CN111979315A

CN111979315A - Application of annular TP63 as lung squamous carcinoma diagnosis or treatment target

Info

Publication number: CN111979315A
Application number: CN201910438326.5A
Authority: CN
Inventors: 覃文新; 程卓安; 余成涛
Original assignee: Shanghai Cancer Institute
Current assignee: Shanghai Cancer Institute
Priority date: 2019-05-24
Filing date: 2019-05-24
Publication date: 2020-11-24

Abstract

The invention provides application of cyclic TP63(circTP63) as a diagnosis or treatment target of squamous cell lung carcinoma. The invention discloses that the circTP63 in the squamous cell lung carcinoma presents high specificity expression for the first time, and the circTP63 can be used as a marker for diagnosis and prognosis of the squamous cell lung carcinoma. The invention also discloses that the expression of the specific knockdown circTP63 can effectively inhibit the growth of the squamous cell lung carcinoma, thereby achieving the effect of inhibiting the squamous cell lung carcinoma. Therefore, the circTP63 can be used as a target for detecting, treating and prognosing squamous cell lung carcinoma and is used for developing reagents and medicaments for clinical diagnosis and treatment.

Description

Application of annular TP63 as lung squamous carcinoma diagnosis or treatment target

Technical Field

The invention belongs to the field of gene diagnosis or treatment, and particularly relates to application of cyclic TP63(circTP63) as a diagnosis or treatment target of squamous cell lung carcinoma.

Background

Lung cancer is the first killer of malignant tumors worldwide threatening human health. Squamous cell carcinoma (LUSC) is one of the major subtypes of lung cancer, with about 40 million people dying from squamous cell carcinoma worldwide each year. Epidemiological data indicate that the pathogenesis of the disease is closely related to smoking, but the action mechanism is not clarified. Pathological diagnosis and treatment methods have certain limitations. The conventional treatment methods for squamous cell lung carcinoma mainly comprise surgical treatment, chemotherapy and molecular targeted therapy. But most patients have already been diagnosed late and lost the chance of surgery.

In recent years, the life cycle of a late-stage lung cancer patient with sensitive mutation is obviously prolonged by a targeted medicament aiming at a lung cancer driving gene. However, the mutation mostly occurs in lung adenocarcinoma, and no clear driving gene is found in subtypes such as lung squamous cell carcinoma, and the molecular targeted drug has a fresh curative effect on lung squamous cell carcinoma. The current standard treatment of advanced lung squamous carcinoma is still a platinum-containing double-drug scheme with limited curative effect, and most patients are in a state of no drug availability after failure of first-line and second-line treatment. Therefore, there is an urgent need to find new markers for early diagnosis of LUSC and evaluation of therapeutic effects.

Circular RNA (Circular RNA) is a newly discovered non-coding RNA, and is a type of RNA molecule that does not have a 5 'end and a 3' end and forms a Circular structure by covalent bonds. There is increasing evidence that circRNA can be involved in regulation of gene expression at the transcriptional, post-transcriptional modification level. Originally thought to be a byproduct of the formation of mis-alternative splicing, which is the "noise" of transcription, but with the advent of second-generation sequencing technologies, researchers have identified large amounts of circRNA from archaea, nematodes, mouse and human cells, suggesting that circRNA is a common phenomenon of cellular gene expression, some of which have tissue-cell specific expression characteristics, suggesting that this class of RNA molecules may possess specific biological functions. The circRNA has the characteristics of good conservation, high specificity, difficult degradation and the like. Therefore, there is a need in the art for further exploration and development of some circrnas to be associated with disease, and to be used in clinical diagnosis or treatment.

Disclosure of Invention

The invention aims to provide application of circTP63 as a diagnosis or treatment target of squamous cell lung carcinoma.

In a first aspect of the present invention, there is provided the use of cyclic TP63(circTP63) for the preparation of a diagnostic agent for the diagnosis of squamous cell lung carcinoma.

In a preferred embodiment, the nucleotide sequence of the circular TP63 is shown as SEQ ID NO. 1.

In another aspect of the present invention, there is provided a use of a diagnostic reagent specifically recognizing or amplifying circular TP63 for preparing a kit for diagnosing squamous cell lung carcinoma.

In a preferred embodiment, the diagnostic reagent comprises: a primer for specifically amplifying circular TP 63; or a probe that specifically recognizes circular TP 63; or a chip that specifically recognizes circular TP 63.

In another aspect of the present invention, there is provided a kit for diagnosing squamous cell lung carcinoma, the kit comprising:

a primer for specifically amplifying circular TP 63; preferably, the product obtained by primer amplification is a primer which spans the reverse cleavage site of the circular TP63 and can specifically amplify circular TP 63; more preferably, the primer has the nucleotide sequence shown by SED ID NO. 2 and SED ID NO. 3; or

A probe that specifically recognizes circular TP 63; or

Chip specifically recognizing circular TP 63.

