CN112553333B

CN112553333B - Application of miR-1207 and target gene thereof in detection of laryngeal squamous cell carcinoma

Info

Publication number: CN112553333B
Application number: CN202011442585.4A
Authority: CN
Inventors: 崔晓峰; 陈向军; 张思林
Original assignee: Shenzhen Hospital of Southern Medical University
Current assignee: Shenzhen Hospital of Southern Medical University
Priority date: 2020-12-08
Filing date: 2020-12-08
Publication date: 2022-03-08
Anticipated expiration: 2040-12-08
Also published as: CN112553333A

Abstract

The invention discloses miR-1207 and an application of a target gene thereof in detection of laryngeal squamous cell carcinoma, wherein the target gene is LOC339685 or LOC 400706. The invention discloses an application of a reagent for detecting LOC339685 or LOC400706 in preparing a product for diagnosing laryngeal squamous cell carcinoma, and also discloses an application of LOC339685 or LOC400706 in preparing a medicament for treating laryngeal squamous cell carcinoma.

Description

Application of miR-1207 and target gene thereof in detection of laryngeal squamous cell carcinoma

Technical Field

The invention relates to the field of molecular diagnosis, in particular to application of miR-1207 and a target gene thereof in detection of laryngeal squamous cell carcinoma.

Background

Laryngeal cancer is one of the common malignancies in the head and neck, with 96-98% of the pathological types being squamous cell carcinoma of the Larynx (LSCC). According to the latest data compiled by the International Cancer research organization, the number of new cases of laryngeal Cancer worldwide in 2018 is 17.74 ten thousand, and the number of cases of death is 9.48 ten thousand (Bray F, Ferlay J, Soerjomataram I, et al. Global Cancer statistics 2018: GLOBOCAN esters of incidences and mortality world wide for 36cancers in 185countries [ J ]. CA Cancer J C1in,2018,68(6):394 424.); the recent statistical data in China shows that the number of new cases of laryngeal Cancer in 2015 is 2.64 ten thousand and the number of death cases is 1.45 ten thousand (Chen W, Zheng R, Baade PD, et al Cancer statistics in China,2015[ J ]. CA Cancer J Clin,201666(2): 115-. Although the incidence and mortality of laryngeal cancer are relatively low, the incidence and mortality of laryngeal cancer are on the rise in recent years, and the incidence of laryngeal cancer in northeast and northeast China is much higher than that in south province of Yangtze river (Chenvinger, Wangben, Gao Wei, etc.. analysis of epidemiological characteristics and influencing factors of laryngeal cancer [ J ]. contemporary Chinese medicine 2015,22(12): 43-46.). At present, according to foreign studies, the 5-year survival rate of patients with laryngeal Cancer is 61% (Miller KD, Siegel RL, Lin CC, et al. Cancer treatment and subvorship statistics,2016[ J ]. CA Cancer J Clin,2016,66(4): 271-289), while the 5-year survival rate is significantly different due to different clinical stages. Wherein the 5-year survival rate of the early patients can reach 80-90%. There are no standard treatment strategies available to improve patient survival, particularly in patients with intermediate and advanced laryngeal carcinoma. A patient can achieve a relatively ideal result through an operation or radiotherapy, while a middle-and-late-stage patient needs to reconstruct and maintain the function of the larynx as much as possible under the condition of ensuring the survival rate by combining the measures of the operation, the radiotherapy, the chemotherapy, the biotherapy and the like according to the self condition, and the postoperative life quality of the patient is ensured (Lehuijijijijijijijijun, Chenthink, Liyun, and the like, the diagnosis and treatment strategy and the progress of the laryngeal cancer [ J ] clinical otorhinolaryngopharynx, neck and neck surgery, 2019,33(11): 1017-. Therefore, the search for effective molecular markers will provide new exploratory directions for the treatment of laryngeal cancer.

MicroRNA (miRNA), also known as microRNA, is widely found in eukaryotes, has a base length of about 21-25 bases, is not relatively long, is a non-coding RNA species, and has an important function in that it can regulate gene expression at the transcriptional or translational level by specifically interacting with a target gene sequence, and then initiate downstream signaling pathways to regulate cell proliferation, differentiation, apoptosis, and lipometabolism, as well as various other biological processes. Numerous studies have shown that miRNA are closely related to the development and development of tumors (Pang Y, Young CY, Yeast H. MicroRNAs and state cancer [ J ] Acta Biochim Biophys Sin,2010,42(6): 363-. The research on the relation between miRNA and target gene thereof and laryngeal squamous cell carcinoma has important significance for effectively predicting laryngeal squamous cell carcinoma, searching potential molecular targets, making correct treatment schemes and judging prognosis.

Disclosure of Invention

In order to remedy the deficiencies of the prior art, it is an object of the present invention to provide biomarkers associated with the development of laryngeal squamous cell carcinoma.

It is another object of the present invention to provide a means and product for diagnosing laryngeal squamous cell carcinoma using the expression level of biomarkers.

The third object of the present invention is to provide a means and a drug for treating laryngeal squamous cell carcinoma using an inhibitor of a biomarker.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides application of a reagent for detecting a biomarker in preparation of a product for diagnosing laryngeal squamous cell carcinoma, wherein the biomarker is a target gene LOC339685 or LOC400706 regulated and controlled by miR-1207.

Further, miR-1207 is mature miR-1207-3p, miR-1207-3p is expressed in a patient with laryngeal squamous cell carcinoma in a down-regulation mode, and LOC339685 or LOC400706 is expressed in a patient with laryngeal squamous cell carcinoma in an up-regulation mode.

Further, the agent is selected from:

a probe that specifically recognizes the biomarker; or

Primers for specific amplification of biomarkers.

Further, the sequences of the amplified LOC339685 or LOC400706 are shown in SEQ ID NO.3-4 and SEQ ID NO.5-6, respectively.

The invention provides a product for diagnosing laryngeal squamous cell carcinoma, which comprises a reagent for detecting a target gene LOC339685 or LOC400706 regulated by miR-1207.

Further, the product comprises a chip or a kit.

