CN105154448A - Prostatic cancer molecular target RP11-1023L17.1 and application thereof to diagnostic kit - Google Patents
Prostatic cancer molecular target RP11-1023L17.1 and application thereof to diagnostic kit Download PDFInfo
- Publication number
- CN105154448A CN105154448A CN201510590470.2A CN201510590470A CN105154448A CN 105154448 A CN105154448 A CN 105154448A CN 201510590470 A CN201510590470 A CN 201510590470A CN 105154448 A CN105154448 A CN 105154448A
- Authority
- CN
- China
- Prior art keywords
- prostate cancer
- molecular target
- primer sequence
- application
- seqidno
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the biotechnology field and in particular provides a prostatic cancer molecular target RP11-1023L17.1 and an application thereof to a diagnostic kit. RP11-1023L17.1 is IncRNA (long non-coding ribonucleic acid). A nucleotide sequence of RP11-1023L17.1 is shown in SEQ ID NO.1. The invention comprises an application of the prostatic cancer molecular target to screening drugs for preventing, relieving and/or treating prostatic cancers, an inhibitor of the prostatic cancer molecular target, an application of the inhibitor to preparation of drugs for preventing, relieving and/or treating prostatic cancers, the prostatic cancer diagnostic kit containing the prostatic cancer molecular target and applications of the prostatic cancer molecular target and the diagnostic kit to screening, diagnosis, treatment, status monitoring and prognostic monitoring of prostatic cancer high risk groups. Being used for diagnosing prostatic cancers, the molecular target and the diagnostic kit containing the molecular target are simple to operate and convenient to draw, are safe and non-invasive and have the characteristics of higher specificity and sensitivity and easiness in mass screening.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of prostate cancer molecular target RP11-1023L17.1 and the application in diagnostic kit thereof, comprise and be marked on the screening of prostate cancer high risk population, the diagnosis of prostate cancer, the application in the field such as prostate cancer therapy and the monitoring of situation, the monitoring of prostate cancer direction of medication usage and prostate cancer prognosis detection by this bio-molecular target.
Background technology
According to associated viscera in " ASCO annual report: 2015 Clinical Oncology progress ", liquid Biopsy is listed in one of therapeutic field of tumor coming decade trend.Some molecular markers in blood have been applied to the diagnosis of some diseases, and as gpt is used for the diagnosis of hepatitis, number of white blood cells is for judging inflammation.Blood circulation Tumour DNA (circulatingtumorDNA, ctDNA) be a kind of outer dissociative DNA of born of the same parents of acellular state, be present in the body fluid such as blood, synovial fluid and cerebrospinal fluid, somatocyte DNA is through to come off or when discharging into the recycle system after apoptosis, it is mainly made up of the mixture of short strand or double-stranded DNA and strand and double-stranded DNA, exists with DNA protein complex or dissociative DNA two kinds of forms.CtDNA is from the somatic mutation of tumour cell, therefore, ctDNA is a kind of distinctive new tumor biomarker, and can by qualitative, quantitative and tracking, by becoming the early diagnosis of clinical tumor, prognosis judge and follow the tracks of to follow up a case by regular visits to etc. provide a series of convenient, fast, special, without wound or Wicresoft and molecular Biological Detection means, the tumour especially for some, not there is typical clinical symptom, checking without specificity and difficult diagnosis can avoid complexity, there is traumatic biopsy.To become " liquid biopsy " in conjunction with new-generation sequencing technology (NGS), and substitute the biopsy of the intrusion sense of organization.
RP11-1023L17.1 belongs to lncRNA(longnon-codingRNA, long-chain non-coding RNA), the non-coding RNA of a class transcript length more than 200 Nucleotide, research in recent years finds that it is the RNA that a class has important biomolecule function, participate in genomic imprinting, karyomit(e) silence, chromatin modification, transcriptional activation, transcribe interference, the multiple important regulation process such as the interior transport of core, in the vital movements such as cytodifferentiation and growth, genetic transcription and translation, heredity and epigenetic, all play important regulating and controlling effect.In recent years, increasing authority's research confirms that lncRNA plays a part to suppress or promote tumour in the developing of tumour, and in modulate tumor cell proliferation, apoptosis, cell cycle, Invasion and Metastasis ability etc., all has very vital role.Oneself has more lncRNAs to be proved to there are differences in the mankind's kinds of tumors comprising mammary cancer, prostate gland, melanoma, liver cancer, colorectal carcinoma, bladder cancer etc. and expresses and perform important adjusting function at present.Early stage effectively detect tumour generation, development and to improve the curative effect of cancer therapy drug particularly important for the treatment of cancer, invention novel tumor markers is the focus of tumor research as the target spot of Clinics and Practices always.
Prostate cancer is one of common male reproductive system malignant tumour.In world wide, prostate-cancer incidence occupies the second in all malignant tumours of the male sex, exceedes lung cancer at the sickness rate of U.S.'s prostate cancer, becomes the tumour of first harm men's health.The sickness rate of Asia prostate cancer well below American-European countries, but presents ascendant trend in recent years, and increases rapider than European and American developed countries.Patients with prostate cancer is elderly men mainly, generally at 50 years old with sequela, 95% betides the elderly men of more than 60 years old, and incidence increases constantly with age.Prostate cancer is early stage many without any symptom, even if uncomfortable to some extent, is also not enough to the attention causing patient, when tumour increases urethra, often obscures mutually with hyperplasia of prostate again.First find that distant metastasis focus just finds prostate cancer the patient of China about 80%.Now, pathology reaches late period, prognosis mala.
