CN101768214A - Human tumor marker-Tim17 polypeptide and application thereof - Google Patents
Human tumor marker-Tim17 polypeptide and application thereof Download PDFInfo
- Publication number
- CN101768214A CN101768214A CN200910174168A CN200910174168A CN101768214A CN 101768214 A CN101768214 A CN 101768214A CN 200910174168 A CN200910174168 A CN 200910174168A CN 200910174168 A CN200910174168 A CN 200910174168A CN 101768214 A CN101768214 A CN 101768214A
- Authority
- CN
- China
- Prior art keywords
- tim17
- cancer
- polypeptide
- gly
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the biotechnology and medical field and relates to a novel human tumor marker-Tim17 polypeptide, a coding Tim17-polynucleotide sequence and a method for generating protein by the recombinant technology. The invention also relates to a Tim17-protein, coding sequence application thereof and a medicine composite containing Tim17-protein antagonist. Experiments show that the Tim17 polypeptide, a coding sequence thereof and an expression product with the gene almost cannot be detected in the normal cells and tissues and can be expressed highly in the tumor cells and tissues, and the expression level is in positive correlation with the level, the degree of differentiation and the prognosis of the tumor obviously. The result indicates that Tim17 is a specific tumor marker and can be used as the marker for preventing and early detecting the breast cancer, the lung cancer, the liver cancer, the intestinal cancer, the bladder cancer, the prostatic cancer or the lymphatic cancer or as the target for tumortherapy.
Description
Technical field
The invention belongs to biotechnology and medical field.Be specifically related to a kind of new human tumor marker thing-Tim17 polypeptide (translocase of inner mitochondrial membrane 17), the polynucleotide sequence of coding Tim17 and produce this proteic method through recombinant technology.The invention still further relates to the purposes of Tim17 albumen and encoding sequence thereof, as be used for the prevention of tumour, early detection, the judgement of prognosis, and the pharmaceutical composition that contains Tim17 protein antagonist (as antibody and antisense nucleic acid, RNAi etc.).
Background technology
Biomarker (biomarker) is meant can be by objective measurement, indication normal physiological or pathologic process, or body is for physics, chemistry, the Biological indicators of drug reaction.One of problem of the most critical of tumor research is sought early detection exactly, diagnosis typing, and treatment monitoring and prognosis, and as the mark of drug targets.Cell changes into the process of tumour from standard state, and a series of variations can take place the intracellular protein express spectra.Tumor markers be exactly tumour take place and evolution in, by the synthetic release of tumour cell or host a class material to tumor response release.They have certain specificity and sensitivity, can be as the monitoring index in the Clinics and Practices.
At present, being used to clinical tumor markers also quite lacks.The mark auditing standards of various countries is slightly different.China mainly still is with reference to the standard of western developed countries such as the U.S. in the tumor markers application facet.With the U.S. is example, and annual ASCO (American Society of Clinical Oncology) can propose guidance instruction to the used biomarker of clinical tumor.The mark that can be used for mammary cancer as 2007 comprises ER/PR, HER2, and uPA/PAI1 and multiparameter gene expression analysis method (Oncotype DM, MammaPrint etc.), and detailed suggestion working conditions and scope is provided.Remaining is as Ki67, Cyclin D, and Cyclin E, p27, p21, Proteomic analysis etc. are insufficient because of evidence, are not proposed use (referring to the ASCO webpage).Can see that admitting that these marks are improving patient's diagnosis, the effect while in the treatment, the sickness rate and the lethality rate of tumour patient are still in rising trend generally at present.This phenomenon requires the discovery and the clinical application of how better tumor markers.
Summary of the invention
The polypeptide SEQ ID NO:1 that the purpose of this invention is to provide a kind of new human tumor marker thing Tim17, nucleic acid (RNA) SEQ ID NO:5, and segment, analogue, derivative.
Another object of the present invention provides the above-mentioned RNA of coding, picodna sequence (DNA) the SEQ ID NO:6 of polypeptide.
Another object of the present invention provides the preparation method of above-mentioned RNA and polypeptide, and this RNA, the purposes of polypeptide and its encoding sequence.
Described RNA can produce by the mode of PCR.Specifically, can be right with the primer among the SEQ ID NO:3, by the polymerase chain reflection, obtaining sequence is the RNA product of SEQ ID NO:5.Described polypeptide can be produced by the mode of chemosynthesis.This RNA and polypeptide all can help to detect the existence of tumour.
The present invention has found the new gene that can be used as tumor markers through extensive and deep research.This expression of gene product comprises RNA SEQ ID NO:4 and Protein S EQ ID NO:2, normal cell and the tissue in almost detect less than, tumour cell and the tissue in very high expression is but arranged.And the rank of expression amount and tumour, differentiation degree, and patient's prognosis all is obvious positive correlation.Result of study shows that Tim17 is a special tumor markers.Finished the present invention on this basis.
