is incubated for 20 minutes at room temperature.
7. being washed 3 times, every time 5 minutes with 0.1%Tween-20 PBS.
8. enzyme mark anti-rabbit polymer is added dropwise, it is incubated at room temperature 30 minutes.
9. being washed 3 times, every time 5 minutes with 0.1%Tween-20 PBS.
10.DAB develops the color 5 minutes, distillation washing color development stopping.
11. indigo plant is returned in sufficiently washing after haematoxylin is redyed, washed, breaking up.12.
12. conventional be dehydrated transparent, neutral gum mounting.
13. observing under the microscope, be judged to according to cell colored intensity: it is not colored be negative (-), light brown be weak
Positive (+), brown be positive (++), sepia be strong positive (+++)；Can be divided into according to positive cell quantity: (+) refers to sun
For property cell number 25% hereinafter, (++) refers to positive cell number between 25%-49%, (+++) refers to positive cell number 50% or more.Most
The tinctorial strength result that Comprehensive Evaluation obtains qualitative sxemiquantitative is carried out according to the result of the two afterwards.
The building of 6 gene coding region ZCCHC10 of embodiment clone and expression vector
Test below, the recycling including DNA in RNA extraction, cDNA synthesis, PCR amplification, agarose gel electrophoresis, gel with it is pure
" Molecular Cloning:A Laboratory guide " (fourth edition) (Green M.R, Sambrook is pressed in change, digestion, connection, conversion and screening etc.
J. it writes；He Fu is elementary to be translated, Science Press, 2017).Operating process is as follows:
1. design of primers and synthesis
Using using online freeware Primer-BLAST(https: //www.ncbi.nlm.nih.gov/tools/
Primer-blast it) is designed, and the 5 '-end addition EcoRI and Kpn restriction enzyme sites in upstream primer and downstream and guarantor respectively
Protect base.ZCCHC10 encodes zone amplication primer sequence are as follows: 5 '-AAAGAATTCAGATGGCGACTCCCATGC-3 ' (draw upstream
Object), ZCCHC10-CDS-R: 5 '-AAAGGTACCCAGTCCAATATGAATGGAGCAA-3 ' (downstream primer).Primer is upper
After the synthesis of Hai Shenggong company, primer is dissolved to 10 μm of ol/L of final concentration.
2. being expanded using the cDNA of people as template using above-mentioned primer.By following component preparation PCR reaction solution: 2.5
10 ' PCR buffer of mL, 2 mL dNTP mixed liquors (each 2.5mmol/L), 1 mL forward primer (10 mmol/L), 1 mL is anti-
To primer (10 mmol/L), 1-2 mL cDNA, 0.13 mL Taq archaeal dna polymerase (5 unit/mL) adds sterilizing double deoxidation
Water is to 25mL.PCR reaction system are as follows: PCR amplification condition are as follows: 95 DEG C of initial denaturation 2min then carry out 35 and recycle (94 DEG C
45s, 58 DEG C of 30s, 72 DEG C of 1min), last 72 DEG C of extensions 10min.
3, after reaction, by PCR product on 1.5% agarose gel containing ethidium bromide electrophoresis, when bromophenol blue migrate to
Glue length 3/4 when, take out glue PCR product is observed on uv analyzer.PCR product should be single band, and molecular weight is big
Small about 520 bp.
4. being observed under ultraviolet transilluminator and cutting target DNA band.Target DNA is purified using gel purification kit, is used
Restriction enzyme EcoRI and KpnI are digested and are recycled and purify DNA.
5. by above-mentioned recycling and the DNA fragmentation purified and the expression vector pCMV-Myc(carrier use in advance EcoRI and
KpnI linearisation) connection.
6. connection product converts bacillus coli DH 5 alpha, and is cultivated in LB solid medium with ampicillin
Overnight.
7. picking single colonie, is cultivated in LB liquid medium, and extract plasmid and carry out digestion identification, with restricted interior
EcoRI and KpnI digestion is cut, digestion products should be two bands, and size is 0.52kb and 3.8 kb respectively.