The clinical diagnostic modalities of prostate cancer mainly contains digital rectal examination, serum PSA (PSA) detection, the detection of endorectal ultrasonography ripple, living tissue pathologic finding etc. at present.Digital rectal examination is the method for the simplest, most economical practicality, and the forefinger mainly through doctor touches prostate gland, in order to find a lot of asymptomatic patients with prostate cancer, likely obtains the chance of early diagnosis and radical cure.But all there is limitation in above method.The limitation of such as digital rectal examination is mainly in 4: when (1) patient's prostate gland lump is little, easy to cause missed diagnosis; (2) enlargement of some patients prostate cancer is not obvious, but belongs to late period, not easily effects a radical cure; (3) patient's rectum has during illness this can not be used to detect; (4) may have when doctors experience is not enough and fail to pinpoint a disease in diagnosis or the possibility of mistaken diagnosis.PSA under normal circumstances in blood not high (not higher than 4ng/ml), when being in prostate cancer and other prostatosis disease states, PSA raises becomes the most responsive knurl mark of current examination prostate cancer, but also there is certain limitation in it: (1) needs to get blood examination and surveys, and has certain damage to patient; (2) PSA increases also common and non-prostate cancer disease, as prostatitis, prostatomegaly etc., therefore not easily makes a definite diagnosis; (3) PSA increases when making a definite diagnosis prostate cancer, and often patient belongs to the middle and later periods, does not reach the object of early diagnosis.Prostate gland ultrasound examination simple and direct-viewing operation, not damaged, provide location and qualitative sign and the character judging pathology by showing the size of lump, number, position, density, edge, body, form with or without calcification and calcification, size, number, distribution and halo, skin change etc. around; Its limitation is: (1) little cancer stove to compactness is easily failed to pinpoint a disease in diagnosis; (2) sometimes clear and definite etiologic diagnosis can not be provided; (3) because it can not show the internal structure of tumour and surrounding tissue so diagnostic accordance rate is very low; (4) higher misdiagnosis rate is had to the good Malignant mass of solid that some lack typical sign.Living tissue pathologic finding because it is traumatic, complicacy can not as the means of primary dcreening operation, but its gold standard that to be prostate cancer make a definite diagnosis, general and additive method technical battery uses.
Research in recent years shows, lncRNA and prostate cancer closely related, they may participate in the generation of tumour, development and transfer, so may have corresponding effect to the detection and prognosis etc. of the pathogenesis of tumour, early diagnosis, individualized treatment, transfer.
Summary of the invention
The object of the present invention is to provide a kind of new prostate cancer molecular target relevant to prostate cancer, and prostatic cancer diagnostic reagent kit, and this prostate cancer molecular target and the prostatic cancer diagnostic reagent kit application in prostate cancer high risk population screening, diagnosis, treatment and condition monitoring, Prognosis scoveillance.
The present invention finds that the content of RP11-1023L17.1 in prostate cancer tissue sample is higher than the content in prostate gland healthy tissues sample after deliberation, and the tumorigenesis of display RP11-1023L17.1 and prostate cancer also exists close dependency.Therefore, the present invention proposes RP11-1023L17.1 as the new prostate cancer molecular target relevant to prostate cancer, and provide containing this prostate cancer molecular target RP11-1023L17.1(as mark) diagnostic kit, and this molecular target or the diagnostic kit application in prostate cancer high risk population screening, diagnosis, treatment and condition monitoring, Prognosis scoveillance.
Prostate cancer molecular target RP11-1023L17.1 provided by the invention, be a kind of lncRNA, total length 5001bp, its nucleotides sequence is classified as shown in SEQIDNO.1.
Aforesaid prostate cancer molecular target RP11-1023L17.1, the medicine of can be used for screening prevention, alleviating and/or treating prostate cancer.Its inhibitor RP11-1023L17.1siRNA(SEQIDNO.6, SEQIDNO.7) can be used for preparing the medicine preventing, alleviate and/or treat prostate cancer.
The present invention also provides the diagnostic kit containing aforementioned prostate cancer molecular target RP11-1023L17.1.This diagnostic kit can be used for prostate cancer high risk population screening, diagnosis, treatment condition monitoring, Prognosis scoveillance etc.
Aforesaid prostate cancer molecular target RP11-1023L17.1 is as the application of mark in the test kit of preparation prostate cancer high risk population screening, diagnosis, treatment condition monitoring, Prognosis scoveillance, the content by detecting the RP11-1023L17.1 in subject's tissue samples, blood and urine, and compared with normal level RP11-1023L17.1 content, to carry out prostate cancer high risk population screening, diagnosis, treatment condition monitoring, Prognosis scoveillance.
Aforesaid prostate cancer molecular target RP11-1023L17.1, as the application of mark in the test kit of preparation prostate cancer high risk population screening, diagnosis, medicinal design, treatment and condition monitoring, Prognosis scoveillance and in medicine, can be detected the content of RP11-1023L17.1 in subject's serum, urine and tissue samples by Total RNAs extraction, reverse transcription, quantitative PCR.
The diagnostic kit of aforesaid diagnosing prostate cancer comprises:
(1) total RNA extraction reagent in tissue samples, blood and urine;
Every 50mg tissue or 200ul blood or 200ul urine, use:
(2) Reverse Transcription;
(3) quantitative PCR reagent;
Primer comprises RP11-1023L17.1 and contrast β-ACTIN two pairs of primers;
(4) prostate gland healthy tissues cDNA
As negative control and the common quantitative PCR detection of detection sample cDNA, each reaction system uses and the identical amount of detection sample cDNA.
The diagnostic kit interpretation of result of aforesaid diagnosing prostate cancer detects between sample and negative control compares employing t inspection, and P<0.05 is significant difference, is judged to the Samples detection positive.