Specifically, relatively from same patient, the breast cancer cell line of different grade malignancies has obtained a series of differential expression protein by systematically in the present invention.Timm17A is one of them new tomour specific expressed proteins.An one polypeptide, SEQ ID NO:1 is stabilized special the detecting of isotope-labeled mass spectroscopy and has the expression level that is higher than 4.8 times of normal cells in tumour.By the method for quantitative RT-PCR, the rna expression that the result shows Timm17A in the tumour is also apparently higher than the level of normal control.Simultaneously, find by antibody checking, the albumen of Tim17 (comprise A, two hypotypes of B, antibody is not distinguished this two hypotypes) also in rising trend in tumour (Figure 1A, B).Further, method by immunohistochemical methods, the present invention tests (Fig. 1 C to 43 examples tissue normal and the breast cancer tumour patient, table 1), the result shows, not seeing in the normal galactophore tissue has the proteic expression of Tim17, and then shows the expression of Tim17 in the early stage galactophore disease (Hyperplasia, cyclomastopathy); Breast cancer disease philtrum (DCIS, catheter in situ knurl) reaches peak expression in early days.Above-mentioned experimental evidence shows that Tim17 has the latent effect as the early detection markers for breast cancer.
In order to verify above-mentioned experimental result, the present invention has carried out the work that database data is excavated.Oncomine (
Www.oncomine.org) in the database, depositing the RNA micro-array chip data of massive tumor case.The present invention searches for and data preparation the Timm17A gene, and wherein, the comparative result of mammary cancer and healthy tissues shows that the expression level of Timm17A is apparently higher than normal control (Fig. 2) in the mammary cancer; In the rank of mammary cancer, in the expression correlation analysis of differentiation degree and Timm17A, shown obvious positive correlation (Fig. 3).More meaningfully, in the expression correlation analysis of patient's prognosis and Timm17A, also shown obvious positive correlation (Fig. 4); Another hypotype of while Tim17, the Timm17B gene has also shown above-mentioned these results.The above results shows that two hypotypes of Tim17 all can become the potential tumour and find (early detection), diagnosis (branch rank), the mark of prognosis.
For whether the tumour high-expression phenomenon of observing Tim17 only is confined to mammary cancer, the present invention has also carried out the similar data mining analysis to other tumours of Oncomine lane database.Result's demonstration, in lung cancer, liver cancer, intestinal cancer, bladder cancer, in the lymphatic cancer, all there is the phenomenon (Fig. 5) of high expression level in this kind tumour in prostate cancer.Analytical results confirms that Tim17 is the tumor markers of a wide spectrum.
The present invention is according to Tim17 cross expressing in tumour, and suppress its expression and whether can suppress the growth of tumor check: the shRNA at Tim17 has been synthesized in design, but and it is cloned in slow virus (lenti-viral) carrier of abduction delivering.The result shows that the expression that suppresses Tim17 can significantly suppress growth of tumor.Described result confirms that further Tim17 can be as the target of oncotherapy.
Description of drawings
The expression of Fig. 1 Tim17 in breast cancer cell line and tissue,
Wherein, A: with quantitative reverse transcription-PCR that the special primer of Tim17A carries out, the result carries out stdn with crt gene GAPDH and represents, 16N among the figure, HME are the normal breast epithelial cell, and all the other are breast cancer cell; B: detect Tim17 albumen with immune marking method in the mammary gland cell, cell identifies as A; C: detect Tim17 albumen with immunohistochemical methods in the tissue, figure is for normally, the example of carcinoma in situ and invasive carcinoma; On: normal; In: ductal carcinoma in situ; Down: invasive carcinoma.
The differential expression (data mining results) of Fig. 2 TIMM17A RNA in normal control and breast cancer tumour tissue of patient, wherein, Class 1:Normal (7 example); Class 2:Breast Carcinoma (45 example).
Fig. 3 TIMM17A expression level and mammary cancer patient prognosis are remarkable positive correlation (data mining results),
Wherein, A: data set 1, Class 1: existence (121 example), Class 2: dead (38 example); B: data set 2, Class 1: no disease (180 example), Class 2: recurrence (93 example).
Fig. 4 TIMM17A expression level is remarkable positive correlation (data mining results) with mammary cancer rank and differentiation degree,
Wherein, A: data set 1, Class 1:grade 1 (68 example), Class 2:grade 2 (126 example), Class 3:grade 3 (55 example); B: data set 2, Class 1:grade 1 (67 example), Class 2:grade 2 (128 example), Class 3:grade 3 (54 example); C: data set 3, Class 1: high differentiation (30 example), Class 2: middle differentiation (83 example), Class 3: low differentiation (83 example).
In the many tumours of Fig. 5 TIMM17A expression being arranged all, is the mark (Oncomine data analysis result) of a wide spectrum.Wherein, A: bladder cancer; B: intestinal cancer; C: liver cancer; D: lung cancer; E: prostate cancer.
Embodiment
In a first aspect of the present invention, the Tim17 polypeptide of the isolated differential expression of novelty is provided, it comprises: polypeptide or its conservative property variation polypeptide or its active polypeptide or its reactive derivative with SEQ ID NO:1 aminoacid sequence.