Further, the chip includes: a solid phase carrier and a probe which is attached to the solid phase carrier and specifically recognizes LOC339685 or LOC 400706. The solid phase carrier comprises plastic products, microparticles, membrane carriers and the like. The most common plastic products are small test tubes, beads and microplates made of polystyrene; the microparticles are microspheres or particles polymerized by high molecular monomers, and the diameter of the microparticles is mostly micron; the membrane carrier comprises microporous filter membranes such as nitrocellulose membrane, glass cellulose membrane and nylon membrane.

Further, the kit comprises a primer, a probe or a chip which specifically binds to LOC339685 or LOC 400706.

Further, the kit also comprises a nucleic acid extraction reagent, a polymerase chain reaction reagent, a color developing agent or indicator, nucleic acid analysis software or an instruction for use.

Such a kit may employ, for example, a test strip, membrane, chip, tray, test strip, filter, microsphere, slide, multiwell plate, or optical fiber. The solid support of the kit can be, for example, a plastic, a silicon wafer, a metal, a resin, a glass, a membrane, a particle, a precipitate, a gel, a polymer, a sheet, a sphere, a polysaccharide, a capillary, a film, a plate, or a slide.

The invention provides application of a biomarker in construction of a calculation model for predicting laryngeal squamous cell carcinoma, wherein the biomarker is a target gene LOC339685 or LOC400706 regulated and controlled by miR-1207, and the calculation model is constructed by taking the expression level of LOC339685 or LOC400706 as an input variable.

The invention provides application of a biomarker in preparation of a medicine for treating laryngeal squamous cell carcinoma, wherein the biomarker is a target gene LOC339685 or LOC400706 regulated and controlled by miR-1207.

Further, the drug comprises an inhibitor of LOC339685 or LOC 400706.

Further, the inhibitor is a nucleic acid inhibitor of LOC339685 or LOC 400706.

Further, the nucleic acid inhibitor is siRNA.

Further, the sequence of the siRNA is shown in SEQ ID NO. 11-14.

The invention provides a medicament for treating laryngeal squamous carcinoma, which comprises an inhibitor of LOC339685 or LOC 400706.

Further, the inhibitor reduces the expression level of LOC339685 or LOC 400706.

Further, the inhibitor is a nucleic acid inhibitor of LOC339685 or LOC 400706.

Further, the nucleic acid inhibitor is siRNA.

Further, the sequence of the siRNA is shown in SEQ ID NO. 11-14.

Further, the medicament also comprises a pharmaceutically acceptable carrier, including (but not limited to) diluents, binders, surfactants, humectants, adsorption carriers, lubricants, fillers and disintegrating agents.

In the present invention, the term "level of expression" or "expression level" generally refers to the amount of a biomarker in a biological sample. "expression" generally refers to the process by which information (e.g., gene coding and/or epigenetic information) is converted into structures present and operating in a cell. Thus, as used herein, "expression" may refer to transcription into a polynucleotide, translation into a polypeptide, or even polynucleotide and/or polypeptide modifications (e.g., post-translational modifications of a polypeptide). Transcribed polynucleotides, translated polypeptides, or fragments of a polynucleotide and/or polypeptide modification (e.g., post-translational modification of a polypeptide) should also be considered expressed, whether they are derived from transcripts generated by alternative splicing or degraded transcripts, or from post-translational processing of a polypeptide (e.g., by proteolysis). "expressed genes" include genes that are transcribed into a polynucleotide (e.g., mRNA) and then translated into a polypeptide, as well as genes that are transcribed into RNA but not translated into a polypeptide (e.g., transport and ribosomal RNA, miRNA, IncRNA). As a preferred embodiment, "expressed gene" refers to a gene that is transcribed into RNA but not translated into a polypeptide.

"expression upregulation" refers to increased expression or increased level of a biomarker in an individual relative to a control, such as an individual without a disease or disorder (e.g., cancer), an internal control (e.g., a housekeeping biomarker), or the median expression level of a biomarker in a sample from one patient group/population.

"downregulating expression" refers to a reduced expression or reduced level of a biomarker in an individual relative to a control, such as an individual without a disease or disorder (e.g., cancer) or an internal control (e.g., a housekeeping biomarker), or the median expression level of the biomarker in a sample from one patient group/population. In some embodiments, the reduced expression is little or no expression.

In the present invention, LOC339685 is located on chromosome 22, and the ensembles number is ENSG00000224715, including LOC339685 gene and homologs, mutations, and isoforms thereof. The term encompasses full length, unprocessed LOC339685, as well as any form of LOC339685 that results from processing in a cell. The term encompasses naturally occurring variants (e.g., splice variants or allelic variants) of LOC 339685. A representative sequence of LOC339685 is shown in ENST00000434707.1(SEQ ID NO. 1).

LOC400706 is located on chromosome 19, and the ensembles number is ENSG00000204869, including the LOC400706 gene and homologs, mutations, and isoforms thereof. The term encompasses full length, unprocessed LOC400706, as well as any form of LOC400706 that results from processing in a cell. The term encompasses naturally occurring variants (e.g., splice variants or allelic variants) of LOC 400706. A representative sequence of LOC400706 is shown in ENST00000596694.1(SEQ ID NO. 2).

In the present invention, the term "primer" means an oligonucleotide, whether naturally occurring or synthetically produced in a purified restriction digest, that is capable of acting as a synthesis origin when placed under conditions which induce synthesis of a primer extension product complementary to a nucleic acid strand, i.e., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH. The primer may be single-stranded or double-stranded and must be long enough to prime synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer depends on many factors, including temperature, source of primer, and method of use. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides. Factors involved in determining the appropriate length of a primer will be readily known to those skilled in the art.

The term "probe" refers to a molecule that is capable of binding selectively to a specifically intended target biomolecule, such as a nucleotide transcript or protein encoded by or corresponding to an intrinsic gene. Probes may be synthesized by one skilled in the art, or may be derived from a suitable biological preparation. Probes can be specifically designed to label them. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules. In a preferred embodiment, the molecules used as probes include RNA and DNA.