The contrast used of aforementioned detection kit is β-ACTIN, and its primer sequence is as follows:
β-ACTIN upstream primer sequence: 5 ＇-CCTCTCCCAAGTCCACACAG-3 ＇ (SEQIDNO.2)
β-ACTIN downstream primer sequence: 5 ＇-GGGCACGAAGGCTCATCATT-3 ＇ (SEQIDNO.3).
RP11-1023L17.1 that aforementioned detection kit detects, its primer sequence is as follows:
RP11-1023L17.1 upstream primer sequence: 5 ＇-GATTTACTTTTGGGATACACTCATCAT-3 ＇ (SEQIDNO.4)
RP11-1023L17.1 downstream primer sequence: 5 ＇-ACAGGTGACTTCATCTTGGATTT-3 ＇ (SEQIDNO.5).
The present invention is that the Diagnosis and Treat of prostate cancer provides a kind of new molecular target RP11-1023L17.1.The inhibitor of this molecular target can be used for the medicine preparing treatment prostate cancer, can be used as mark simultaneously and is applied to and prepares in diagnostic kit.Use this molecular target and containing the diagnostic kit diagnosing prostate cancer of this molecular target, simple to operate, draw materials conveniently, safe hurtless measure, and there is higher specificity, susceptibility and facilitate the feature of a large amount of examination.This molecular target is applicable to being applied to the screening of prostate cancer high risk population, the qualification of prostate cancer, the field such as prostate cancer therapy and the monitoring of situation, the monitoring of prostate cancer direction of medication usage and prostate cancer Prognosis scoveillance.
Accompanying drawing explanation
The content detection of Fig. 1 .RP11-1023L17.1 in prostate cancer tissue sample and in healthy tissues sample.
Fig. 2. in prostate cancer cell line PC-3, RP11-1023L17.1siRNA is to RP11-1023L17.1 silence efficiency.
Fig. 3 .RP11-1023L17.1-siRNA significantly suppresses the propagation of prostate cancer cell.
Fig. 4. medicine SB20580 significantly suppresses the expression of RP11-1023L17.1 in prostate cancer cell line.
Embodiment
For making the present invention easier to understand, the present invention is set forth further below in conjunction with specific embodiment, but following embodiment does not only limit the scope of the invention for illustration of the present invention, below NM specific experiment method in embodiment, conveniently experimental technique carries out.
embodiment 1:the content detection of RP11-1023L17.1 in prostate cancer tissue sample and in healthy tissues sample
The present embodiment key step is as follows:
1, the extraction of total serum IgE in tissue samples
Obtain the tissue samples after Prostate Cancer after Radical corrective surgery, obtain the tissue samples of patient's excision of Pulmonary resections in contrast simultaneously.The total serum IgE extracting aforementioned tissues sample is in without in DNA and 1.5 milliliters of centrifuge tubes without the pollution of RNA enzyme.
The test kit of total serum IgE is extracted purchased from Beijing CoWin Bioscience Co., Ltd. in tissue samples.The total serum IgE extracted passes through to use ThermNanoDrop2000c spectrophotometer, the concentration determination that the ratio measuring 260/280nm ultraviolet wavelength carries out.
2, the lncRNA in detection by quantitative tissue samples
(1) reverse transcription RNA obtains cDNA strand
Configure reverse transcription system according to following table 1, layoutprocedure is carried out on ice.The system configured carries out reverse transcription in PCR instrument.Reaction conditions be 38 degrees Celsius 15 minutes, 85 degrees Celsius 5 seconds.
Table 1
In table 1, X represents that the RNA volume added is determined by RNA concentration, is X=500 sodium gram/RNA concentration in this experiment.Aforementioned Reverse Transcription box is purchased from the precious biological company limited (Takara) in Dalian.
(2) QPCR detection by quantitative
With cDNA diluent for real-time quantitative PCR template, primer final concentration is 200nM, and reaction cumulative volume is 10 μ l.Real-time quantitative PCR instrument uses ABI7900HTsequenceDetectionSystem, completes with 384 orifice plates.Each sample repeats two to three times.When solubility curve meets the requirements substantially without non-specific amplification, with reference to operational manual, adopt thresholdcycle(Ct) method acquisition relative expression quantity, with β-ACTIN for internal reference.Specific procedure is referring to table 2.
Table 2
。
(3) ArrayTools4.1.0 is adopted to carry out data analysis
Target lncRNA and the Ct value level with reference to lncRNA in sample can be recorded with preceding method and try to achieve target lncRNA relative content in the tissue.Be with reference to correcting the amount of lncRNA with β-ACTIN, in being detected by QPCR classical 2
-Δ Ctmethod representation tissue samples in the level (-Δ Ct is target lncRNA and the difference of the Ct value contrasted) of lncRNA.
3, the horizontal diagnosing prostate cancer of RP11-1023L17.1 in tissue samples
As Fig. 1, compared with the high-content of RP11-1023L17.1 in normal control tissue sample, RP11-1023L17.1 content in patients with prostate cancer tissue samples is relatively high, and generally higher than the mean value of healthy tissues sample, normal sample mean is about 2.5 times of the mean value of tumor sample, and difference has statistical significance.
embodiment 2:in prostate cancer cell line, RP11-1023L17.1-siRNA detects RP11-1023L17.1 silence efficiency
The siRNA sequence of the prostate cancer molecular target RP11-1023L17.1 used in the present embodiment is:
RP11-1023L17.1siRNA sense strand sequence: 5 ＇-GCGUCUAAGAGAGUACUUU-3 ＇ (SEQIDNO.6)
RP11-1023L17.1siRNA antisense strand sequence: 5 ＇-AAAGUACUCUCUUAGACGC-3 ＇ (SEQIDNO.7).