In another aspect of the present invention, there is provided the use of a down-regulator of cyclic TP63 for the preparation of a pharmaceutical composition for alleviating or treating squamous cell lung carcinoma, or for the preparation of a pharmaceutical composition for arresting the cell cycle of squamous cell lung carcinoma at G2/M.

In a preferred embodiment, the down-regulator of cyclic TP63 comprises: interfering molecules that specifically interfere with the expression of cyclic TP63, small molecule compounds that specifically inhibit cyclic TP63, gene editing reagents that specifically knock out cyclic TP63 (e.g., the reverse complement intron sequence of cyclic TP63 is knocked out by the method of criprpr to affect the formation of cyclic TP 63); preferably, the circular TP63 down-regulator specifically targets the reverse cleavage point of circTP63, thereby specifically targeting circTP63 without affecting the function of TP 63; preferably, the interfering molecule is siRNA, antisense nucleic acid, miRNA, dsRNA, shRNA targeting cyclic TP63 for inhibition or silencing, or a construct capable of expressing or forming the siRNA, antisense nucleic acid, miRNA, dsRNA, shRNA; more preferably, the interfering molecule is siRNA selected from the nucleotide sequences shown in SEQ ID NO 6 or SED ID NO 7.

In another aspect of the present invention, there is provided a use of annular TP63 for screening a potential agent for ameliorating or treating squamous cell lung carcinoma.

In another aspect of the present invention, there is provided a method of screening for a potential substance for ameliorating or treating squamous cell lung cancer, the method comprising: (1) treating a system expressing circular TP63 with a candidate substance; and (2) detecting expression of cyclic TP63 in said system; wherein, if the candidate substance can reduce the expression of ring TP63, the candidate substance is a potential substance for relieving or treating lung squamous carcinoma.

In a preferred embodiment, step (1) comprises: in the test group, the candidate substance was added to a system expressing circular TP 63; and/or step (2) comprises: detecting the expression of cyclic TP63 in the test group of systems and comparing the expression with a control group, wherein the control group is a system which does not add the candidate substance and expresses cyclic TP 63; if the expression of cyclic TP63 in the test group is statistically lower than in the control group, it indicates that the candidate is a potential agent for alleviating or treating squamous cell lung carcinoma.

In another preferred embodiment, the system is selected from: cell systems (e.g., cells or cell cultures expressing circular TP 63), subcellular systems, solution systems, tissue systems, organ systems, or animal systems.

In another preferred embodiment, said statistically lower is preferably significantly lower, such as more than 20% lower, preferably more than 50% lower; more preferably, the lower value is more than 80%.

In another preferred embodiment, the candidate substance includes (but is not limited to): small molecule compounds designed against cyclic TP63, interfering molecules, nucleic acid inhibitors, binding molecules (e.g., antibodies or ligands), etc., designed against cyclic TP63 or its involved signaling pathway or upstream or downstream molecules.

In another preferred example, the method further comprises: further cell experiments and/or animal experiments are carried out on the obtained potential substances to further select and determine substances useful for alleviating or treating squamous cell lung carcinoma from the candidate substances.

In another aspect of the present invention, there is provided a pharmaceutical composition for alleviating or treating squamous cell lung carcinoma or retarding the cell cycle of squamous cell lung carcinoma cells from G2/M, said pharmaceutical composition comprising: a downregulator of cyclic TP63 and a pharmaceutically acceptable carrier; wherein the down regulator is an interfering molecule which specifically interferes with the expression of the cyclic TP63, a small molecule compound which specifically inhibits the cyclic TP63, and a gene editing reagent which specifically knocks out the cyclic TP 63; preferably, the interfering molecule is siRNA, antisense nucleic acid, miRNA, dsRNA, shRNA targeting cyclic TP63 for inhibition or silencing, or a construct capable of expressing or forming the siRNA, antisense nucleic acid, miRNA, dsRNA, shRNA; more preferably, the interfering molecule is siRNA selected from the nucleotide sequences shown in SEQ ID NO 6 or SED ID NO 7.

In another aspect of the present invention, there is provided a method for preparing a diagnostic reagent for diagnosing squamous cell lung carcinoma, the method comprising: preparing a reagent for specifically recognizing or amplifying the cyclic TP63 by taking the cyclic TP63 as a target; preferably, the reagent comprises: a primer for specifically amplifying circular TP 63; or a probe that specifically recognizes circular TP 63; or a chip that specifically recognizes circular TP 63; preferably, the method further comprises: loading said reagent that specifically recognizes or amplifies said circular TP63 onto a solid support; preferably, the solid support comprises: test paper or test paper strips, microspheres and glass slides.

In another aspect of the present invention, there is provided a method for diagnosing squamous cell lung carcinoma, comprising: the presence of cyclic TP63 in an ex vivo sample (e.g., cancerous tissue) from a subject is detected using a diagnostic reagent or kit that specifically recognizes or amplifies cyclic TP 63.