8. digestion is identified that correct plasmid send Shanghai Sangon Biotech Company to be sequenced.Sequencing result shows that the code area ZCCHC10 contains
There are 513 nucleotide, infers that it encodes 170 amino acid according to nucleotide sequence.
Growth, Clone formation, migration and the invasion of 7 ZCCHC10 gene of embodiment inhibition lung carcinoma cell
1. the foundation of stable cell line
Using ZCCHC10 expression vector in embodiment as template, the coding region sequence of ZCCHC10 is subcloned into slow virus carrier
The Shanghai GV166(Ji Kai company) in, and entrust and carry out lentiviral particle packaging in Shanghai Ji Kai genome company.It will expression
ZCCHC10 gene lentiviral particle and empty carrier virion infect lung cancer cell line H460 and A549 respectively.Slow-virus infection
It is carried out according to the operation manual of company.Screening stable cell line is carried out with puromycin after infection 3-4 days.Harvest a part of cell
Albumen is extracted, the expression of detection ZCCHC10 albumen is tested using Western blot.The result shows that ZCCHC10 gene energy
Effectively expressing (Fig. 3) is tested as follows using H460 the and A549 cell for stablizing expression ZCCHC10 of building.
2. cell growth assay
Then experiment the previous day was uniformly passed to cell in 96 orifice plates, 5000/hole with serum free medium culture 24 hours,
Every group is done 5 repetitions, sets 37 DEG C of cultures, 24 hours measurement MTT values in CO2 incubator.Measuring method is as follows: the MTT of 10ul is added
Into each hole, 4h is cultivated, the culture medium in every hole is carefully sucked, pay attention to the crystallization for not being drawn onto bottom, 100 μ L are added in every hole
Orifice plate is placed in 10 min of low-speed oscillation on shaking table, dissolves crystalline solid sufficiently, with 490nm wavelength by DMSO (dimethyl sulfoxide)
Under ultraviolet specrophotometer measure the OD value in each hole.Culture plate is put into incubator culture, is taken out every hour for 24 hours and surveys one
Secondary MTT value.It is respectively longitudinal and transverse axis with light absorption value and time, draws cell Proliferation Dynamic Curve figure.
2. scratch experiment
Experiment the previous day bed board, the cell that logarithmic phase is grown uniformly is passed in 12 orifice plates, 50000/hole, is set in CO2 incubator
37 DEG C of overnight incubations.Cell scratch is manufactured perpendicular to orifice plate with 100 μ L pipette tips, guarantees that each scratch width is consistent as far as possible, each
Orifice plate draws 3 scars, is then divided into six regions with a perpendicular scar, and last each hole forms " rich " font scar.
The culture medium for sucking cell rinses cell fragment 2 times that orifice plate washes away scratch generation with PBS, changes serum-free, antibiotic-free
Culture solution.It photographs to record under the microscope.Culture plate is put into incubator culture, is taken out every hour for 24 hours, in same position
Scar width is taken pictures.Experimental result is analyzed according to the image data taken pictures.
3. colony formation
Experiment the previous day carries out bed board, the cell that logarithmic phase is grown uniformly is passed in 6 orifice plates, 1000, every hole cell is simultaneously
And every group is done 3-4 repetition, is uniformly dispersed.It every 3-4 days replacement fresh cultures, is placed in incubator after cultivating 14 days, uses
PBS is washed twice, is then fixed with methanol, is dyed after fixed with Jim Sa.It is counted under low-powered microscope and is greater than 30
Clone's number of a cell, takes pictures.
4. Transwell Matrigel
It can first allow cell to remove serum starvation 12-24 h before preparing cell suspension, further remove the influence of serum.Vitellophag,
Centrifugation discards culture solution after terminating digestion, is washed 1-2 times with PBS, is resuspended with the serum free medium containing BSA.Cell is passed to
The invasion of Corning company are small indoor (being covered with 8.0 μm of PET film, product article No. 354480 in advance).Each small ventricular cell
Density about 50000 (since different cell invasion abilities are different, cell density makees corresponding adjustment when specific experiment).It wears
The cell for crossing film is dyed with Giemsa, is observed and is taken pictures setting microscope.