Embodiment 1: the Tim17 polypeptide that obtains differential expression
Separate the breast cancer cell line that obtains from a patient, comprise normal (16N), tumour (NT), and metastatic tumor (MT2) are used D
3-Leu (Cambridge Isotope company) stable isotope is cultivated the marked tumor cell.Normal and metastatic tumor cell is with containing D
0The nutrient solution of-Leu is cultivated.Protein lysate (8M urea, 2.5Mthiourea, 65mM DTT with three clones, 4% (w/v) CHAPS, 0.5% (v/v) Biolytes pH 3-10, proteaseinhibitor cocktail) extracting, quantitatively (RC DC Protein Assay Kit, Biorad company).The protein of equivalent is mixed into normally: tumor group and tumour: the metastatic tumor group, separate with the one dimension sds gel electrophoresis then.After gel was dyed, each gel strips cut into 8 similar bands of size.Each band through the decolouring, dried glue, in-gel digestion is put forward steps such as peptide, uses the liquid chromatography isolated polypeptide again.Isolated polypeptide is identified by LTQ-Orbitrap (ThermoElectron company) mass spectrograph.Identify and obtain more than 1200 proteic quantitative informations.Wherein more than 70 is confirmed as the significant difference expressed proteins.Remove known tumor markers, in the new mark of remainder, determine the significant TIMM17A of differential expression (in two hypotypes of Tim17 albumen), it is the albumen with important mitochondrial function.The polypeptide of the quantitative information that is obtained is GKEDPWNSITSGALTGAILAAR.In tumour, its expression ratio normal cell is high 4.8 times.Identify through repeatedly mass spectrum and all to obtain identical result.
In a second aspect of the present invention, the polynucleotide of the isolating described polypeptide of encoding are provided.SEQ?ID?N0：4。Embodiment 2: the full-length gene that obtains coding TIMM17A from breast cancer cell line
Total RNA with in Trizol reagent (Invitrogen company) the extraction 21T breast cancer cell line (deriving from two kinds of cells of NT or MT2) becomes cDNA with PrimeScript 1st strand cDNA Synthesis Kit (TaKaRa company) with total RNA reverse transcription.With synthetic cDNA is template, design contains TIMM17A clone gene forward primer (having removed the initiator codon ATG of former TIMM17A) the 5 '-CA GAA TTC TGG AGG AGT ACGCGC GAG-3 ' and the reverse primer 5 '-GACCTCGAGCTACTGATATTGTCGATA-3 ' of restriction enzyme site, carry out the PCR reaction with warm start Taq archaeal dna polymerase (TaKaRa company), reaction conditions is the pre-sex change of 98 degree 2 minutes, 95 degree are 10 seconds then, 55 degree annealing 15 seconds, 72 degree carried out extension in 40 seconds, reflected 30 circulations.PCR product and pcDNA3.0-HA-FLAG empty carrier are carried out EcoRI and XhoI double digestion respectively, are connected and the transformation experiment of DH5 α bacterium, obtain the positive colony of TIMM17A gene transformation, treat that dna sequencing determines that gene order obtains the pcDNA3.0-HA-FLAG-TIMM-17A carrier after errorless.
In a third aspect of the present invention, simulation, promotion, the active compound of antagonism people Tim17 are provided, and the compound that suppresses the expression of people Tim17.Preferably, this compound is people Tim17 encoding sequence or its pulsating small molecules interference RNA.Be cloned in the pLVTHM carrier pLVTHM-sTimm17A. that this carrier is gone into packing cell 293T to produce virus with the packaging plasmid corotation described small molecules shRNA.With virus infection tumour cell to be measured, find that the growth of tumour cell to be measured is obviously slowed down.
Embodiment 3:TIMM17A small molecules interference RNA suppresses growth of tumor
According to the design rule of shRNA, 23 base shRNA of three sequences of design.To wherein have the sequence clone of inhibition of gene expression effect preferably to pLVTHM (Trono laboratory, Switzerland) MluI of carrier and ClaI site.The carrier called after pLVTHM-sTimm17A that produces.In order to produce derivable shRNA express cell is that (the Trono laboratory Switzerland) changes the 293T cell over to the pLVPT-tTR/KRAB-Red carrier.Simultaneously, two package carrier PMD.G (VSV.G), CMV-DR891 is gone into the 293T cell by corotation.The 293T cell continued growth of transfection is after 48 hours, the supernatant of collecting cell.Filter and remove cell, supernatant is infected the MDA-231 breast cancer cell.Infected MDA-231 cell obtains the cell of the expressing K RAB supressor of fluorescence redly with selected by flow cytometry apoptosis after cultivating in 48 hours.Obtain the MDA-231-KRAB cell strain of stably express KRAB.With pLVTHM-sTimm17A carrier and the PMD.G (VSV.G) that makes up, CMV-DR891 package carrier corotation is gone into the 293T cell to produce the expression vector virion of shRNA.With the same method of above-mentioned generation stable cell line, with virus infection MDA-231-KRAB cell strain, can be thereby produce by the MDA-231-KRAB-sTimm17A cell strain of DOX (Sigma company) abduction delivering shRNA.Described cell is expressed shRNA under the DOX of 1 μ g/ml, suppress the TIMM17A expression of gene.