In a preferred embodiment, the method comprises: extracting total RNA of a sample, reversing the total RNA into cDNA, synthesizing and marking CRNA, hybridizing, washing, scanning and analyzing signals.

In another preferred example, the method comprises: extracting total RNA of the sample, reversing the total RNA into cDNA, performing fluorescence PCR amplification, and performing qualitative or quantitative analysis on an amplification product.

In another preferred embodiment, the expression or expression level of cyclic TP63 in the test sample is detected, and if the result shows that the expression level of cyclic TP63 is significantly higher (statistically higher, such as higher than 2-fold or higher, more seriously higher than 60-fold or higher, and more seriously higher than 1000-fold or higher) than that of the control, the provider of the test sample is at high risk for or is a patient with squamous cell lung cancer; wherein the control is a tissue sample adjacent to the cancer.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, SBC human CERNA array chip for screening of circRNA associated with squamous cell lung carcinoma. circTP63 showed different expression differences in 5 lung squamous carcinoma and paracancerous tissues by SBC human cerana array.

FIG. 2, differential expression of circTP63 in squamous lung carcinoma tissue and paired paracancerous lung tissue; the expression in matched cancer and cancer-adjacent tissues of 35 lung squamous carcinoma patients is amplified and verified by a qRT-PCR method.

FIG. 3, qRT-PCR assay si-circTP63 knock-out effect. Wherein the si-circTP63 sequence refers to SED ID NO 6; the si-circTP63#2 sequence refers to SED ID NO 7;

a: detecting the effect of si-circTP63 on the expression levels of circTP63 and TP63 in the SW900 cell line;

b: detecting the effect of si-circTP63 on the expression levels of circTP63 and TP63 in the H1703 cell line;

c: the effect of si-circTP63#2 on the expression levels of circTP63 and TP63 was examined in the H1703 cell line.

FIG. 4, CCK-8 tests the effect of knockout of circTP63 on the growth of squamous cell lung carcinoma cells. Wherein SW900 and H1703 refer to human lung squamous carcinoma cell lines;

a: detecting the effect of si-circTP63 on cell proliferation in the SW900 cell line;

b: detecting the effect of si-circTP63 on cell proliferation in the H1703 cell line;

c: the effect of si-circTP63#2 on cell proliferation was examined in the H1703 cell line.

FIG. 5, flow cytometry to examine the effect of knockout of circTP63 on the cell cycle of squamous cell lung carcinoma;

a: detecting the effect of si-circTP63 on the cell cycle in the SW900 cell line;

b: the effect of si-circTP63 on the cell cycle was examined in the H1703 cell line.

Detailed Description

The inventor of the invention has conducted extensive and intensive studies and extensive screening, and has revealed for the first time that cyclic TP63(circTP63) exhibits high expression specificity in squamous cell lung carcinoma, and that it can be used as a marker for diagnosis and prognosis of squamous cell lung carcinoma. Furthermore, the inventors have found that the growth of squamous cell lung carcinoma can be effectively inhibited by specifically knocking down the expression of circTP63, thereby achieving the effect of inhibiting squamous cell lung carcinoma. Therefore, the circTP63 can be used as a target for detecting, treating and prognosing squamous cell lung carcinoma and is used for developing reagents and medicaments for clinical diagnosis and treatment.

Biomarkers

A "biomarker" is a gene whose expression level in a tissue or cell is altered compared to the expression level in a normal or healthy cell or tissue. In the invention, the biomarker is circTP 63.

It will be appreciated by those skilled in the art that the utility of the present invention is not limited to quantifying gene expression of any particular variant of the marker genes of the present invention. As a non-limiting example, the marker gene may have the nucleotide sequence shown in SEQ ID NO. 1. In some embodiments, it has a sequence that is at least 85% identical or similar to the sequence set forth in SEQ ID NO. 1, such as a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical or similar to the sequences set forth above.

The present invention may utilize any method known in the art for determining gene expression. It will be appreciated by those skilled in the art that the means by which gene expression is determined is not an important aspect of the present invention. The expression level of the biomarker can be detected at the transcriptional level.

In some embodiments, the expression level of the biomarker is detected at the transcriptional level. Various methods for specific DNA and RNA measurements using nucleic acid hybridization techniques are known to those skilled in the art. Some methods involve electrophoretic separation (e.g., Southern blots for detecting DNA and Northern blots for detecting RNA), but measurements of DNA and RNA can also be made without electrophoretic separation (e.g., by dot blotting). Southern blots of genomic DNA (e.g., from humans) can be used to screen for Restriction Fragment Length Polymorphisms (RFLPs) to detect the presence of a genetic disorder affecting a polypeptide of the invention. All forms of RNA can be detected.