As the probe, a labeled probe in which a polynucleotide for cancer detection is labeled, such as a fluorescent label, a radioactive label, or a biotin label, can be used. Methods for labeling polynucleotides are known per se. The presence or absence of the test nucleic acid in the sample can be checked by: immobilizing the test nucleic acid or an amplification product thereof, hybridizing with the labeled probe, washing, and then measuring the label bound to the solid phase. Alternatively, the polynucleotide for cancer detection may be immobilized, a nucleic acid to be tested may be hybridized therewith, and the nucleic acid to be tested bound to the solid phase may be detected using a labeled probe or the like. In this case, the polynucleotide for cancer detection bound to the solid phase is also referred to as a probe. Methods for assaying test nucleic acids using polynucleotide probes are also well known in the art. The process can be carried out as follows: the polynucleotide probe is contacted with the test nucleic acid at or near Tm (preferably within ± 4 ℃) in a buffer for hybridization, washed, and the hybridized labeled probe or template nucleic acid bound to the solid phase probe is then measured.

The size of the polynucleotide used as a probe is preferably 18 or more nucleotides, more preferably 20 or more nucleotides, and the entire length of the coding region or less. When used as a primer, the polynucleotide is preferably 18 or more nucleotides in size, and 50 or less nucleotides in size. These probes have a base sequence complementary to a specific base sequence of a target gene.

The primers or probes of the invention can be chemically synthesized using a solid phase support of phosphoramidite or other well known methods. The nucleic acid sequence may also be modified using a number of means known in the art. Non-limiting examples of such modifications are methylation, capping, substitution with one or more analogs of a natural nucleotide, and modification between nucleotides, for example, modification of an uncharged linker (e.g., methyl phosphate, phosphotriester, phosphoimide, carbamate, etc.), or modification of a charged linker (e.g., phosphorothioate, phosphorodithioate, etc.).

Many expression detection methods use isolated RNA. The starting material is typically total RNA isolated from a biological sample, e.g. from a tumor or tumor cell line, respectively, and a corresponding normal tissue or cell line. If the source of the RNA is a primary tumor, RNA may be extracted from a frozen or preserved paraffin-embedded and fixed (e.g., formalin-fixed) tissue sample.

In the present invention, "chip", also referred to as "array", refers to a solid support comprising attached nucleic acid or peptide probes. Arrays typically comprise a plurality of different nucleic acid or peptide probes attached to the surface of a substrate at different known locations. These arrays, also known as "microarrays," can generally be produced using either mechanosynthesis methods or light-guided synthesis methods that incorporate a combination of photolithography and solid-phase synthesis methods. The array may comprise a flat surface, or may be nucleic acids or peptides on beads, gels, polymer surfaces, fibers such as optical fibers, glass, or any other suitable substrate. The array may be packaged in a manner that allows for diagnostic or other manipulation of the fully functional device.

A "microarray" is an ordered array of hybridization array elements, such as polynucleotide probes (e.g., oligonucleotides) or binding agents (e.g., antibodies), on a substrate. The matrix may be a solid matrix, for example, a glass or silica slide, beads, a fiber optic binder, or a semi-solid matrix, for example, a nitrocellulose membrane. The nucleotide sequence may be DNA, RNA or any permutation thereof.

In the present invention, the biomarker inhibitor is an agent that targets a sequence of a marker and is capable of inhibiting the expression level of the biomarker, and comprises: shRNA (small hairpin RNA), small interfering RNA (siRNA), dsRNA, microRNA, antisense nucleic acid, or a construct capable of expressing or forming the shRNA, small interfering RNA, dsRNA, microRNA, antisense nucleic acid, or the like.

As a preferred mode of the invention, the inhibitor of LOC339685 or LOC400706 is a specific small interfering RNA molecule. As used herein, the term "small interfering RNA" refers to a short segment of double-stranded RNA molecule that targets RNA of homologous complementary sequence to degrade a specific RNA, a process known as RNA interference. Small interfering RNA can be prepared as a double-stranded nucleic acid form, which contains a sense and an antisense strand, the two strands only in hybridization conditions to form double-stranded. A double-stranded RNA complex can be prepared from the sense and antisense strands separated from each other. Thus, for example, complementary sense and antisense strands are chemically synthesized, which can then be hybridized by annealing to produce a synthetic double-stranded RNA complex.

The invention has the advantages and beneficial effects that:

the invention discovers that the expression levels of miR-1207-3p and target genes LOC339685 and LOC400706 thereof are related to laryngeal squamous cell carcinoma for the first time, and whether the subject suffers from laryngeal squamous cell carcinoma or not and the risk of suffering from laryngeal squamous cell carcinoma can be judged by detecting the expression levels of miR-1207-3p and target genes LOC339685 and LOC400706 thereof in a sample of the subject, so that a clinician is guided to provide a prevention scheme or a treatment scheme for the subject, and meanwhile, a molecular marker is adopted for diagnosis, so that compared with the traditional diagnosis means, the diagnosis is more timely, more sensitive and more specific.

The invention firstly discovers that the change of the expression level of LOC339685 or LOC400706 can affect the proliferation and migration of laryngeal squamous carcinoma cells, and therefore, the treatment of laryngeal squamous carcinoma can be realized by changing the expression level of LOC339685 or LOC 400706.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. Those of ordinary skill in the art will understand that: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The following examples are examples of experimental methods not indicating specific conditions, and the detection is usually carried out according to conventional conditions or according to the conditions recommended by the manufacturers.

Example 1 screening for biomarkers associated with laryngeal squamous cell carcinoma

1. Sample collection

6 laryngeal squamous carcinoma tissues and corresponding paracarcinoma tissue samples are collected and subjected to high-throughput sequencing.

2. Preparation and Mass analysis of RNA samples

Tissue RNA was extracted using the TRIZOL method, as follows:

1) the mortar was pre-cooled with liquid nitrogen, and the tissue sample was placed in the mortar with liquid nitrogen and ground well into powder under liquid nitrogen.

2) Transferring the sample powder into a 2.0mL EP tube filled with TRIzol lysate, shaking violently, mixing well, laying flat and standing at room temperature for 5-10 min.