On this basis,, be inoculated in 10 holes in the 96 porocyte culture dish with the density of MDA-231-KRAB-sTimm17A cell strain with 50000/ hole.Wherein cultivate in the DOX nutrient solution is arranged in 5 holes, and cultivate in the nutrient solution of no DOX in 5 holes in addition.After 72 hours, measure cell growth condition with MTT (Sigma company) method.The result shows, the MDA-231-KRAB-sTimm17A cell that has the nutrient solution of DOX to cultivate is compared with the cell of no DOX 50% growth-inhibiting.
In a fourth aspect of the present invention, the carrier and the virus that contain above-mentioned small molecules interference RNA are provided.The production process of carrier and virus describes in detail in embodiment 3.
In a fifth aspect of the present invention, provide the method that whether has Tim17 in the test sample.It comprises: the RNA in the extracting tissue, reverse transcription becomes cDNA.Carry out quantitative pcr amplification with design synthetic primer sequence (SEQ ID NO:3).Another method that detects protein level is: the protein in the extracting tissue, carry out immune marking reaction with specific antibody.Or, to paraffin-embedded tissue, carry out the immunohistochemical methods test with specific antibody.The method that detects tumour also is provided, has comprised: sample is carried out above-mentioned quantitative PCR test, immune marking test or immunohistochemical methods test, the individuality that the result is higher than background level suffers from tumour or tumor susceptibility is higher than normal population.
Embodiment 4: the RNA of quantitative PCR detection TIMM17A
Albumen corresponding sequence and the gene order information on the NCBI website (accession number:NM 006335.1) according to mass spectrum identifies design the TIMM17A primer with primer3 software (http://frodo.wi.mit.edu/primer3/input.htm).The upstream primer sequence that obtains, from 5 ' to 3 ' be atccctggaactccatcaca, the downstream primer sequence is tgcagaggcaaatcttgtca.Make amplified production stride across No. 2 introns of genome sequence during design of primers, thereby reduce the possibility that genomic dna influences the result.The confidential reference items of quantitative PCR are the GAPDH gene.The upstream primer of used GAPDH gene is cgagatccctccaaaatcaa, and downstream primer is ttcacacccatgacgaacat.Extract total RNA with Trizol, survey concentration and the purity of RNA through spectrophotometer (260nm/280nm).Carry out reverse transcription (TaKaRa) with total RNA of 3 μ g and oligo dT primer through PrimeScript 1st strand cDNASynthesis Kit.In 25 μ l quantitative PCR reaction systems, add 75ng cDNA template, 1 * SYBR Premix Ex Taq (Perfect Real Time; TaKaRa) and the primer of each 200nM.(Bio-rad company) carries out amplified reaction with iQ5 quantitative PCR instrument.Response procedures is: 95 ℃ of initial sex change 10 seconds, and two-step approach is carried out 40 circulations, and 95 ℃, sex change in 5 seconds, 60 ℃ of annealing were extended 20 seconds.Under the relative quantification pattern, carry out the data quantitative analysis with iQ5 (Bio-Rad) v2.0 version software.Figure 1A is a result of quantitative PCR experiment.Use clone RNA, find normal cell 16N, HME expresses very low TIMM17A RNA, and tumour cell, as NT, MT2, the T47D expression amount is significantly higher than normal cell.
Embodiment 5: immunoblotting and immunohistochemical methods detect Tim17 albumen
Use the antibody (rabbit against human T IMM17A/TIMM17B antibody, PTGLAB company) of Tim17, in cell and tissue, carry out immunoblotting and immunohistochemical experiment.In immunoblotting,, transfer to then on the pvdf membrane (Amersham Bioscience company) with the about 30 μ g total proteins of 6-15% gradient SDS-PAGE gel separation.With the TBST damping fluid that contains 5%BSA (0.1%Tween 20 for 137mM NaCl, 20mM Tris-HCl pH7.6) sealing pvdf membrane, with Tim17 antibody incubated at room one hour or 4 degree overnight incubation, washing, HRP link coupled two anti-hatching.Washed film adds hypersensization luminescent solution (Amersham Bioscience) development, through the imaging of LAS-3000 imaging system (Fuji, Japan).(Fuji company, Japan) software is quantitative to the band of immunoblotting through Multi Gauge V3.0.Figure 1B is the result of immunoblot experiment in clone.The contrast of sample in Actin B antibody (mouse-anti people Actin B antibody, the PTGLAB company) composition.Experiment shows that at the normal breast epithelial cell, among 16N and the HME, Tim17 is in very low expression level, and at breast cancer cell, among NT and the MT2, the expression level of Tim17 significantly increases.