Diagnostic reagent and application

Based on the new findings of the present inventors, circTP63 can be used as a marker (marker) for the determination of squamous cell lung carcinoma. By analyzing the expression condition of circTP63 in the sample to be tested, the diseased state of the subject can be known, and the basis is provided for the diagnosis or prognosis of the disease. In a preferred embodiment, the sample or specimen to be tested is a tissue sample or a body fluid of a patient.

The expression of circTP63 can be detected using a variety of techniques known in the art, and are encompassed by the present invention. Available prior art techniques for detecting nucleic acids are (but not limited to): gene chip technology, probe hybridization technology, Polymerase Chain Reaction (PCR), Northern Blot and other methods.

The invention provides reagents that specifically recognize or amplify circTP 63. Any reagent that recognizes circTP63 is encompassed by the invention. The reagent specifically recognizing circTP63 includes but is not limited to: primers that specifically amplify circTP63 or probes that specifically recognize circTP 63.

The reagent for specifically recognizing circTP63 can also be fixed on a test paper, a glass slide or other solid phase carriers to prepare immune colloidal gold test paper or similar detection materials.

As an alternative of the present invention, the quantitative or semi-quantitative Polymerase Chain Reaction (PCR) method was used to determine the expression level and expression level of circTP63 in the sample. Preferably, detection is achieved by real-time quantitative Realtime-PCR. The reagents used were primers for specific amplification of circTP63, based on which one could easily design a primer after knowing the nucleotide sequence of circTP 63. According to the characteristic of circTP63, the product obtained by primer amplification is a primer which spans the reverse cleavage site of the circular TP63 and can specifically amplify circular TP 63. As a more preferable mode of the invention, the primers are primer pairs and have the nucleotide sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3. The primer pair can be amplified to obtain an amplification product with a proper length, and the detection specificity is good.

As an alternative of the present invention, the detection of circTP63 can be performed using gene chip technology. After knowing the nucleotide sequence of circTP63, one can readily design probes based thereon. For example, if a modified glass slide or silicon wafer is used as the solid support, and the 5' end of the probe contains a poly-dT string modified with an amino group, the oligonucleotide probe can be prepared into a solution, and then spotted on the modified glass slide or silicon wafer by a spotting machine to be arranged into a predetermined sequence or array, and then fixed by being left for overnight, thereby obtaining the gene chip of the present invention. If the oligonucleotide probe does not contain an amino group modification, the preparation method thereof can be also referred to the prior art.

Specifically, suitable probes can be designed according to circTP63 described in the present invention, and immobilized on a solid support to form an "oligonucleotide array". An "oligonucleotide array" is an array having addressable locations (i.e., locations characterized by distinct, accessible addresses), each addressable location containing a characteristic oligonucleotide attached thereto. The oligonucleotide array may be divided into a plurality of subarrays as desired.

In the present invention, the solid phase carrier includes plastic products, microparticles, membrane carriers, and the like. The plastic products can be combined with antibodies or the egg tl antigen through a non-covalent or physical adsorption mechanism, and the most common plastic products are small test tubes, small beads and micro reaction plates made of polystyrene; the micro-particles are microspheres or particles polymerized by high molecular monomers, the diameter of the micro-particles is more than micron, and the micro-particles are easy to form chemical coupling with antibodies (antigens) due to the functional groups capable of being combined with proteins, and the combination capacity is large; the membrane carrier comprises microporous filter membranes such as a nitrocellulose membrane, a glass cellulose membrane, a nylon membrane and the like.

Diagnostic kit

The present invention also provides a kit for detecting squamous cell lung carcinoma, the kit comprising: an agent that specifically recognizes circTP63, or a vector loaded with the agent. The reagent specifically recognizing circTP63 is, for example: a primer for specifically amplifying circTP63, a probe for specifically recognizing circTP63 or a chip for specifically recognizing circTP 63.

The kit can also contain a marker for marking the RNA sample and a substrate corresponding to the marker. In addition, the kit can also contain some auxiliary reagents: nucleic acid extraction reagents (such as nucleic acid extraction solution, phenol, chloroform, isoamyl alcohol, NaCl, etc.); and/or polymerase chain reaction reagents (e.g., dNTPs, Taq enzyme, PCR buffer, DNA polymerase, etc.); and/or a reagent for the enzyme chain immunoreaction (such as a developing solution or a hybridization solution).

In addition, the kit also comprises an instruction manual and/or chip image analysis software.

CircTP63 downregulators and uses thereof

Based on the new discovery of the inventor, the invention provides the application of the circTP63 down-regulating agent in preparing a composition (such as a medicament) for relieving or treating squamous cell lung carcinoma. The circTP63 down-regulator can realize the relieving, inhibiting or treating effect on the lung squamous carcinoma by inhibiting the expression of circTP 63.

As used herein, the term "circTP 63 down-regulator" includes inhibitors, blockers, etc., as long as they are capable of down-regulating the expression level or activity of circTP 63. They may be chemical compounds, chemical small molecules, biological molecules. The biomolecule may be at the nucleic acid level (including DNA, RNA) or may be a virus or viral product that inhibits the expression of circTP 63.