The siRNA sequence of the negative control (NC) used is:
NCsiRNA sense strand sequence: 5 ＇-UUCUCCGAACGUGUCACGU-3 ＇ (SEQIDNO.8)
NCsiRNA antisense strand sequence: 5 ＇-ACGUGACACGUUCGGAGAA-3 ＇ (SEQIDNO.9).
The present embodiment key step is as follows:
1, the siRNA transfection (for six orifice plates) of cell
Prostate cancer cell line PC-3 is inoculated in six orifice plates, the cell confluency degree of next day is made to be about 40-50%, the Lipofectamine2000 of 5 μ L and 250 μ LOpti-MEM mixing is hatched, the siRNA of 5ul20uM/L is mixed with 250 μ LOpti-MEM simultaneously and hatch.After leaving standstill 5min, both are mixed.Cell PBS is washed one time simultaneously, change the Opti-MEM of 1.5ml into.After transfection mixture leaves standstill 20min, be evenly added drop-wise in six orifice plates, the final concentration of siRNA is 50uM/ml.Be replaced with perfect medium after 4-6 hour to continue to cultivate.
2, the extraction of total serum IgE in cell
Cell transfecting after cultivating 48h, collecting cell also extracts its total serum IgE, and extracting method is with embodiment 1.
3, the lncRNA in detection by quantitative cell also carries out data analysis
Detection by quantitative and data analysing method are together with embodiment 1.
4, RP11-1023L17.1siRNA is to RP11-1023L17.1 silence efficiency
As Fig. 2, after PC-3 transfection RP11-1023L17.1siRNA, the expression amount of RP11-1023L17.1 have dropped more than 80%.Prove that RP11-1023L17.1siRNA can effectively strike and subtract the expression of RP11-1023L17.1 in prostate cancer cell line PC-3.
embodiment 3:rP11-1023L17.1-siRNA significantly suppresses the propagation of prostate cancer cell, can be used for the preparation of prostate cancer medicine.
The present embodiment key step is as follows:
1, the siRNA transfection (for six orifice plates) of cell
Transfection method is with embodiment 2.
2, cell proliferation experiment
Resuspended after cell dissociation, be inoculated in 96 holes, and the control wells only adding 100 μ L1640 substratum is set.After inoculation 0h, 24h, 48h, after every hole adds 10ulCKK-8 reagent respectively, continue in cell culture incubator to hatch 2 hours.Be used in the absorbance value (OD) in each hole, microplate reader determined wavelength 450nm place, reference wavelength 630nm (600-650nm).Deduct the mean value of blank well absorbance value as actual light absorption value using each hole absorbance value, average, make curve with 0h, 24h, 48h time point absorbance value, the proliferative conditions of reflection cell.
3, RP11-1023L17.1-siRNA affects the proliferative conditions of prostate cancer cell
As Fig. 3, RP11-1023L17.1-siRNA significantly suppress the propagation of prostate cancer cell, can be used for the preparation of prostate cancer medicine.
embodiment 4:medicine SB20580 significantly can suppress the expression of RP11-1023L17.1 in prostate cancer cell line, can be used as the medicine of potential prostate cancer.
The present embodiment key step is as follows:
1, the process of cell
Be inoculated into by prostate cancer cell line PC-3 in six orifice plates, make the cell confluency degree about 70% of next day, within second day, being replaced by normal substratum containing concentration is the substratum of 10 μMs, cultivates 0 hour respectively, 2 hours, 4 hours.
2, the extraction of total serum IgE in cell
Collecting cell also extracts its total serum IgE, and extracting method is with embodiment 1.
3, the lncRNA in detection by quantitative cell also carries out data analysis
Detection by quantitative and data analysing method are together with embodiment 1.
4, medicine SB20580 is to the inhibiting rate of RP11-1023L17.1
As Fig. 4, after use medicine SB20580 is to cell process, the expression amount of RP11-1023L17.1 have dropped more than 35% and 55% respectively after 2h and 4h.Prove that medicine SB20580 effectively can suppress the expression of RP11-1023L17.1 in prostate cancer cell line PC-3, can be used as the medicine of potential prostate cancer.
embodiment 5:the application of the diagnostic kit of this prostate cancer
The present embodiment key step is as follows:
1, the extraction of total serum IgE in tissue samples, blood, urine
Use amount handling tissue samples, blood, the urine of the Trizol reagent of 1mL according to every 50mg tissue or 200ul blood or 200ul urine, transfer in the 1.5mlEp pipe without RNA enzyme after piping and druming evenly; In homogenate, add the chloroform of 1/5 volume, vibration centrifuge tube to emulsifying soln becomes milky white shape, without phase-splitting, and 12000rpm4 DEG C of centrifugal 15min; Draw supernatant to new pipe, add equal-volume Virahol, mix gently ,-20 DEG C of 2h precipitations; 12000rpm4 DEG C of centrifugal 10min; Abandon supernatant, add 1ml75% ethanol gently along tube wall, fine laundering EP manages, 12000rpm4 DEG C of centrifugal 2min; Abandon supernatant, of short duration centrifugal, suck residue supernatant with rifle, be placed in stink cupboard and dry; Add appropriate DEPC water, make resolution of precipitate with rifle piping and druming; Quantitative: electrophoresis detection extracting quality, UV spectrophotometer measuring OD260/OD280 and sample concentration; Obtain total serum IgE in tissue samples, blood, urine, place-80 DEG C of preservations.