In immunohistochemical experiment, through formalin fixed and paraffin-embedded organization chip available from US Biomax company (CA, U.S.A.Catalog:TMA-BR480).Section is restored antigen through 0.01M citrate buffer (pH=6.0) poach after dewaxing and aquation.Spending night with one anti-4 of the anti-Tim17 of dilution in 1: 100 hatches.HRP polymer detection system by anti-rabbit detects the imaging of Olympus BX51 microscopic system again.Marked to dying good organization chip by two researchers, at least 10% breast epithelial cell is caught the chip of look and be can be regarded as positive chip.Data are carried out significance,statistical check P＜0.05 with Fisher Exact method.Fig. 1 C example normal, the immunohistochemical staining of ductal carcinoma in situ and invasive carcinoma.The result shows, does not express Tim17 albumen in all 5 healthy tissuess, and Tim17 albumen galactophore disease in early days the earliest has part to express in the cyclomastopathy; Reached peak expression (100% expresses 6/6 in the tumour of detection) during to the infantile tumour ductal carcinoma in situ.The result shows that Tim17 can be as the mark of mammary cancer prevention and early detection.
In a sixth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Purposes comprises with the polypeptide immune animal and obtains antibody at polypeptide, again the expression by antibody detection protein.Can pass through blood, tissue, and other body fluid (as the mammary gland imbibition, nipple aspirate) detect.The effect of encoding sequence comprises by its design primer, probe, and siRNA, and shRNA etc. are used to detect DNA, and the expression of RNA suddenlys change and because inhibition of gene expression reaches the result of treatment that suppresses tumor growth.Described purposes is described in embodiment 3,4,5 to some extent.
In a seventh aspect of the present invention, a kind of drug regimen is provided, it contains the people Tim17 antagonist of the present invention and the pharmaceutically acceptable carrier of safe and effective amount.Preferred antagonist is the small molecules interference RNA sequence.These pharmaceutical compositions can be treated tumour.Concrete is, the pLVTHM-sTimm17A that becomes with the pLVTHM vector construction, and with the defective virus of its generation.These results describe in embodiment 3 to some extent.
In other aspects of the present invention because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Table 1 to be Tim17 the people normal and tumor tissues in expression.
Table 1
Wherein,
aLobular carcinoma in situ Lobular carcinoma in situ;
bDuctal carcinoma in situ(DCIS) Ductal carcinoma in site;
cInfiltrating cancer Infiltrating carcinoma;
dAge; The P value is with Fisher Exact statistical computation.
A kind of human tumor marker thing-Tim17 polypeptide and uses thereof sequence table
SEQUENCE?LISTING
＜110〉Fudan University
＜120〉a kind of human tumor marker thing-Tim17 polypeptide and uses thereof
<130>11
<160>6
<170>Patentln?version?3.1
<210>1
<211>22
<212>PRT
＜213〉human body
<400>1
Gly?Lys?Glu?Asp?Pro?Trp?Asn?Ser?Ile?Thr?Ser?Gly?Ala?Leu?Thr?Gly
1 5 10 15
Ala?Ile?Leu?Ala?Ala?Arg
20
<210>2
<211>171
<212>PRT