The circTP63 down-regulator is any substance which can reduce the activity of circTP63, reduce the stability of circTP63, down-regulate the expression of circTP63 and reduce the effective action time of circTP63, and the substances can be used in the invention, and can be used as substances which are used for down-regulating circTP63, so that the down-regulator can be used for relieving, inhibiting or treating squamous cell lung carcinoma.

The circTP63 down-regulator specifically targets the reverse cleavage point of circTP63, thereby specifically targeting circTP63 without affecting TP63 function.

As a preferred mode of the invention, the down-regulator can be a circTP63 specific interfering RNA molecule, such as siRNA or shRNA. The method for preparing the interfering RNA molecule is not particularly limited, and includes, but is not limited to: chemical synthesis, in vitro transcription, and the like. The interfering RNA may be delivered into the cell by using an appropriate transfection reagent, or may also be delivered into the cell using a variety of techniques known in the art. As a preferred mode of the present invention, there is provided a preferred interfering molecule which is siRNA selected from the nucleotide sequences represented by SEQ ID NO 6 or SED ID NO 7, and in the specific examples of the present invention, it has been demonstrated that the siRNA has an excellent inhibitory effect.

As an alternative of the invention, the down-regulator may be a small molecule compound directed to circTP 63. With circTP63 disclosed herein as the target, one skilled in the art can screen such small molecule compounds using methods routine in the art.

As an alternative of the present invention, targeted gene editing can be performed using CRISPR/Cas (e.g. Cas9) system to knock out the segment associated with the production of circTP63 in the region targeted to the disease.

Drug screening

After the close correlation of circTP63 with lung squamous carcinoma was known, substances that inhibit the expression of circTP63 could be screened based on this feature. From said substances, a truly useful drug for the alleviation or treatment of squamous cell lung carcinoma can be found.

Accordingly, the present invention provides a method for screening a potential substance for inhibiting squamous cell lung carcinoma, the method comprising: treating a system expressing circTP63 with a candidate substance; and detecting the expression of circTP63 in the system; if the candidate substance can inhibit the expression of circTP63, the candidate substance is a potential substance for inhibiting the lung squamous carcinoma. The system for expressing circTP63 can be, for example, a cell (or cell culture) system, and the cell can be a cell endogenously expressing circTP 63; or may be a cell recombinantly expressing circTP 63. The system for expressing circTP63 can also be a subcellular system, a solution system, a tissue system, an organ system, or an animal system (e.g., an animal model, preferably a non-human mammalian animal model, such as mouse, rabbit, sheep, monkey, etc.), and the like.

In a preferred embodiment of the present invention, in order to more easily observe the change in the expression of circTP63 in the screening, a control group may be provided, and the control group may be a system expressing circTP63 without adding the candidate substance.

As a preferred embodiment of the present invention, the method further comprises: further cell experiments and/or animal experiments are performed on the obtained potential substances to further select and identify substances that are truly useful for the alleviation or treatment of squamous cell lung carcinoma.

The method for detecting the expression, activity or amount of circTP63 in the present invention is not particularly limited. Conventional quantitative or semi-quantitative detection techniques may be employed.

In another aspect, the invention also provides a potential substance for relieving or treating squamous cell lung carcinoma, which is obtained by the screening method. These preliminarily selected substances may constitute a screening library so that one may finally select a substance useful for inhibiting the expression and activity of circTP63 and thereby alleviating or treating squamous cell lung carcinoma.

Inhibitor and pharmaceutical composition of circTP63

Based on the findings of the present invention, the present invention provides a pharmaceutical composition comprising an effective amount of a down-regulator of circTP63, and a pharmaceutically acceptable carrier. Any of the foregoing downregulators of circTP63 can be used in the preparation of the composition. The pharmaceutical composition can be a medicine or a health-care product and the like.

The down regulator of circTP63 refers to any substance capable of inhibiting the expression of circTP63 gene or inhibiting the effective action time of circTP63, and the substances can be used in the invention, and can be used for inhibiting the expression of circTP63 gene, thereby being used for preventing or treating lung squamous cell carcinoma.

In a preferred embodiment of the present invention, the inhibitor of circTP63 is siRNA selected from the group consisting of the nucleotide sequences shown in SEQ ID NO. 6 or SED ID NO. 7.

Introduction of siRNA into host cells can be carried out by a known method such as electroporation with U, calcium phosphate, liposome, DBAE dextran, microinjection, viral infection, lipofection, or binding to a cell membrane-permeable peptide.

The invention has the advantages and beneficial effects that:

the invention discovers that the differential expression of circTP63 is related to the occurrence and the development of the squamous cell lung carcinoma for the first time, and whether the subject suffers from the squamous cell lung carcinoma or is at risk of suffering from the squamous cell lung carcinoma can be judged by detecting the expression of circTP63 in a sample of the subject, so that a clinician is guided to provide a prevention scheme or a treatment scheme for the subject.