5. result
ZCCHC10 gene significantly inhibits growth (Fig. 4), Clone formation (Fig. 5), the migration (Fig. 6) of lung cell A549 and H460
With invasion (Fig. 7).
Sensibility of the 8 ZCCHC10 genes amplification lung carcinoma cell of embodiment to chemotherapeutics
1. the foundation of stable cell line
With embodiment 7.
2. drug-treated and MTT measurement
Then experiment the previous day was uniformly passed to cell in 96 orifice plates, 5000/hole with serum free medium culture 24 hours,
With the cis-platinum (0,2.5,5,10,20,50 μm of ol/L) of various concentration, every group is done 5 repetitions.With setting 37 in CO2 incubator
DEG C culture 24 hours measurement MTT values.The same embodiment of measuring method.
3. calculating IC50 using EXCEL software.
4. the result shows that in lung cell A549 or H460 cell be overexpressed ZCCHC10 after, cis-platinum it is half-suppressed
Concentration (IC50) significantly reduces, and illustrates to be overexpressed the sensibility (Fig. 8) that ZCCHC10 significantly improves cell to chemotherapeutic drugs Cisplatin.
The stability of 9 ZCCHC10 of embodiment enhancing p53 albumen
1, cell culture and transfection
HeLa cell is passed on 12 well culture plates and is cultivated.Condition of culture is 90% DMEM culture medium (GIBCO company), and 10% is excellent
Matter fetal calf serum is cultivated in carbon dioxide (5%) incubator, and temperature is 37 DEG C.The cell transfecting recommended by ATCC: to thin
Born of the same parents it is long to 70%-80% when, complete medium is changed into serum free medium, Nature enemy is carried out to cell, according to transfection reagent
The detail specifications of Lipo 2000 is transfected by step, is changed within 4-6 hours complete medium into after having transfected and is continued to cultivate.
2, protein lysate and measurement protein concentration are extracted.
Cell is harvested, 100 μ L RIPA lysates and 1 μ L 100x Cocktail protease are added in each culture hole
Inhibitor mixes well.Be placed on ice crack 2 hours or so, multigelation 3 times, ultrasonication 50 seconds, 12000 turns of low temperature from
The heart takes supernatant after ten minutes.Bradford method surveys protein concentration.
3, electrophoresis and immunoblot experiment (Western blot) are carried out by embodiment 4
4, result
1), influence of the ZCCHC10 to p53 protein expression level
By the HA-p53 plasmid of equivalent and different amounts of Myc-CCDC106 plasmid co-transfection HeLa cell.24 harvest after transfection
Cell simultaneously carries out Western blot experiment.The result shows that: with the increase of Myc-CCDC106 plasmid amount, transfection HeLa cell
Afterwards, the expression of p53 also decreases, and the expression of internal reference β-actin does not change, and shows that CCDC106 can be mentioned significantly
The expression (Fig. 9 A) of high p53 albumen.
2) influence of the ZCCHC10 to p53 protein stability
In order to further prove whether reducing for p53 expression is to promote caused by the degradation of p53 because of ZCCHC10, we
The half-life experiments of protein degradation have been done again.HA-p53 plasmid is unloaded with Myc-CCDC106 plasmid and pCMV-Myc respectively
Body transfection HeLa cell, after transfection 12 hours, when cell handles different respectively with the cycloheximide (CHX) that concentration is 50 μ g/mL
Between, it then harvests cell and carries out Western blot experiment.The result shows that: the degradation of p53 albumen is bright after transfection CCDC106
It is aobvious to weaken (Fig. 9 B).
Sequence table
<110>Hunan Normal University
<120>application of the tumor suppressor gene ZCCHC10 in pulmonary cancer diagnosis and Index for diagnosis and therapeutic agent
<141> 2018-04-09
<160> 3
<170> SIPOSequenceListing 1.0
<210> 2
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ccggagacaa gctgaagcaa ata 23
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ggtttctcca atgctttgtt gc 22
<210> 3
<211> 15
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 3
Ile Ala Arg Arg Gln Ala Glu Ala Asn Lys Gln His Val Arg Cys
1 5 10 15
Claims (10)
- Application of the 1.ZCCHC10 gene in the drug of preparation anti-lung cancer.