2, the RP11-1023L17.1 relative prostate normal tissue expression amount change in tissue samples, blood, urine is detected
Use seminal plasma fructose detection kit, according to reaction system and condition in embodiment 1, in use test kit, prostate gland healthy tissues cDNA is as the contrast cDNA in QPCR detection by quantitative, detect the RP11-1023L17.1 relative prostate normal tissue expression amount change in tissue samples, blood, urine, analyzing and testing result, compare between sample and contrast and adopt t inspection, P<0.05 is significant difference, is judged to and detects the sample positive.
The present invention is not restricted to the described embodiments; what describe in above-described embodiment and specification sheets just illustrates principle of the present invention; without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, and these changes and improvements all fall in the claimed scope of the invention.Application claims protection domain is defined by appending claims and equivalent thereof.
<110> Fudan University
<120>RP11-1023L17.1 is as a kind of prostate cancer molecular target and the application in diagnostic kit thereof
<130>1
<160>9
<170>PatentInversion3.3
<210>1
<211>5001
<212>RNA
<213> species home sapiens (Homosapiens)
<400>1
accagugacagagcgaccauaauggauuaauaagcgcagccagggcuggugaauuaccau60
aucuccgucaagugcaguaaccaguucaaguuggaagugugucuuuugaaaucagacaac120
aaagucguggacaaccaggcugggacccagggccagcugaaggugcugggugccaaccuc180
ugguggccguaccugaugcacgaacaccccgccuaccuguacucgugggaggauggugau240
ugcucacaccaaagccuuggaccccucccagccugugaccuuugugaccaacuccaccua300
cgcagcagacaagggggauccaccucugauguucagugaagaguaccagaaaagucugcu360
agagcaguaccaucugggucucaaucaaaaacgcagaaaauacgugguuggagagcucau420
cuggaauuuugccgauuucaugacuaaccaguccaaggaugaaggaaacacuggaccuca480
uuauggauuuacuuuugggauacacucaucauuccagaggaggguaaaaggcugagaagc540
uuaaguucugcaggcuggaaauccaagaugaagucaccuguaguucagugucugcgucua600
agagaguacuuuguugcugcacccgccagagggaagaaauacuguaucuucucaugaagg660
aaggaaccgaaggugggaauagggaccaaacucccucuuucaagccuuuuuguagugaca720
uuaauucauuuaugaggaugccaccaucaugacauaaucauuucccaaaggauuucaccu780
ccucccacuguugcauuggggauuaauuuuccaacacaugaauuuugagggacacauuca840
aaccauagcaacugguauauaguaacuagguggcccgauggucuucauaauaaaguuaua900
uuuuacuuuaguauaaaauaaaaggucaaggcuuguaacugugaugagacugcuucaugu960
auaucuccccuagugacuaucacaguugacugacagcuccagggguucaucuuuguaucc1020
aucacuaccuauaguccaaaauccccaucucacagcuguugucagccaaugacaaagcau1080
agugaggugcuguuccugcucaauauggaggaaaacuuuggcuugauaacucuccauugg1140
ccugccaaaauauguuaaguauugugcuacuaucugaaacucauuuuaccuaaccuuuuu1200
uauuuucuuuccuccuucauaagguuuacaaguauuguggcugaaggcugugucuauucc1260
ugcuuccuccaccucaccuugcaaaaguguuuauccaaauaaaucccucacacaucuaau1320
cccauuuuggcaaauucaguuucagaacuuugccuucacuacuagucucaaggaaaauau1380
auuaauacacacacacacacacacacacacacacgcaugcacacacacacauauguauau1440
auuucccaaucuauuauagguaaaauauacucuuaucacgaauaaauccaaauugugaau1500
gcuuaaaauauacuuuacagaauauuaaaauuuaaaagcaucacaggaaaaauauuaaua1560
cuguuuacagaauuucaauaugugaauaauauuuacauuacaguuucauaugaaccuuuu1620
acuucucuauuuaguaugccauuaugucacugcagagguaugaaaaggagagcucuccua1680
guugugaaaaaagaaacauguuuuauugggagcuaaguggaagguugaacaugugggaau1740
aucugggcaugcacugaagacaccuuuugcaucucccccauccacauagcaaagugaaug1800
ugguuuguguccauuuaugcaggauacucuggaaaaccaaacugaaacaagguuaacaua1860
cauuuuuaaaagaaaacuaaaggaaaacaacacauacuuuauuaccuaucaaaguaacca1920
cuucauuauauuuuaguggaagcuauuauuuauuaucgaauuauuugcuuuggcaggagg1980
auacaggguuuucccauuuggguuguauauguuccucaugagaaaagcugaagacaaaau2040
cuuacccuucugcccaaagucaauugaaucaacauguuuaccuugcuccacggagcugcu2100
aaccuacuggcuggguguuguguggcuuggcaauggaguucugcaugacgggaacaaugg2160
uuuuuaaguggacuaaucagagcuguuaaugcauaugcagugaaggcaggaacuuugcua2220
caugcagggcuuaucauuuugcuaauaacaaugccuggcacagauuagcaauuuguugaa2280
auaaaacauucugggagauguaagauagagaaagagagcagcauguaguagaaauagaug2340