As a potential molecular target, the circTP63 provides a new approach for clinical diagnosis and treatment of lung squamous carcinoma.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Example 1 Gene marker related to squamous cell lung carcinoma

1. Sample collection

5 samples of squamous cell lung carcinoma and tissues beside the carcinoma are collected respectively, the material-taking part of a squamous cell lung carcinoma tumor tissue sample is a main tumor region which is positioned at the junction of the outer 1/3 of a tumor mass and normal tissues, and obvious necrotic and calcified parts in the center of the tumor and normal tissues at the periphery of the tumor are removed; the paracancer normal lung tissue specimen is taken from a part above 5cm of the tumor edge, and no obvious change is observed by naked eyes.

All patients who provided the samples were obtained from the department of chest hospital of Shanghai, and informed consent was given, and all of the above samples were obtained with the consent of the tissue ethics Committee.

2. RNA extraction

Taking soybean-sized cancer or para-cancer tissues, adding liquid nitrogen into a mortar, grinding the soybean-sized cancer or para-cancer tissues into powder, then transferring the powder into an RNase-free EP tube, adding 1ml of Trizol to fully crack the tissues, then adding 200ul of chloroform, violently shaking the obtained product, centrifuging the obtained product at 4 ℃ and 12000rpm for 15min, absorbing an upper layer of a transparent water phase, adding isopropanol with the same volume, fully and uniformly mixing the obtained product, standing the obtained product at room temperature for 10min, centrifuging the obtained product at 4 ℃ and 12000rpm for 10min, sometimes visually observing tube bottom white RNA precipitates, removing supernatant, adding 1ml of 75% ethanol, centrifuging the obtained product at 4 ℃ and 7500rpm for 10min, removing ethanol, standing the obtained product, volatilizing and airing the obtained product, adding a certain amount of RNase-free.

3. Agarose gel electrophoresis detection

The extracted RNA is subjected to agarose gel electrophoresis, the Agilent Bioanalyzer 2100 detects the quality of an RNA sample, and the 28s rRNA and 18sRNA main bands are observed to be obvious, have no degradation, have qualified RNA integrity indexes and meet the requirements on concentration, so that the RNA can be used for a chip circRNA expression profile and a screening experiment.

4. Chip experiment

The chip adopts SBC human ceraRNA array of Shanghai Bohao biological technology limited company, and the steps of the chip use instruction are carried out for reversing cDNA, CRNA synthesis and marking, hybridization, washing, scanning, signal analysis and the like. From the chip, circTP63 was obtained by screening, and its probe number: the Hsa _ circ _0068515 probe sequence is: GGAGCCAACAGTGAGGGGCCGTGAGACTTATGAAATGCTGTTGAAGATCAAAGAGTCCCT (SED ID NO: 9).

5. Results

The signal values of circTP63 in the SBC human ceraRNA array chip in 5 specific samples are shown in Table 1, and in 5 cases of lung squamous carcinoma patients, the cancer and the cancer-adjacent tissues of circTP63 (probe number: Hsa _ circ _0068515) have higher expression signals than those of the cancer-adjacent tissues, especially in 4 samples of S06, S22, S32 and S50.

TABLE 1

Table 1 is further summarized and charted as shown in fig. 1, indicating that circTP63 is significantly more expressed in lung squamous carcinoma tissues than in paracarcinoma tissues.

circTP63 biological information

circTP63, named as has _ circ _0068515 in the circBase database, has the sequence located at chromosome 3, q28, and is formed by reverse splicing and circularization of exon 10 and 11 of TP63mRNA (NCBI ID: NM _ 003722.4). The sequence is as follows:

GTGAGGGGCCGTGAGACTTATGAAATGCTGTTGAAGATCAAAGAGTCCCTGGAACTCATGCAGTACCT TCCTCAGCACACAATTGAAACGTACAGGCAACAGCAACAGCAGCAGCACCAGCACTTACTTCAGAAACAGACCTCAATACAGTCTCCATCTTCATATGGTAACAGCTCCCCACCTCTGAACAAAATGAACAGCATGAACAAGCTGCCTTCTGTGAGCCAGCTTATCAACCCTCAGCAGCGCAACGCCCTCACTCCTACAACCATTCCTGATGGCATGGGAGCCAACA(SEQ ID NO:1)

example 2 qRT-PCR detection of the expression level of circTP63 in Lung squamous carcinoma patient tissues

1. Sample collection

Cancer tissues and matched paracarcinoma tissues of 35 patients with squamous cell lung carcinoma were collected in 6 months to 2014 9 months in 2013, and the methods were performed as in example 1.

2. RNA extraction

The procedure was as described in the corresponding method in example 1.

3. Reverse transcription

According to the PrimeScript RT Master Mix kit, the protocol was followed according to the instructions provided by the reagent supplier.