＜213〉human body
<400>2
Met?Glu?Glu?Tyr?Ala?Arg?Glu?Pro?Cys?Pro?Trp?Arg?Ile?Val?Asp?Asp
1 5 10 15
Cys?Gly?Gly?Ala?Phe?Thr?Met?Gly?Thr?Ile?Gly?Gly?Gly?Ile?Phe?Gln
20 25 30
Ala?Ile?Lys?Gly?Phe?Arg?Asn?Ser?Pro?Val?Gly?Val?Asn?His?Arg?Leu
35 40 45
Arg?Gly?Ser?Leu?Thr?Ala?Ile?Lys?Thr?Arg?Ala?Pro?Gln?Leu?Gly?Gly
50 55 60
Ser?Phe?Ala?Val?Trp?Gly?Gly?Leu?Phe?Ser?Met?Ile?Asp?Cys?Ser?Met
65 70 75 80
Val?Gln?Val?Arg?Gly?Lys?Glu?Asp?Pro?Trp?Asn?Ser?Ile?Thr?Ser?Gly
85 90 95
Ala?Leu?Thr?Gly?Ala?Ile?Leu?Ala?Ala?Arg?Asn?Gly?Pro?Val?Ala?Met
100 105 110
Val?Gly?Ser?Ala?Ala?Met?Gly?Gly?Ile?Leu?Leu?Ala?Leu?Ile?Glu?Gly
115 120 125
Ala?Gly?Ile?Leu?Leu?Thr?Arg?Phe?Ala?Ser?Ala?Gln?Phe?Pro?Asn?Gly
130 135 140
Pro?Gln?Phe?Ala?Glu?Asp?Pro?Ser?Gln?Leu?Pro?Ser?Thr?Gln?Leu?Pro
145 150 155 160
Ser?Ser?Pro?Phe?Gly?Asp?Tyr?Arg?Gln?Tyr?Gln
165 170
<210>3
<211>40
<212>DNA
＜213〉human body
<400>3
atccctggaa?ctccatcaca
tgcagaggca?aatcttgtca 40
<210>4
<211>1644
<212>DNA
＜213〉human body
<400>4
agtcaagatg?gaggagtacg?cgcgagagcc?ttgcccatgg?cgaattgtgg?atgactgtgg
60
tggggccttt?acgatgggta?ccattggtgg?tggtatcttt?caagcaatca?aaggttttcg 120
caattctcca?gtgggagtaa?accacagact?acgagggagt?ttgacagcta?ttaaaaccag
180
ggctccacag?ttaggaggta?gctttgcagt?ttggggaggg?ctgttttcca?tgattgactg 240
tagtatggtt?caagtcagag?gaaaggaaga?tccctggaac?tccatcacaa?gtggtgcctt
300
aacgggagcc?atactggcag?caagaaatgg?accagtggcc?atggttgggt?cagccgcaat
360
gggtggcatt?ctcctagctt?taattgaagg?agctggtatc?ttgttgacaa?gatttgcctc 420
tgcacagttt?cccaatggtc?ctcagtttgc?agaagacccc?tcccagttgc?cttcaactca 480
gttaccttcc?tcaccttttg?gagactatcg?acaatatcag?taggacttct?ttcctaggat 540
ttctttaaca?gaacgagttg?tggttcgaga?aggatttcag?aagatcaagt?tacagtctgt 600
ttttaaaacc?ataggtggga?cagctatggc?caataggcta?taaagagaca?tttagcactt 660
ttttctattt?aaaggaacaa?gcggggaagg?gtgctaaaag?ataatacgtt?tatttattca 720
cacttgaatt?gcatttgtga?tcaaaataaa?tgtttaaatc?gctaaaggaa?aatacagtaa 780
gtgcttgaaa?gatgaaggac?caaaaggcca?aaaaacagtg?aaatatgatc?atcatctctt
840
gcggacttct?ctgcctggtt?ttgtgtgttc?tgttattcaa?acaataaaaa?gctggtggaa 900
cttactcttt?cttttaagat?aagttgtaga?cttcgatgtt?tcatgctcat?gtacttcaaa 960
taatgcatgt?tttatagtta?gtccctcatc?acttgaagtg?acttctgaga?attatgcaga 1020
gtcaacatgg?atcatttcac?agtgagatgc?tttatggatt?gaaggatatg?gtaaaatgtt 1080
tatagtttac?tttgaaagta?aaatatacta?tgtcttggtt?ttgaggatat?tggatacaaa 1140
actctcttcc?tttagggcta?ctgagtcttg?attcctgatc?atcagaaatt?tcaccagaaa 1200
caacttgctt?ccaatatacc?caattctata?tgaagaattc?atggagagtg?tactggcact 1260
ggaagagttt?agtgtttctt?gtatgcttga?aaataaagta?tgtactgttt?tgaatgtgtt 1320
ccaagtcctc?tgcataaacg?atgtattttg?gggtctggtt?gggcctggaa?aatggatgag 1380
cacttcagaa?caggtcattt?tcctgatatt?ggaagtgaca?tgtggcccta?taggaggcat 1440
gatgttagtt?aattacacat?ttgcctacat?ctgtgggaaa?tggagaacaa?agccatgtgg 1500
gtactgtaaa?cacacgttta?tcttttggcc?caatgccata?catatggtag?gcatttaatt 1560
actgattgtg?tttggataat?ttgggaattt?tcgactgtgg?taaaatatac?ataaaataat 1620
acttattaaa?aaaaaaaaaa?aaaa 1644
<210>5
<211>155
<212>PRT
＜213〉human body
<400>5
Ala?Thr?Cys?Cys?Cys?Thr?Gly?Gly?Ala?Ala?Cys?Thr?Cys?Cys?Ala?Thr
1 5 10 15
Cys?Ala?Cys?Ala?Ala?Gly?Thr?Gly?Gly?Thr?Gly?Cys?Cys?Thr?Thr?Ala
20 25 30
Ala?Cys?Gly?Gly?Gly?Ala?Gly?Cys?Cys?Ala?Thr?Ala?Cys?Thr?Gly?Gly
35 40 45
Cys?Ala?Gly?Cys?Ala?Ala?Gly?Ala?Ala?Ala?Thr?Gly?Gly?Ala?Cys?Cys