ucgaaagaugaauuaagaugaugcauuaagcuugaaacgugaggcagagaaagcuguaca2400
uaaguugaaggcuuugaguuaaaagacuauaggaauuagaugagugggggcuauggagaa2460
cggagagaauuuagaguguggacaagcguucuaugagcagagacugggacuagccaaaac2520
gugaugaugggcagcuagcuuggaaagaaugcuuacaacgugaaaauuauauauuuacaa2580
aaggccauuacuucuguuaaagaacaauagaccccagugaaaagaaaggaaauugaaaaa2640
uagagaaaauguggagaaaacuagaaucucuauagacagcaucaaugcagcaucaauuau2700
gugaaccacuuuugagcacaaagaaauauuguuuugaccuuggaggcaauuuggucuuca2760
uuagguuuagcuguaggauaguugauguucauuauucccuauaaugcuugugauggcaaa2820
accuucacaaauuuauaugaucuagguauguuuucaauccuuacaacccaaguaaccgau2880
cauaacucucacuaugucauuugaaaaaaaaaaugaucaucagaaguguaauucaauuag2940
caaguaucaguaguggaguauaaauuauugguuaauacuaagcaugauggaaaaaucaua3000
guagauggaaauaugggaaucuuuauuuuggaugaauaaacuuuaugccuaaaacauaug3060
uuuauaaaaaauacuuugugaauaaacccauugucuaauauuuaaaagaguugaaguaug3120
cuauuauaagaccuuccuuaauugaugaaaugaugcaaagccaauaauauugcuccacuu3180
ccugaaguauagagaugaacagaaaccuuuuucuuuauuccauguucuauauaagucgag3240
aacuagagcucaagauuaaguuuuuuguuuuuuguuuuuuuuuccauuucccugggaaca3300
gagcaacagucucucugggucuaaaacauccuuuuuucgguacaucccacagcauccuau3360
agaaauauguugcaaucaguugccaagucacguccuagcuuaaugucagcaauuuucuuu3420
cugaaccaauuuugcacucagcauuaagaggaaauauugaagggagacauaccuuuuaug3480
uuuguaaaauuuauacuucuuaagauaaaaaggcaacuauauccauugucgugagaucuu3540
gagaagaaauaagaaaaugaaauauuauagaaaauauuauauuauuuaauuguccuguuc3600
uaaaacacuuucuaagccugccuguuuuuuugccaaauuaaaucaauauuuggauguaga3660
cagcuuuucagaguggcaguaucauagucaaugaagaugaccugaggcacaauuauugcu3720
aauuggacauagaaaccaccuucacucauauauaaaaauuauuaugugcuauacuagaua3780
uuucaggagaauugauaaaagaaagacuguuguauucauaugcuugucuuccuggcuaga3840
ggaucuguuuuaauuaaucagcucauggaguuuggaaaauauuuauaguauacauagcug3900
aguguucauguaaauuuugaauacauucauacaacuuuuuuuuuaaaaaaagauugaacu3960
ucaaaaccauuuucuuacauacucaguagaaguuguuauaagccaacauuuuuugugagc4020
uauacuauuuuaaacaucuaaaguaaauuauuugacauauaaaaagacuucuucauuuaa4080
aaauauaucuuuuaaaaauaauuuuacaagugauggcaucucauuuuagaagaagaggca4140
ucaaugacagcaguuacaguaacucgaugcugaauauguuuuuaaauaccagaugcugug4200
uucagcauuguacauacauuaucaaauuuuauucugauaauaugcugcaugauguauuag4260
gcuggguucucucagacagaaccuacacguauacauauauauauacacacaugcauauac4320
cuacacauacagagagagagagagagauguacauuuauuauaggaauuggaucaugcgau4380
uaugcgggccgagaaguuccaggauagguugucugcaagcuggagaaccagggaagagag4440
uagaguagcuuucuccaaguccugaagcuucagaacuagggaaacugaugguauaacucu4500
cagucagaggccaaaggccugagaacucagacagccacuuugcaacuccuggaaucccaa4560
ggccagacagccuggaguuuggauguccaaaagcaccagaaggagggugucuuaggucca4620
ggagagagcgagcuuuccuaugcauuuuuguuuuauccauaccccugaccaauuggaugg4680
ugcccacccgcauugagggugggugucccucuauuaaauauuuuaacuauaauuuuaacu4740
gugauauaggcacugaauucuuguugcuaauaaucugguaagauccaucugaacuaugaa4800
gugaguaccuggaggaacuccuacauuuuaggcuuucaaagguuacaggcuuuucgugug4860
uguguguguguguguguguguuuugagaaaaauggaauugaaacacugugauuagaaugu4920
uuacuuauauagaauuuaugaaugaauguauauaauaauuacuguauauaauuuuaaaau4980
auaauaaagucucuuuaucca5001
<210>2
<211>20
<212>DNA
<213> artificial sequence
<400>2
cctctcccaagtccacacag20
<210>3
<211>20
<212>DNA
<213> artificial sequence
<400>3
gggcacgaaggctcatcatt20
<210>4
<211>27
<212>DNA
<213> artificial sequence
<400>4
gatttacttttgggatacactcatcat27
<210>5
<211>23
<212>DNA
<213> artificial sequence
<400>5
acaggtgacttcatcttggattt23
<210>6
<211>19
<212>RNA
<213> artificial sequence
<400>6
gcgucuaagagaguacuuu19
<210>7
<211>19
<212>RNA
<213> artificial sequence
<400>7
aaaguacucucuuagacgc19
<210>8
<211>19
<212>RNA
<213> artificial sequence
<400>8
uucuccgaacgugucacgu19
<210>9
<211>19
<212>RNA
<213> artificial sequence
<400>9
acgugacacguucggagaa19
Claims (10)
1. a prostate cancer molecular target, is characterized in that for RP11-1023L17.1, and be a kind of lncRNA, its nucleotides sequence is classified as shown in SEQIDNO.1.
2. prostate cancer molecular target as claimed in claim 1 prevents in screening, alleviates and/or treat the application in the medicine of prostate cancer.