4. qRT-PCR amplification

The sequence of the primers (SED ID NO: 2; SED ID NO:3) designed based on the sequence of circTP63 is as follows:

forward direction: 5'-GCCCTCACTCCTACAACCATT-3' (SED ID NO: 2);

and (3) reversing: 5'-TTGTGTGCTGAGGAAGGTACT-3' (SED ID NO: 3).

The primer sequence of housekeeping gene beta-actin is as follows:

forward direction: 5'-AGTTGCGTTACACCCTTTCTTG-3' (SED ID NO: 4);

and (3) reversing: 5'-GCTGTCACCTTCACCGTTCC-3' (SED ID NO: 5).

A25 uL reaction system was used, 3 parallel channels were set for each sample, and all amplification reactions were repeated three more times. The procedures were performed according to SYBR Premix EX TagTMII kit instructions.

The amplification procedure was 95 ℃ for 60s, (95 ℃ for 15s, 60 ℃ for 15s) x 35 cycles, 60 ℃ for 5min extension. SYBR Green is used as a fluorescent marker, PCR reaction is carried out on an ABI 7500 fluorescent quantitative PCR instrument, amplification specificity is analyzed through a dissolution curve, and relative quantification is carried out by a 2^ delta Ct method.

5. Statistical method

The experimental results are independently repeated for 3 times, the result data are expressed in a mode of mean value +/-standard deviation, Graphpad prism 6 is used for analysis and charting, and t test is used for pairing comparison of cancer and para-cancer tissues, and the statistical significance is considered when p is less than 0.05.

6. Results

The results are shown in fig. 2, compared with the lung squamous carcinoma paracancerous tissue, the expression of circTP63 in the lung squamous carcinoma tissue is obviously up-regulated, and the difference has statistical significance and is consistent with the chip detection result.

Example 3 inhibition of circTP63 Gene expression in human Lung squamous carcinoma cell lines

1. Cell culture

Culturing human lung squamous carcinoma cell strain SW900 in Leibovitz' S L15 culture medium containing 10% fetal calf serum and 1% P/S at 37 deg.C in air incubator with relative humidity of 90%; human squamous cell lung carcinoma cell line H1703, using 10% fetal calf serum and 1% P/S RPMI1640 medium at 37 deg.C, 5% CO2, relative humidity of 90% incubator. Changing the solution for 1 time in 2-3 days, and carrying out conventional digestion and passage by using 0.25% of trypsin containing EDTA.

Digesting the cells in the culture bottle by using pancreatin and inoculating the cells in a 6-well plate to ensure that the number of the cells is 2-8 multiplied by 10⁵Per well, cell culture medium was added. The cell density was observed overnight the next day, and transfection was possible at cell densities above 70%.

2. siRNA primer sequence Synthesis

The si-circTP63 sequence SED ID NO 6, si-circTP63#2 sequence SED ID NO 7 and negative control si-NC SED ID NO 8 sequences were designed, screened and synthesized.

siRNA target sequencing is listed as:

5’-GCCAACAGUGAGGGGCCGU-3’(SED ID NO:6)；

5’-CAACAGUGAGGGGCCGUGAGA-3’(SED ID NO:7)。

the siRNA (si-NC) target sequences used for the negative controls were:

5’-UUCUCCGAACGUGUCACGU-3’(SED ID NO:8)。

3. transfection

The lung squamous carcinoma cells were divided into 3 groups, namely a control group (si-NC) and an experimental group (si-circTP 63 transfection and si-circTP63#2 transfection). Transfection of the vector was performed using liposome 2000, and the specific transfection method was performed as indicated in the specification. siRNA transfection concentrations were all 50 nM.

4. qRT-PCR detection of transcript levels of circTP63

4.1 extraction of Total RNA from cells

The cell culture medium in the 6-well plate was poured off, washed twice with PBS, and the lml Trizol reagent was added to each well and left at room temperature for 5 min. The subsequent extraction method was the same as the RNA extraction method described in example 1.

4.2 reverse transcription procedure as in example 2.

4.3qRT-PCR amplification procedure as in example 2.

5. Statistical method

The statistical method was the same as in example 1.

6. Results

As shown in FIGS. 3 a-c, in the two human lung squamous carcinoma cell lines, circTP63 of the si-circTP63 and si-circTP63#2 groups was significantly low expressed compared with the blank group, and the difference was statistically significant (P < 0.05).

Example 4 Effect of circTP63 on proliferation of Lung squamous cell carcinoma

In this example, CCK-8 experiment was used to examine the effect of circTP63 on the proliferation potency of two lung squamous carcinoma cells SW900 and H1703.

1. The cell culture and transfection procedures were the same as those described in example 3.

2. Taking out the cells the next day, observing the growth condition of the cells under a microscope, adding pancreatin containing EDTA into lml/hole, digesting the cells, removing the pancreatin after digestion is finished, adding a cell culture medium, uniformly mixing to suspend the cells, and then counting the cells.