50 55 60
Ala?Gly?Thr?Gly?Gly?Cys?Cys?Ala?Thr?Gly?Gly?Thr?Thr?Gly?Gly?Gly
65 70 75 80
Thr?Cys?Ala?Gly?Cys?Cys?Gly?Cys?Ala?Ala?Thr?Gly?Gly?Gly?Thr?Gly
85 90 95
Gly?Cys?Ala?Thr?Thr?Cys?Thr?Cys?Cys?Thr?Ala?Gly?Cys?Thr?Thr?Thr
100 105 110
Ala?Ala?Thr?Thr?Gly?Ala?Ala?Gly?Gly?Ala?Gly?Cys?Thr?Gly?Gly?Thr
115 120 125
Ala?Thr?Cys?Thr?Thr?Gly?Thr?Thr?Gly?Ala?Cys?Ala?Ala?Gly?Ala?Thr
130 135 140
Thr?Thr?Gly?Cys?Cys?Thr?Cys?Thr?Gly?Cys?Ala
145 150 155
<210>6
<211>516
<212>DNA
＜213〉human body
<400>6
atggaggagt?acgcgcgaga?gccttgccca?tggcgaattg?tggatgactg?tggtggggcc
60
tttacgatgg?gtaccattgg?tggtggtatc?tttcaagcaa?tcaaaggttt?tcgcaattct 120
ccagtgggag?taaaccacag?actacgaggg?agtttgacag?ctattaaaac?cagggctcca
180
cagttaggag?gtagctttgc?agtttgggga?gggctgtttt?ccatgattga?ctgtagtatg 240
gttcaagtca?gaggaaagga?agatccctgg?aactccatca?caagtggtgc?cttaacggga
300
gccatactgg?cagcaagaaa?tggaccagtg?gccatggttg?ggtcagccgc?aatgggtggc
360
attctcctag?ctttaattga?aggagctggt?atcttgttga?caagatttgc?ctctgcacag 420
tttcccaatg?gtcctcagtt?tgcagaagac?ccctcccagt?tgccttcaac?tcagttacct 480
tcctcacctt?ttggagacta?tcgacaatat?cagtag 516
Claims (12)
1. a human tumor marker thing Tim17 polypeptide is characterized in that this polypeptide comprises: the polypeptide of the aminoacid sequence of SEQ ID NO:1 or its conservative property variation polypeptide or its active polypeptide or its reactive derivative; Its coding nucleic acid has the sequence of SEQ ID NO:5.
2. a Tim17 albumen is characterized in that, this albumen has the aminoacid sequence of SEQ ID NO:2.
3. isolating polynucleotide is characterized in that, described polynucleotide have the sequence of SEQ ID NO:4, the albumen of its coding claim 2.
4. a DNA is characterized in that, has the structure of SEQ ID NO:6, the RNA and the polypeptide of its coding claim 1.
5. a compound is characterized in that, this compound is the active antagonist of antagonism people Tim17, and it contains people Tim17 encoding sequence or its pulsating small molecules interference RNA of claim 1.
6. a pharmaceutical composition is characterized in that, it contains the compound and the pharmaceutically acceptable carrier of the claim 5 of safe and effective amount.
7. an energy and claim 1 or the described Tim17 protein-specific of claim 2 bonded antibody.
8. the method for Tim17 in the test sample is characterized in that it comprises: the RNA in the extracting tissue, and reverse transcription becomes cDNA, with the primer sequence quantitative pcr amplification of SEQ ID NO:3; Or the protein in the extracting tissue carries out immune marking reaction with specific antibody, detects protein level; Or, to paraffin-embedded tissue, carry out the immunohistochemical methods test with specific antibody.
9. the Tim17 polypeptide of claim 1 and encoding sequence thereof are preparing the purposes that detects in tumor markers or the oncotherapy target.
10. the albumen of claim 2 and encoding sequence thereof are preparing the purposes that detects in tumor markers or the oncotherapy target.
11. by the purposes of claim 9 or 10, wherein said tumour is mammary cancer, lung cancer, liver cancer, intestinal cancer, bladder cancer, prostate cancer or lymphatic cancer.