3)10000rpm, 4 ℃ for 5 min.

4) The supernatant was pipetted into a fresh 2.0mL EP tube and 200. mu.L chloroform/isoamyl alcohol per mL lysate was added and mixed by vigorous inversion.

5)10000rpm, 4 ℃ for 10 min.

6) Pipette the supernatant into a new 1.5mL centrifuge tube, pay attention to not pipette the middle protein layer, add equal supernatant volume of isopropanol, mix by gentle inversion.

7) Putting into a refrigerator at-20 deg.C for precipitation for 1 h.

8)13600rpm, 4 ℃ for 20 min.

10) The supernatant was aspirated off, 1mL of 75% ethanol was added, and the pellet was purged with a pipette.

11) Centrifuging at 4 deg.C for 3min at 10000rpm, removing supernatant, centrifuging for a short time, removing residual liquid, and air drying for 3-5 min.

12) The precipitate was dissolved with 30-100. mu.L of DEPC water or RNase-free water.

13) Total RNA concentration, RIN value, 28S/18S and fragment size were measured using an Agilent 2100Bioanalyzer (Agilent RNA 6000Nano Kit).

3. Library construction and sequencing on computer

The library construction and the machine sequencing are completed by the Huada gene.

3.1 transcriptome banking and sequencing

1) Total RNA DNase I digestion: digesting DNA fragments existing in a Total RNA sample by using DNase I, purifying and recovering reaction products by using magnetic beads, and finally dissolving the reaction products in DEPC water;

2) removing rRNA: taking a digested Total RNA sample, removing rRNA by using a kit, carrying out Agilent 2100 detection after the rRNA is removed, and verifying the rRNA removal effect;

3) RNA disruption: taking the sample in the previous step, adding a breaking Buffer, and placing the sample in a PCR instrument for thermal breaking till 140-;

4) reverse transcription one-strand synthesis: adding a proper amount of primers into the broken mRNA, fully and uniformly mixing, reacting for a certain time at a proper temperature of a Thermomixer to open a secondary structure and combine with the primers, adding a one-chain synthesis reaction system prepared in advance, and synthesizing one-chain cDNA on a PCR instrument according to a corresponding procedure;

5) synthesis of reverse transcription duplex: preparing a double-chain synthesis reaction system, reacting on a Thermomixer at a proper temperature for a certain time to synthesize double-chain cDNA, and purifying and recovering reaction products by using a kit;

6) and (3) repairing the tail end: preparing a terminal repair reaction system, reacting in a Thermomixer at a proper temperature for a certain time, and repairing the cohesive terminal of the cDNA double-chain obtained by reverse transcription under the action of enzyme. Purifying and recovering the end repairing product by using a kit, and finally dissolving a sample in EB Solution;

7) 3' end of cDNA plus "A": preparing an A reaction system, reacting in a Thermomixer at a proper temperature for a certain time, and adding A base at the 3' end of the product cDNA with the repaired end under the action of enzyme. Adding the product A and purifying and recovering the product A by using a kit;

8) ligation of cDNA 5' adapter: preparing a joint ligase reaction system, reacting in a Thermomixer at a proper temperature for a certain time, connecting a joint with the A base under the action of enzyme, and purifying and recovering a product by using a kit;

9) UNG digested cDNA double strand: preparing a UNG digestion reaction system, digesting two strands in double-stranded DNA by UNG enzyme, and purifying and recovering a product by using magnetic beads;

10) PCR reaction and product recovery: and (3) preparing a PCR reaction system, selecting a proper PCR reaction program, and amplifying the ligation product obtained in the previous step. And (3) carrying out agarose gel electrophoresis on the PCR product, cutting the gel, selecting the size of the required DNA fragment, and purifying and recovering by using a kit. The recovered product was dissolved in EB solution. Labeling, and preparing the library to finish the preparation;

11) and (3) detecting the quality of the library: library quality was checked using Agilent 2100Bioanalyzer and ABI StepOneNuplus Real-time PCR System;

12) and (3) machine sequencing: sequencing was performed using the Illumina Hiseq x-ten platform, PE150 strategy.

3.2 Small RNA library construction and sequencing

1) RNA fragment selection Total RNA was gel cut using PAGE electrophoresis to separate 18-30nt RNA.

2)3 'linker ligation the 3' end of the RNA of 1) was ligated using a single stranded DNA linker of 5-amplified, 3-blocked.

3) Annealing of reverse transcription primer RT primer is added into the system of 2), hybridized with 3 'adaptor connected to RNA and hybridized with redundant free 3' adaptor.

4) 5' adaptor ligation to the 5' end of the product in 3) greatly reduces adaptor self-ligation since the adaptor preferentially ligates to single stranded molecules and not to the 3' adaptor and the hybridizing strand of the RT primer.

5) One-strand cDNA synthesis, reverse transcription and extension are carried out by the RT primer in 3), and one-strand cDNA is synthesized.

6) And (3) PCR amplification, namely amplifying the cDNA by using high-sensitivity polymerase, enriching the cDNA simultaneously connected with a 3 'joint and a 5' joint, and amplifying the yield of the library.

7) Library fragment selection, using PAGE electrophoresis to separate PCR products in the range of 100-120bp, effectively removing by-products such as primer dimer and the like.

8) Library quantification and pooling cyclization.

9) And (3) machine sequencing: sequencing on a BGISEQ-500 platform, SE50 strategy.

4. Bioinformatics analysis

Performing bioinformatics analysis on the lncRNA and the small RNA which are differentially expressed, screening differentially expressed genes, and performing limma package analysis on the differentially expressed lncRNA, wherein the adopted standard is that p is less than 0.05; analyzing differentially expressed miRNA by meta package, wherein the adopted standard is p <0.05, | combined.ES | > 1; algorithms including miRWalk, miRanda, RNAhybrid and Targetscan were used to predict lncrnas targeted for differentially expressed mirnas.