- Application of the 2.ZCCHC10 gene in the drug that preparation improves lung cancer chemotherapy sensibility.
- 3. such as the described in any item applications of claim 1 and 2, which is characterized in that the drug is in the case where ZCCHC10 is expressed The expression for restoring ZCCHC10 gene in the lung carcinoma cell or tissue adjusted or lacked by inhibition tumor cell proliferation, is migrated and is invaded It attacks, has the function that treatment and/or enhancing chemosensitivity.
- 4. such as the described in any item applications of claim 1 and 2, which is characterized in that the drug at least contain ZCCHC10 gene and/ Or the albumen of its coding.
- 5. application as claimed in claim 2, which is characterized in that the drug that the drug and chemotherapy drugs in combination uses.
- 6. application as claimed in claim 4, the ZCCHC10 gene is contained in carrier for expression of eukaryon (plasmid vector, slow disease Poisonous carrier or adenovirus vector) in.
- The albumen of 7.ZCCHC10 gene and/or its coding is in the auxiliary diagnosis of preparation lung cancer and/or Index for diagnosis kit Using.
- 8. a kind of for pulmonary cancer diagnosis and/or the Real_time quantitative detection kit of Index for diagnosis, which is characterized in that it is included at least The primer of a pair of of specific amplification ZCCHC10 gene, primer sequence are CCGGAGACAAGCTGAAGCAAATA (upstream primer), GGTTTCTCCAATGCTTTGTTGC (downstream primer).
- 9. a kind of detection kit of immunohistochemistry or immunoblotting for pulmonary cancer diagnosis and/or Index for diagnosis, feature exist In it includes at least the antibody of specific recognition ZCCHC10 albumen.
- 10. a kind of kit for the antibody for preparing specific recognition ZCCHC10 albumen, which is characterized in that it includes at least one Small peptide containing 15 amino acid residues, sequence are for IARRQAEANKQHVRC, which has been coupled to KLH (blood indigo plant egg It is white), on BSA (bovine serum albumin(BSA)) or OVA (chicken ovalbumin).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810309239.5A CN110354279A (en) | 2018-04-09 | 2018-04-09 | Application of the tumor suppressor gene ZCCHC10 in pulmonary cancer diagnosis and Index for diagnosis and therapeutic agent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810309239.5A CN110354279A (en) | 2018-04-09 | 2018-04-09 | Application of the tumor suppressor gene ZCCHC10 in pulmonary cancer diagnosis and Index for diagnosis and therapeutic agent |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110354279A true CN110354279A (en) | 2019-10-22 |
Family
ID=68213542
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810309239.5A Pending CN110354279A (en) | 2018-04-09 | 2018-04-09 | Application of the tumor suppressor gene ZCCHC10 in pulmonary cancer diagnosis and Index for diagnosis and therapeutic agent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110354279A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110702923A (en) * | 2019-11-05 | 2020-01-17 | 南通大学附属医院 | Application of GPR115 gene in preparation of anti-lung cancer medicine and diagnostic kit thereof |
| CN111455058A (en) * | 2020-05-27 | 2020-07-28 | 深圳市因诺转化医学研究院 | Tumor marker related to breast cancer tumor, application and kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1970763A (en) * | 2006-12-18 | 2007-05-30 | 北京市结核病胸部肿瘤研究所 | Shortened anti-oncogene p53 capable of increasing sensitivity of human lung cancer cell to antineoplastics |
| CN104739826A (en) * | 2015-02-13 | 2015-07-01 | 浙江大学 | Application of p53 target-based small molecular compounds in preparation of anti-tumour medicine |
-
2018
- 2018-04-09 CN CN201810309239.5A patent/CN110354279A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1970763A (en) * | 2006-12-18 | 2007-05-30 | 北京市结核病胸部肿瘤研究所 | Shortened anti-oncogene p53 capable of increasing sensitivity of human lung cancer cell to antineoplastics |