12. by the purposes of claim 9 or 10, wherein said tumour is a mammary cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910174168 CN101768214B (en) | 2008-10-06 | 2009-09-29 | Human tumor marker-Tim17 polypeptide and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810200815 | 2008-10-06 | ||
| CN200810200815.9 | 2008-10-06 | ||
| CN 200910174168 CN101768214B (en) | 2008-10-06 | 2009-09-29 | Human tumor marker-Tim17 polypeptide and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101768214A true CN101768214A (en) | 2010-07-07 |
| CN101768214B CN101768214B (en) | 2013-03-13 |
Family
ID=42501333
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910174168 Expired - Fee Related CN101768214B (en) | 2008-10-06 | 2009-09-29 | Human tumor marker-Tim17 polypeptide and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101768214B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102372773A (en) * | 2010-08-11 | 2012-03-14 | 中国科学院生物物理研究所 | Human bladder cancer tumor marker, antibody thereof and application thereof |
| CN103314298A (en) * | 2010-11-12 | 2013-09-18 | 环太平洋生物技术有限公司 | Novel marker for detection of bladder cancer and/or inflammatory conditions of the bladder |
| CN105154448A (en) * | 2015-09-16 | 2015-12-16 | 复旦大学 | Prostatic cancer molecular target RP11-1023L17.1 and application thereof to diagnostic kit |
| CN110423815A (en) * | 2019-07-19 | 2019-11-08 | 江苏医药职业学院 | Detect application and the kit of the reagent of mitochondrial inner membrane translocase 17A expression |
| CN113804885A (en) * | 2020-06-11 | 2021-12-17 | 复旦大学 | Marker for detecting early tumors and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5854414A (en) * | 1997-03-07 | 1998-12-29 | Incyte Pharmaceuticals, Inc. | Human mitochondrial membrane protein |
| CN1641031A (en) * | 2004-01-14 | 2005-07-20 | 上海人类基因组研究中心 | Novel marneffei penicillium TIM17 protein and its coding sequence |
-
2009
- 2009-09-29 CN CN 200910174168 patent/CN101768214B/en not_active Expired - Fee Related
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102372773A (en) * | 2010-08-11 | 2012-03-14 | 中国科学院生物物理研究所 | Human bladder cancer tumor marker, antibody thereof and application thereof |
| CN102372773B (en) * | 2010-08-11 | 2013-06-05 | 中国科学院生物物理研究所 | Human bladder cancer tumor marker, antibody thereof and application thereof |
| US9073995B2 (en) | 2010-08-11 | 2015-07-07 | Institute Of Biophysics, Chinese Academy Of Sciences | Bladder cancer tumor marker, antibody and use thereof |
| CN103314298A (en) * | 2010-11-12 | 2013-09-18 | 环太平洋生物技术有限公司 | Novel marker for detection of bladder cancer and/or inflammatory conditions of the bladder |
| CN103314298B (en) * | 2010-11-12 | 2016-05-25 | 环太平洋生物技术有限公司 | For detection of the novel mark of the inflammatory disease of carcinoma of urinary bladder and/or bladder |
| CN105154448A (en) * | 2015-09-16 | 2015-12-16 | 复旦大学 | Prostatic cancer molecular target RP11-1023L17.1 and application thereof to diagnostic kit |
| CN110423815A (en) * | 2019-07-19 | 2019-11-08 | 江苏医药职业学院 | Detect application and the kit of the reagent of mitochondrial inner membrane translocase 17A expression |
| CN113804885A (en) * | 2020-06-11 | 2021-12-17 | 复旦大学 | Marker for detecting early tumors and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101768214B (en) | 2013-03-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101836116A (en) | Method for detection of cancer | |
| CN101768214B (en) | Human tumor marker-Tim17 polypeptide and application thereof | |
| CN106662543A (en) | Non-invasive gene mutation detection in lung cancer patients | |
| CN109517898A (en) | A kind of detection of the cancer of the esophagus, diagnosis or prognostic evaluation preparation, treat the application of the drug and RND2 gene of the cancer of the esophagus | |
| CN102183655B (en) | New molecular marker CUEDC2 (CUE Domain Containing 2) protein for prognosis judgement in endocrine therapy of breast cancer | |
| CN100564524C (en) | New transfer factor and application thereof | |
| CN111455058A (en) | Tumor marker related to breast cancer tumor, application and kit | |
| US20160267244A1 (en) | Methods of predicting cancer lethality using replikin counts | |
| CN109709335A (en) | Application of the heat shock protein HSPA4 in metastases prediction, prognosis evaluation and treatment | |
| CN110172462A (en) | Gene and its expression product and application of the occurrence and development of a kind of pair of tumour with facilitation | |
| CN105441566B (en) | Kit and chemotherapy of hepatocellular carcinoma sensitizer for prognosis evaluation after Liver Cancer Operation | |
| CN107827970A (en) | A kind of suppression FOXM1 anti-tumor protein peptide | |
| Mubiru et al. | A Variant of the alpha‐methyl‐acyl‐CoA racemase gene created by a deletion in exon 5 and its expression in prostate cancer | |
| JP5527573B2 (en) | MCF7-derived cells | |
| CN110358834A (en) | The application of lncRNA a kind of and kit and drug | |
| CN105753960B (en) | A kind of tumor markers and its application | |
| EP2320932B1 (en) | Methods of predicting cancer lethality using replikin counts | |
| CN105734155B (en) | Chondroblastic osteosarcoma Disease-causing gene and its application | |
| CN111996251B (en) | Application of malignant glioma biomarker | |
| Zhang et al. | Bioinformatics analysis of breast cancer bone metastasis related gene-CXCR4 | |
| CN105505936B (en) | A kind of anti-bone and flesh tumor metastasis biological agent and its application | |
| CN106544430A (en) | A kind of molecular marked compound of detection carcinoma of prostate and its application | |
| CN103451303B (en) | Kit for detecting expression level of human ERCC1 (excision repair cross complementation 1) through PCR (polymerase chain reaction) method | |
| CN107881240B (en) | The diagnosis and treatment marker of osteosarcoma | |
| CN102838657A (en) | Human tumor marker TBRG4 (transforming growth factor beta regulator 4) polypeptide and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130313 Termination date: 20150929 |
|
| EXPY | Termination of patent right or utility model |