5. Results

Sequencing results show that the expression of miR-1207-3p in laryngeal squamous cell carcinoma is remarkably reduced, target gene prediction software is utilized, and the results of differential expression of lncRNA in sequencing are combined, so that LOC339685 and LOC400706 with outstanding effects are selected from targeted and negatively correlated differential expression RNAs for subsequent verification, and the expression of LOC339685 and LOC400706 in laryngeal squamous cell carcinoma is remarkably increased.

Example 2 QPCR detection of expression of miRNA target genes in laryngeal squamous cell carcinoma samples

1. Large sample QPCR validation of differentially expressed genes was performed on 29 cancer tissue samples and paracancerous tissue samples of patients with laryngeal squamous cell carcinoma collected as described in example 1.

2. Extraction of RNA

Tissue RNA was extracted using TRIZOL method, as described in example 1.

3. Reverse transcription to synthesize cDNA

3.1 Synthesis of IncRNA cDNA by reverse transcription

mRNA reverse transcription was performed using the FastQuant cDNA first strand synthesis kit (cat # KR 106).

1) Reaction for removing genomic DNA, 5 Xg DNA Buffer 2.0. mu.l, TotalRNA 1. mu.g, RNase Free ddH₂O brought the total volume to 10. mu.l.

2) Heating in water bath at 42 deg.C for 3 min.

3)10 XFast RT Buffer 2.0. mu.l, RT Enzyme Mix 1.0. mu.l, FQ-RT Primer Mix 2.0. mu.l, RNase Free ddH₂O5.0. mu.l was mixed and added to the above tube to mix together for a total of 20. mu.l.

4) Heating in water bath at 42 deg.C for 15min, and heating at 95 deg.C for 3 min.

3.2 reverse transcription Synthesis of miRNA cDNA

MiRcute Plus miRNA First-Strand cDNA Synthesis Kit (cat # KR211-02) was used for miRNA cDNA reverse transcription.

1) Respectively adding 2 mu g of Total RNA, 10 mu l of 2 XmiRNA RT Reaction Buffer and 10 mu l of MiRNA RT E into a test tubenzyme Mix 2μl，RNase-Free ddH₂O, supplement to 20 μ l, mix gently

2) Heating in water bath at 42 deg.C for 60min, and heating at 95 deg.C for 3 min.

4、Real-Time PCR

4.1 primer design

Primers for amplifying genes were designed based on the gene sequences, the specific sequences of the primers are shown in Table 1, the specific primers were synthesized by Bomaide corporation or purchased from Tiangen corporation, and dual internal references GAPDH and β -Actin were used for the detection of LOC339685 and LOC 400706.

TABLE 1 primer sequences

Primer name	Primer sequences (5'to3')	Sequence numbering
			LOC339685-F	GTGACCTGAGCCAAGATG	SEQ ID NO.3
LOC339685-R	GTGACGATTGTGAGAGTGT	SEQ ID NO.4
			LOC400706-F	ATAGGAGGTCAGAACAAG	SEQ ID NO.5
LOC400706-R	CAGTGAGGACAATTAGAAG	SEQ ID NO.6
			GAPDH-F (internal reference)	GGAGCGAGATCCCTCCAAAAT	SEQ ID NO.7
GAPDH-R (internal reference)	GGCTGTTGTCATACTTCTCATGG	SEQ ID NO.8
			ACTB-F (internal reference) (direct purchase)	CATGTACGTTGCTATCCAGGC	SEQ ID NO.9
ACTB-R (internal reference) (direct purchase)	CTCCTTAATGTCACGCACGAT	SEQ ID NO.10

4.2 fluorescent quantitative detection of IncRNA

Amplification was carried out using SuperReal PreMix Plus (SYBR Green) (cat # FP205) according to the instructions for the product, and the reaction system is shown in Table 2.

TABLE 2Real Time reaction System

Reagent	Volume of
		2×SuperReal PreMix Plus	10μl
Upstream primer (10uM)	0.6μl
		Downstream primer (10uM)	0.6μl
50×ROX Reference Dye^△	2μl
		DNA template	2μl
Sterilized distilled water	4.8μl

The amplification procedure was: 95 ℃ for 15min, (95 ℃ for 10s, 55 ℃ for 30s, 72 ℃ for 30s) x 40 cycles, 95 ℃ for 15s, 60 ℃ for 60s, 95 ℃ for 15 s.

4.3 data analysis

According to the original detection result of Real-Time PCR, according to 2^-△△ctAnd calculating the relative quantitative result of the target gene of each sample by using a relative quantitative calculation formula, and calculating the difference of the transcription level of the target gene of each other sample relative to the control sample.

5. Results

Compared with the expression levels (normalized to 1) of the genes LOC339685 and LOC400706 in the para-carcinoma tissues, the expression of the miRNA target genes LOC339685(2.32 +/-0.460) and LOC400706(3.68 +/-0.389) in the laryngeal squamous carcinoma tissues is up-regulated, the difference has statistical significance (P <0.05), and the high-throughput sequencing result is consistent, so that whether the subject has laryngeal squamous carcinoma can be diagnosed by the expression levels of the LOC339685 and LOC 400706. Through the relationship between LOC339685 and LOC400706 laryngeal squamous cell carcinoma, shRNA and siRNA targeting LOC339685 and LOC400706 can be designed to treat the laryngeal squamous cell carcinoma.

Example 3 silencing of genes and Effect on laryngeal squamous carcinoma cells

1. Cell culture

Human laryngeal squamous carcinoma cell line Hep2 is cultured in RPMI1640 medium (containing fetal calf serum 10%) at 37 deg.C and 5% CO₂Culturing and subculturing under saturated humidity condition.

2. Transfection

And (3) inoculating Hep-2 cells in the logarithmic growth phase to a 6-well plate, performing grouping transfection when the fusion of the cells reaches 80-90%, wherein a transfection reagent adopts Lipofectamine 2000. The experiment was divided into three groups: blank control group (Hep-2); negative control group (transfection general siRNA-NC); experimental groups: siRNA was transfected.

siRNA interfering fragments aiming at LOC339685 and LOC400706 genes (shown in Table 3) are designed and synthesized by Shanghai Ji code pharmaceutical technology Limited.