3. the inhibitor of a prostate cancer molecular target as claimed in claim 1.
4. inhibitor as claimed in claim 3 prevents in preparation, alleviates and/or treat the application in the medicine of prostate cancer.
5. application according to claim 4, is characterized in that medicine prepared by described inhibitor comprises the siRNA of RP11-1023L17.1.
6. a prostatic cancer diagnostic reagent kit, it is characterized in that containing prostate cancer molecular target RP11-1023L17.1, RP11-1023L17.1 be a kind of lncRNA, its nucleotides sequence is classified as shown in SEQIDNO.1.
7. prostatic cancer diagnostic reagent kit according to claim 6, is characterized in that comprising:
(1) total RNA extraction reagent in tissue samples, blood and urine;
(2) Reverse Transcription;
(3) quantitative PCR reagent;
Primer: be RP11-1023L17.1 and contrast β-ACTIN two pairs of primers;
The primer sequence of contrast β-ACTIN is as follows:
β-ACTIN upstream primer sequence: SEQIDNO.2
β-ACTIN downstream primer sequence: SEQIDNO.3;
The primer sequence detecting RP11-1023L17.1 is as follows:
RP11-1023L17.1 upstream primer sequence: SEQIDNO.4
RP11-1023L17.1 downstream primer sequence: SEQIDNO.5.
8. prostate cancer molecular target as claimed in claim 1 is as the application of mark in the test kit of preparation prostate cancer high risk population screening, diagnosis, medicinal design, treatment and condition monitoring, Prognosis scoveillance and in medicine, it is characterized in that: by detecting the content of RP11-1023L17.1 in subject's serum, urine and tissue samples, and compared with normal level RP11-1023L17.1 content, to carry out prostate cancer high risk population screening, diagnosis, treatment and condition monitoring, Prognosis scoveillance.
9. prostate cancer molecular target as claimed in claim 1 is as the application of mark in the test kit of preparation prostate cancer high risk population screening, diagnosis, medicinal design, treatment and condition monitoring, Prognosis scoveillance and in medicine, it is characterized in that: in described subject's serum, urine and tissue samples, the content of RP11-1023L17.1 is detected by Total RNAs extraction, reverse transcription, quantitative PCR.
10. one kind for detecting the primer sequence of prostate cancer molecular target RP11-1023L17.1:
Upstream primer sequence: 5 ＇-GATTTACTTTTGGGATACACTCATCAT-3 ＇
Upstream primer sequence: 5 ＇-ACAGGTGACTTCATCTTGGATTT-3 ＇.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510590470.2A CN105154448A (en) | 2015-09-16 | 2015-09-16 | Prostatic cancer molecular target RP11-1023L17.1 and application thereof to diagnostic kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510590470.2A CN105154448A (en) | 2015-09-16 | 2015-09-16 | Prostatic cancer molecular target RP11-1023L17.1 and application thereof to diagnostic kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105154448A true CN105154448A (en) | 2015-12-16 |
Family
ID=54795493
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510590470.2A Pending CN105154448A (en) | 2015-09-16 | 2015-09-16 | Prostatic cancer molecular target RP11-1023L17.1 and application thereof to diagnostic kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105154448A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148561A (en) * | 2016-09-28 | 2016-11-23 | 北京致成生物医学科技有限公司 | The diagnosis and treatment label of carcinoma of prostate |
| CN106148557A (en) * | 2016-09-14 | 2016-11-23 | 北京致成生物医学科技有限公司 | Application in preparing prostate cancer diagnosis product for the LOC100129066 |
| CN106367507A (en) * | 2016-09-09 | 2017-02-01 | 北京致成生物医学科技有限公司 | Application of LOC283856 in preparation of prostatic cancer early treatment or diagnosis products |
| CN106498062A (en) * | 2016-11-04 | 2017-03-15 | 邱宾涛 | A kind of product of diagnosis of prostate cancer and its application |
| CN106754908A (en) * | 2017-01-19 | 2017-05-31 | 中南大学湘雅二医院 | Prepare diagnosis and molecular target and its application for the treatment of colon cancer drug |
| CN108728535A (en) * | 2018-05-26 | 2018-11-02 | 复旦大学 | Applications of the hsa_circ_0049154 as prostate cancer molecular target in preparing drug and kit |
| WO2018219264A1 (en) * | 2017-06-01 | 2018-12-06 | 上海长海医院 | Use of long-chain non-coding rna as prostatic cancer molecule marker |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1995969A (en) * | 2006-09-14 | 2007-07-11 | 南开大学 | Reagent kit for detecting human prostatic cancer micro-metastasis by using real-time fluorescence quantitative RT-PCR technology |
| CN101768214A (en) * | 2008-10-06 | 2010-07-07 | 复旦大学 | Human tumor marker-Tim17 polypeptide and application thereof |
| CN104651492A (en) * | 2015-01-06 | 2015-05-27 | 中国人民解放军第二军医大学 | Application of miRNA410- in preparation of prostatic cancer diagnostic kit |
-
2015
- 2015-09-16 CN CN201510590470.2A patent/CN105154448A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1995969A (en) * | 2006-09-14 | 2007-07-11 | 南开大学 | Reagent kit for detecting human prostatic cancer micro-metastasis by using real-time fluorescence quantitative RT-PCR technology |
| CN101768214A (en) * | 2008-10-06 | 2010-07-07 | 复旦大学 | Human tumor marker-Tim17 polypeptide and application thereof |