| CN104739826A (en) * | 2015-02-13 | 2015-07-01 | 浙江大学 | Application of p53 target-based small molecular compounds in preparation of anti-tumour medicine |
Non-Patent Citations (5)
| Title |
|---|
| HEGELE A等: "NCBI Reference Sequence: NM_017665.3", 《GENBANK》 * |
| YICHONG NING等: "ZCCHC10 suppresses lung cancer progression and cisplatin resistance by attenuating MDM2-mediated p53 ubiquitination and degradation", 《CELL DEATH DIS.》 * |
| 孙薇: "ZCCHC10蛋白与p53蛋白相互作用的研究", 《中国优秀硕士学位论文全文数据库》 * |
| 宁贻崇: "p53相互作用蛋白CCDC106和ZCCHC10在癌症中的作用及分子机制", 《中国博士论文全文数据库》 * |
| 王晓红等: "ｐ５３蛋白在非小细胞肺癌中表达与放化疗敏感性研究", 《中国煤炭工业医学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110702923A (en) * | 2019-11-05 | 2020-01-17 | 南通大学附属医院 | Application of GPR115 gene in preparation of anti-lung cancer medicine and diagnostic kit thereof |
| CN111455058A (en) * | 2020-05-27 | 2020-07-28 | 深圳市因诺转化医学研究院 | Tumor marker related to breast cancer tumor, application and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Knauer et al. | Nuclear export is essential for the tumor‐promoting activity of survivin | |
| KR101215069B1 (en) | A composition comprising Gastrokine 1 for anti-cancer | |
| CN110354279A (en) | Application of the tumor suppressor gene ZCCHC10 in pulmonary cancer diagnosis and Index for diagnosis and therapeutic agent | |
| CN114686461A (en) | Application of deubiquitinase USP45 in preparation of lung squamous carcinoma treatment drug | |
| CN108926713A (en) | The application of calcineurin regulatory protein 1.4 or its analog in the drug that preparation inhibits liver cancer | |
| CN106701902B (en) | Application of FOXR2 gene and expression product in diagnosis and treatment of liver cancer | |
| CN110237257B (en) | Application of Ube3a ubiquitinated PP2A activator PTPA in treatment of Angel syndrome and autism | |
| CN101768214A (en) | Human tumor marker-Tim17 polypeptide and application thereof | |
| CN105214077B (en) | Application of the USP33 in tumour | |
| Kanae et al. | Expression of the PTEN tumor suppressor gene in malignant mammary gland tumors of dogs | |
| CN113265463B (en) | Application of FAM84B in preparation of esophageal squamous carcinoma prognosis evaluation reagent and screening of drugs for targeted therapy of esophageal squamous carcinoma | |
| CN110170051A (en) | Application of the KLF12 albumen in preparation treatment non-small cell lung cancer drug | |
| CN113929764B (en) | Breast phylliform tumor molecular marker CD146 and application thereof | |
| KR101918342B1 (en) | Methods for detecting hepatitis B virus surface gene non-sense mutations | |
| CN108931633B (en) | Gallbladder cancer diagnosis and prognosis judgment marker PIM1 | |
| CN112852960A (en) | Papillary thyroid carcinoma biomarker and application thereof | |
| EP3674325A1 (en) | Fusion protein of dctn1 protein with ret protein | |
| Capponcelli et al. | Evaluation of the molecular mechanisms involved in the gain of function of a Li‐Fraumeni TP53 mutation | |
| Dong-Xiang et al. | Cyclin-dependent kinase like 3 promotes triple-negative breast cancer progression via inhibiting the p53 signaling pathway. | |
| CN106701904B (en) | Application of ACSL4 gene and expression product in diagnosis and treatment of gastric cancer | |
| CN114058699B (en) | Application of PPDPF in pancreatic cancer diagnosis and medicine preparation | |
| CN104225575B (en) | A kind of tumor suppressor gene or albumen and its application | |
| CN114042160B (en) | CTD-2256P15.2 and application of encoded micro-peptide thereof as target in development of tumor treatment drugs | |
| CN102735843A (en) | JMJD8 gene and expression product for inhibiting growth of hepatoma cells | |
| CN110656174B (en) | Specific marker closely related to occurrence and development of primary hepatocellular carcinoma and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20191022 |
|
| WD01 | Invention patent application deemed withdrawn after publication |