TABLE 3siRNA sequences

3. QPCR detection of the expression level of lncRNA

And collecting cells 48h after transfection, extracting total RNA of the cells, measuring the RNA content by an ultraviolet spectrophotometer, and carrying out QPCR detection on the expression levels of LOC339685 and LOC400706 according to the method described in example 2.

4. CCK-8 experiment for detecting cell proliferation capacity

The cells of each group were collected, cell-digested, centrifuged, resuspended, and seeded at a concentration of 2000 cells/100. mu.L/well in 96-well plates at 37 ℃ with 5% CO₂And (5) culturing. After 24, 48 and 72 hours after transfection, 10 microliter of CCK8 cell proliferation reagent is added into each well in a dark place for culturing for 4 hours, an enzyme labeling instrument detects OD values, the experiment is repeated for 3 times, and the average value of the 3 experiments is taken.

5. Transwell chamber for detecting invasion capacity of cells

48h after cell transfection, each group of cells was cultured for 12h with serum-free medium. Pancreatin digestion to prepare cell suspension with cell concentration of 2X 10⁶Per mL; adding 100 mu L of cell suspension into an upper chamber of a Transwell chamber, wherein each group is provided with 3 multiple holes; adding 6 into each hole in the lower chamber00 mu L of RPMI1640 medium containing 20% of FBS, incubating for 12h, taking out the chamber, removing the culture solution, wiping off cells which do not penetrate through the membrane with a cotton swab, fixing the lower chamber surface with 95% alcohol for 15min, staining the chamber, observing by a microscope, randomly selecting 5 high-power visual fields, counting the number of the cells penetrating through the ECMatrix membrane, repeating the experiment for 3 times, taking the average value of the 3 experiments, and representing the invasiveness of the tumor cells by using the number of the cells.

6. Statistical method

The result data are all expressed in a mean value plus or minus standard deviation mode, statistical analysis is carried out by SPSS18.0 statistical software, single-factor variance analysis or variance analysis of factorial design data is adopted for comparison among groups, a T test method is adopted for pairwise comparison among the groups, and the difference of a test level P <0.05 is of statistical significance.

7. Results

(1) The silencing effect of siRNA on genes is shown in table 4, compared with the blank control group, there is no significant change in siRNA-NC, while the expression levels of LOC339685 and LOC400706 in the experimental group are significantly down-regulated.

TABLE 4 relative expression levels of the genes in each group

(2) The experiment results of CCK-8 for detecting the cell proliferation capacity are shown in Table 5, the OD value of the experimental group is obviously reduced compared with that of the negative control group, and LOC339685 and LOC400706 play an important role in the proliferation of laryngeal squamous cell carcinoma cells.

TABLE 5 OD values of the cells of each group

(3) The invasion test results are shown in table 6, compared with the negative control group (siRNA-NC), the number of transmembrane cells of the experimental group is significantly reduced (P <0.05), which indicates that LOC339685 and LOC400706 play important roles in infiltration and metastasis of laryngeal squamous cell carcinoma.

TABLE 6 number of transmembrane cells in each group

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> Shenzhen Hospital of southern medical university

<120> miR-1207 and application of target gene thereof in detection of laryngeal squamous cell carcinoma