| CN104651492A (en) * | 2015-01-06 | 2015-05-27 | 中国人民解放军第二军医大学 | Application of miRNA410- in preparation of prostatic cancer diagnostic kit |
Non-Patent Citations (5)
| Title |
|---|
| CHENG-CHENG HU ET AL.: "Identification of Prostate Cancer LncRNAs by RNA-Seq", 《ASIAN PACIFIC JOURNAL OF CANCER PREVENTION》 * |
| GUANGFU JIN ET AL.: "Human polymorphisms at long non-coding RNAs (lncRNAs) and association with prostate cancer risk", 《CARCINOGENESIS》 * |
| JOHN R PRENSNER ET AL.: "Transcriptome sequencing across a prostate cancer cohort identifies PCAT-1, an unannotated lincRNA implicated in disease progression", 《NATURE BIOTECHNOLOGY》 * |
| LNCRNAWIKI: "NONHSAT100967", 《LNCRNAWIKI》 * |
| W. S. CHENG ET AL.: "Both genes and lncRNAs can be used as biomarkers of prostate cancer by using high throughput sequencing data", 《EUROPEAN REVIEW FOR MEDICAL AND PHARMACOLOGICAL SCIENCES》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106367507A (en) * | 2016-09-09 | 2017-02-01 | 北京致成生物医学科技有限公司 | Application of LOC283856 in preparation of prostatic cancer early treatment or diagnosis products |
| CN106148557A (en) * | 2016-09-14 | 2016-11-23 | 北京致成生物医学科技有限公司 | Application in preparing prostate cancer diagnosis product for the LOC100129066 |
| CN106148561A (en) * | 2016-09-28 | 2016-11-23 | 北京致成生物医学科技有限公司 | The diagnosis and treatment label of carcinoma of prostate |
| CN106498062A (en) * | 2016-11-04 | 2017-03-15 | 邱宾涛 | A kind of product of diagnosis of prostate cancer and its application |
| CN106754908A (en) * | 2017-01-19 | 2017-05-31 | 中南大学湘雅二医院 | Prepare diagnosis and molecular target and its application for the treatment of colon cancer drug |
| CN106754908B (en) * | 2017-01-19 | 2020-03-24 | 中南大学湘雅二医院 | Molecular target for preparing medicine for diagnosing and treating colon cancer and application thereof |
| WO2018219264A1 (en) * | 2017-06-01 | 2018-12-06 | 上海长海医院 | Use of long-chain non-coding rna as prostatic cancer molecule marker |
| CN108728535A (en) * | 2018-05-26 | 2018-11-02 | 复旦大学 | Applications of the hsa_circ_0049154 as prostate cancer molecular target in preparing drug and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105154448A (en) | Prostatic cancer molecular target RP11-1023L17.1 and application thereof to diagnostic kit | |
| CN108728535A (en) | Applications of the hsa_circ_0049154 as prostate cancer molecular target in preparing drug and kit | |
| CN105316340A (en) | MIR27A-3P serving as prostate cancer molecular marker and application of same to diagnostic reagent kit | |
| CN105154447A (en) | Prostatic cancer molecular target AC016745.3 and application thereof to diagnostic kit | |
| CN108624688A (en) | Applications of the hsa_circ_0012755 as prostate cancer molecular target in preparing drug and kit | |
| Piao et al. | Urinary cell‐free microRNA biomarker could discriminate bladder cancer from benign hematuria | |
| Ross et al. | Clarifying the PSA grey zone: The management of patients with a borderline PSA | |
| Singh et al. | Epithelial-to-mesenchymal transition and its correlation with clinicopathologic features in patients with urothelial carcinoma of the bladder | |
| CN109628591B (en) | Marker for prognosis prediction of lung adenocarcinoma | |
| Nikas et al. | Genome-wide DNA methylation model for the diagnosis of prostate cancer | |
| Ge et al. | PSME4 activates mTOR signaling and promotes the malignant progression of hepatocellular carcinoma | |
| Jain et al. | Urinary extracellular vesicles miRNA—A new era of prostate cancer biomarkers | |
| Juan et al. | ZNF582 hypermethylation as a prognostic biomarker for malignant transformation of oral lesions | |
| CN104611430A (en) | Detection method and primers for TMPRSS2-ERG gene in human urine | |
| Sun et al. | The value and clinical significance of tumor marker detection in cervical cancer | |
| Zhu et al. | Preneoplastic and primary scrotal cancer: updates on pathogenesis and diagnostic evaluation | |
| CN107164535A (en) | A kind of noninvasive high flux methylates diagnosis of colon cancer, research and treatment method | |
| CN108085385A (en) | A kind of colorectal cancer biomarker and its application | |
| Yan et al. | miR‐203 Expression in Exfoliated Cells of Tongue Coating Represents a Sensitive and Specific Biomarker of Gastroesophageal Reflux Disease | |
| Kulasinghe et al. | Current trends and management in head and neck cancers | |
| CN106367477A (en) | Serum miRNA marker related to auxiliary diagnosis of colorectal cancer, and application thereof | |
| Zong et al. | RETRACTED ARTICLE: miR-30d Induced Apoptosis by Targeting Sox4 to Inhibit the Proliferation, Invasion and Migration of Nephroblastoma | |
| CN106282366A (en) | A kind of molecular marked compound relevant to carcinoma of prostate and application thereof | |
| Qi et al. | [Retracted] miR‐18a‐5p and ATM Expression in Esophageal Squamous Cell Carcinoma and Their Correlations with Clinicopathological Features | |
| CN105256025A (en) | Fluorescent quantitative PCR (polymerase chain reaction) detection kit for ERCC1 (excision repair cross-complementing 1) gene expression quantity and application of kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151216 |
|
| WD01 | Invention patent application deemed withdrawn after publication |