<141> 2020-12-08

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4364

<212> DNA

<213> Homo sapiens

<400> 1

gcagggctgc tccctcagaa gcaccaggga ggatccttcc tgcctcttcc agctcccagg 60

ggctccaggg gttccttggc tggtgacggc accatgccat cctctgcctt ctgtgcacac 120

agccttctcc tcgactctct cttccattga taaaagggtc ttgctctacc acccaggctg 180

gagtgcagtg gtgtgatctc agctcgctgc aacctccacc tcctgggctc acacaatcct 240

tccacctcag catctggagt agctgggact acaggtcagt cctctgggct ccatctataa 300

aacaaatgtt tgtcatcctc cgggaaacag agcacatcta acagaggcag gcaattcctg 360

gagcttcttg attctgttca gcagaaccag ggccccagcg gcagaggcct cccaggaggt 420

ccacattgtg caagacacga actcaggtcc tttcatctca tccatcaaca gcccagaaca 480

gagttaattt tgcccactgt acaaagggtg aaacccaaat tcagagaaat tgactggcct 540

gcccgtgcct gcccagctgg gaggagtcag agctggcttc cattcacacg tgtctcactg 600

agaacaccaa cccacaccct gactgaaggg ctggtccaag cctacttatt gggtgtttgc 660

tcactaccct ccttctccct gtccaccctt cccttcgtgg acagaagcca gagttcagag 720

aggatcccca ggtccccagg gacacacagc caggcaagga gggagctcac ctcaactgct 780

gccttctgtc cagggcctct ccaccccaac cccacagccc gccaccttca tgcagccagg 840

actgtgggta atgcactaaa cacatgatta gcatttatta tggcttcatt tcatagacac 900

aggacaatga acagagccat aaacagggag aacaacaatg gaatcaagaa aatatggcac 960

ttttaagaat agtttatgag ttgaacaaaa ggaaaactct agtcttccac tctgggatat 1020

tgagcagtgc tcctagggct ctttggacta taaagcatta ttgaactgtt cctgcaatgc 1080

aaagtgtaca agatggtcat aattaagaac aattgattca atatttttgc caaacctcag 1140

ggtaagaata taaactagtc ataatggaaa aatgccagat ctgaggtgac ctgagccaag 1200

atgatcattg caagaataca ggaaccattg cagtggaggt gacactctca caatcgtcac 1260

agcggagatg acacagcatg gagtgaccat acacaaccat cacagcggag gtgacacaca 1320

ccgcatggag tgatgacact cacacaaccg tcacagcgga gatgacacag catggagtaa 1380

ccatactcac aaccatcaca gcagaggtga cgcacacagc atggagtgac tgcactcaca 1440

caaccgtcac agcggaggtg atgcacacag cacgttagaa gacctccagg tgccggttgc 1500

tgggctcaca tctgatgatc taatgaagag caaagcagac acaggtcgct gcccaggttg 1560

ttttgccacc tagagagagg tggactctaa ccacaaaagc cacacctgtg attcaaagac 1620

acctgtgtca ggctgcaccc acgagcagtg tcaggtgtgg ctgctgtggg ggcaggtgcc 1680

aggtagtctg cctccagagc tagtgtcaac tgtgtctggg ttcagtggac gagcagattc 1740

aaaccaggct atggaaacca ccaaacaaca tggtgcctgg aaacagaagg gtgtgttcag 1800

ccgaggggca tctgccctgg agctccccag acactcagga gccgactctc tgggaagtca 1860

caacaggggc tcagaactcg ctgtggggct aaaccttgtg cctgcctttc ataggatgac 1920

aaggccgcct ccacccactc acccactgtc cctcacaggg ccaccacaga gcaagatgac 1980

tgtgccttcc accctctgtc cactggctag ggccagcgtg aatggaggtg tggccacagg 2040

gggcaagctt cttaggacac caagtgctga gaaaatgact cgctgaagac tattaggaaa 2100

gaggatctct agagtctggg agagaacaca gggagccagc cgtgggccag gccgcagtgt 2160

gctgagacat ggctaacaac cagctcctgt ggtgaggggt ggatggtcgt gcagtcatca 2220

ccaatagccc tggtgcaatt gctcccacca tggctgattc ccagctacaa atgtcacatc 2280

aactgttgca ggattccagg atatttaaca acaggctctc tggagcggta ctagctggcc 2340

ccagcactgc accctcccag gactctggct tctgaggaag cctggtccac agaaatctac 2400

agctgtaatg gaacctcaaa gcaggtccct ccgcggggta gggtctggtc actgcagtca 2460

gcttgctgca ggcctacagg agttctgagc cccaaagtgt ccaccccacc ggtaggaatc 2520

aagccttcct ccaaacactt ggtttatcac attgcataga gagcacctga taggttcaag 2580

atctgtgttc aaccagaaag ctacacactc aagctgaact catgctccca ggagccccca 2640

gaggccagga cacgccctcc ccacagtcgg gggggacagg agaaagtgca tgcgtgctgg 2700

aacgtcaaac atcacgtggc acagggaggg gagaaagggg ccaggggatg cggggcttgg 2760

ccctggccct ggcccagatc ttagataatg ggcaggcacc cggcagggag gacaaagcag 2820

aaagggcatt tctaggtgaa tgagaagctg agctggcaaa gatatgactg ggggtcccag 2880

caagcgggaa tgaaactgta gattagtgtg tggagcccca aacaggcatg tgggtggcct 2940

cgcacactgg agaccctggt gccagaagag gcaactgcca ttgacggggc cctgctgtga 3000

gctgcgtgcc aggccttgtg gctgcacaca caatcccaca caccctcagg gtttactgag 3060

acatcctccc ggtgtcccca gaaaaggccc agcagtccag gaggtggagc tctcggggga 3120

cgggggacag agccagggct catgggcctg tggagcacct gggaagccgt gaggaggacg 3180

tgggggctgc aagtggaaag cttctgtggg agcacaaatc cttgccgagc tcagtggagc 3240

cgggccgtga atgtcacctg tgggtgggtg tgttccctga cacagccagc cgccctcact 3300

gctgtcgcct tgacccgaag tccccccagt tcctcacctg ctgccaggct gagcctcaag 3360

gactctcctg agacctggca tcatggggca gaaggcacgt aaccataacc tccagatgca 3420

tcatggatgc tgaacgcacg tcgattgatt gagcaaataa ataactgctg cggccgcaaa 3480

gtaccagaga aggatgggac tgtgcccaga ctttctgaaa tagatctaaa ttttgccagg 3540

tggccaaggc aggcagcagt ggggctgtga caggaaaggc catcctcgcc acccagaccc 3600

caccggcctc acgttctgtt gtcgaaagac acctgcctgc tttgcgactc catctccacc 3660

gaaacggtct ctgcagtcat ttgcagggat cggtccattt cccttgaaca cctcctttat 3720

ccctctcccc agaatcatga agcccagccc cgatcaatct tgccacttac atcaccccac 3780

tggtatcttc acttttcaat ctctttaaca tacatgcagg aaaaagacag ccagcatgga 3840

atacagttca gcagggccaa agaggagcag tggcgtcatc tcaggatgtg ctgggcaggc 3900

accacagcgc cggcgtcccc acgtccagga caaagctgag tgcaagtgtc accgtgagct 3960

ggcctgtgtg agcccggccc actgaccacc ccccagataa aaaagagcag gagatgcctc 4020

tcagccagga ctcagaccac cagcacgcag cacccggcac ccacggctga gcatgtgccc 4080

tcgagtagag aggagacctc ggtatggagg ggacagtgat gtgacagcca ccaagtccat 4140

ggtctgaccc ccagcagcag gggtgccagc ctcattgtgg agtgttgcag catgcgggga 4200

aatgattttc ctaatcactg ctaccagttg ggtgctaatg agccccagtt ctggttccac 4260

tggtgacatt tcagtttaca catcgctgcc atttggggtg aataagtcca agccacttaa 4320

acctcaggct cacattgatt agagacgtcc cctccaggtc ccaa 4364

<210> 2

<211> 2719

<212> DNA

<213> Homo sapiens

<400> 2

gctgcatcct gactctgggt tggaaacttc gtggtggatg atgcctgtaa ctacccagat 60

gaaatcaaga cgcaacagcc ctcatcgagg gatgctcaga gtcaaggaaa cttttctttt 120

gagctactga cagcttaact cctgtgaaca aaatttggag catatttgtt tctctctgcc 180

tgatttctcc aaaatttgga aactatttgt gagtattctt aacttatagc aatatagtta 240

tttgcataag tacaataagg atctgttttc ttttgcaaac agacacaatt ggagaaactg 300

gtgattttac caaagctttg attggaatgg tatgttttcc tttaaggaat caaacttgac 360

ttataaagcc aataaaagcc ccttgggaaa cctggcctca tgccttgtct acacagtccc 420

tgtacagggt tcccgacctg tggtaagtaa agaatgtcac tttctgattg gcccaggagc 480

cccaggttat cttgggacct caagaggaga ggaatttacc caactcaggt atttgagggt 540

gcaaactcac ggctgggctc agcttttaaa aagtcttatc tgagattcat tttatgaaac 600

acagttccat caaagtcaat tttaaaagcc tctgtgaaaa ataattatta ttgctgcact 660

ttatacaaat aattaggcca agtataataa agcaaattgg ttttgccatg atttgtcttt 720

agtaaaaaat gggagactgg agagagaaaa attatgtttc aagaactatg gtacacctgt 780

tattagattc taatctcatc agttgttttt gagggttttc ttctgcaatt tagactgact 840

gcttattcct gtgagccaac cagtgatctc tggttgcagt tcagaataaa caagacagat 900

accacctttt gtcagaactc ggagttacaa gtgaccctca ccataattat gctttctgag 960

ctcctctcta ccctgaatac aagagaccct aacagttagg caggaaagca ttgcccctat 1020

tcagcctgaa gaagttacag aatatggatc ttcatccttc cacaaccctt aggattaaga 1080

gttgccttgt aaaagggagg ggggaaatgt cagagacatt tgaatcagaa caactccacc 1140

ttgaataggg tctgggtaaa acaaggctga gaactgctgg gttgcattcc cagatggtta 1200

aggcattcta actcaccgga tgagatagga ggtcagaaca agatacagct tataaagacc 1260

ttgccgataa aacaggttgt agtaagaaaa gccggccaaa accaagatag caacaaaagt 1320

gacttctaat tgtcctcact gctcattata tgctaattac agtgcattag catgctaaaa 1380

gacactccta cccacaccaa aacagtttac aaattccata gcaacatcag aaaattaccc 1440

tatatagtct aaaaagggga ggaaccccca gttctgggaa ttgcccactc ttcctggaaa 1500

attcatgaat aatccacccc ttgtgatatg atttggctgt gtgtagccta gggacttgat 1560

atcctgcatc ccagttgctc tagccatgga taaaaggggc caaggtacag ctggggccat 1620

ggcttgaaag ggtgcaagct ccaagcctag gcagcatcca catggtgttg agcctgcggg 1680

tgcacagagg tcaagaattg aggtttggga acctccgcct agatttcaga ggatgtagag 1740

aaatgcctgg atgtccagtc agaagtttgc ttcaggaaca gcgccctcat ggagaacctt 1800

tgctagggca atgaagaagg gaaatgtggg cttgaaaccc cacacagagt ccccactgag 1860

gcaccgccta gtggggctgt gaggagaggg ccagcgtcct ccagacccca gaatggtaga 1920

tccaccaaca gcttacactg tgcacctgga agagccatag acactcaaca ccaggagtga 1980

aagcagccac aaagacacag aggcagagct gcccaagacc atgggaaccc acctcttgca 2040

gcataacttg gatgtgagaa atggtgtcca tggagataat ttcagagctt taagatttgg 2100

ctgccctgct ggatttctaa cttgcatggg gcctgtagcc cctccatctt ggccagtctg 2160

tcacatttgg aatgggtgta tttacccgat acctgtaccc ccattgtatc tgggaagtaa 2220

ctaagttgct tttgatttta caggctccta ggtggaagga actcaccttg tcttaaatga 2280

gactttggac tatggacttt taagtttatg ctgaaatgag ttaagaattt gggggactgt 2340

ggggaaggta tgattggttt taaaatgtga gaacatgaaa tttgggaggg gttgggggca 2400

gaatgatatg gtttggctgt gtccctaccc aaatctcatc ttgaattgta gctcccataa 2460

ttcccgcctg tcatgggagg gatgcagtgg gaggtaatta aatcatgggg acgggtcttt 2520

cccatgctgt tctcatggta gtgaataaat ctcaagagtt ctgatggttt tataaatgag 2580

agttcccttg cacaagctct ctctttgcct gccactatgt aagatgtggc tttgctcctc 2640

cttgccttcc tccatgattg tgaggcctcc tcaaccaggt gaaactgtga gtcaattaaa 2700

cctctttcct ctatcaatt 2719

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtgacctgag ccaagatg 18

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtgacgattg tgagagtgt 19

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ataggaggtc agaacaag 18

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cagtgaggac aattagaag 19

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggagcgagat ccctccaaaa t 21

<210> 8

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggctgttgtc atacttctca tgg 23

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

catgtacgtt gctatccagg c 21

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctccttaatg tcacgcacga t 21

<210> 11

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ucauuguccu gugucuauga a 21

<210> 12

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cauagacaca ggacaaugaa c 21

<210> 13

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aaauugcaga agaaaacccu c 21

<210> 14

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggguuuucuu cugcaauuua g 21

Claims

1. Application of a reagent for detecting a biomarker in preparation of a product for diagnosing laryngeal squamous cell carcinoma is characterized in that the biomarker is a target gene LOC339685 or LOC400706 regulated by miR-1207.

2. The use according to claim 1, wherein the agent is selected from the group consisting of:

a probe that specifically recognizes the biomarker; or

Primers for specific amplification of biomarkers.

3. The use according to claim 2, wherein the sequence of amplification of LOC339685 or LOC400706 is as shown in SEQ ID nos. 3-4 and 5-6, respectively.

4. The use of claim 1, wherein the product comprises a chip or a kit.

5. The application of claim 4, wherein the chip comprises: a solid phase carrier and a probe which is attached to the solid phase carrier and specifically recognizes LOC339685 or LOC 400706.

6. The use according to claim 4, wherein the kit comprises a primer, probe or chip that specifically binds LOC339685 or LOC 400706.

7. The application of the inhibitor of the biomarker in the preparation of the medicine for treating laryngeal squamous cell carcinoma is characterized in that the biomarker is a target gene LOC339685 or LOC400706 regulated by miR-1207.

8. The use according to claim 7, wherein the inhibitor is a nucleic acid inhibitor of LOC339685 or LOC 400706.

9. The use of claim 8, wherein the nucleic acid inhibitor is an siRNA.

10. The use of claim 9, wherein the siRNA has the sequence shown in SEQ ID nos. 11 to 14.