3. The cell suspension concentration was diluted to 13000/ml, and then inoculated into 96-well plates, 200ul of cell suspension was added to each well, cells were controlled at about 3000 cells, and 8 replicate wells were inoculated. Set up si-circTP63 experimental group and si-NC control group. A total of 4 96 well plates were plated for 4 detection time points of 24h, 48h, 72h, and 96h, respectively.

4. And after 24h, taking out the first 96-well plate, adding 100ul of CCK-8 detection solution into each well of , continuously putting the 96-well plate into a cell culture box, incubating for about 2h, detecting the absorbance value of each well at the wavelength of 450nm by using an enzyme-labeling instrument, and recording data.

5. And respectively repeating the operation in the step 4 in 48h, 72h and 96h, finally counting the absorbance values at each time point, and drawing a growth curve graph.

6. Statistical analysis

The statistical analysis was the same as in example 1.

7. Results

As shown in FIGS. 4 a-c, the proliferation of the two lung squamous carcinoma cells in the experimental group was significantly inhibited after si-circTP63 transfection, and the difference was statistically significant (P < 0.05). This result indicates that circTP63 has an inhibitory effect on cell proliferation.

Example 5 Effect of circTP63 on the growth cycle of Lung squamous carcinoma cells

In this example, the effect of circTP63 on the cell growth cycle was examined using flow cytometry.

1. The cell culture procedure was as in example 3.

2. The cell transfection procedure was as in example 3.

3. Dyeing process

3.1 the cultured cells were removed from the incubator, the culture medium was removed, and the cells were washed 2 times with PBS.

3.2 adding 0.25% pancreatin to the culture dish to digest the cells, terminating the cell digestion with culture medium after a certain period of time, and collecting the cell fluid in a flow tube.

3.31000 rpm for 5min, discard the supernatant, with lmL PBS heavy suspension cells. Centrifuging again and discarding the supernatant.

3.4 75% ethanol in PBS, lmL 75% ethanol was added to the Ep tube. Mixing by turning upside down, and storing at-20 deg.C for more than 24 h.

After 3.5 fixation for 24h, cells were harvested by centrifugation at l000rpm for 5min, the supernatant was discarded, 500ul PBS was added, cells were resuspended, and cells were harvested by centrifugation at 1000rpm for 5 min.

3.6 resuspension of the cells with 100ul PBS, 100ul PI stain (BD Pharmingen) per 1X 106 addition^TMCompany), incubating for 10-30min at room temperature in dark, and detecting the cell cycle change on a machine.

4. Statistical method

The statistical method was the same as in example 1.

5. Results

As shown in FIG. 5, the results of the experiment show that after transfection of siRNA for 24 hours, SW900 cells had 60.83% of cells at the G1 phase in the sinC group, 72.34% of cells at the G1 phase in the si-circTP63 group, 35.12% of cells at the G1 phase in the sinC group in the H1703 cell group, and 45.15% of cells at the G1 phase in the si-circTP63 group. This result indicates that, when si-circTP63 was transfected, the number of cells in G1 phase was significantly increased and the cell growth cycle was slowed compared to si-NC.

This result suggests that the expression of circTP63 was down-regulated and the cell cycle was arrested at stage G1. Therefore, circTP63 has a significant growth inhibitory effect on lung squamous carcinoma cells.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Shanghai City institute for tumor

Application of <120> cyclic TP63 as lung squamous carcinoma diagnosis or treatment target

<130> 193264

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 295

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 1

gtgaggggcc gtgagactta tgaaatgctg ttgaagatca aagagtccct ggaactcatg 60

cagtaccttc ctcagcacac aattgaaacg tacaggcaac agcaacagca gcagcaccag 120

cacttacttc agaaacagac ctcaatacag tctccatctt catatggtaa cagctcccca 180

cctctgaaca aaatgaacag catgaacaag ctgccttctg tgagccagct tatcaaccct 240

cagcagcgca acgccctcac tcctacaacc attcctgatg gcatgggagc caaca 295

<210> 2

<211> 21

<212> DNA

<213> primers (Primer)

<400> 2

gccctcactc ctacaaccat t 21

<210> 3

<211> 21

<212> DNA

<213> primers (Primer)

<400> 3

ttgtgtgctg aggaaggtac t 21

<210> 4

<211> 22

<212> DNA

<213> primers (Primer)

<400> 4

agttgcgtta caccctttct tg 22

<210> 5

<211> 20

<212> DNA

<213> primers (Primer)

<400> 5

gctgtcacct tcaccgttcc 20

<210> 6

<211> 19

<212> DNA/RNA

<213> Small interfering RNA (siRNA)

<400> 6

gccaacagug aggggccgu 19

<210> 7

<211> 21

<212> DNA/RNA

<213> Small interfering RNA (siRNA)

<400> 7

caacagugag gggccgugag a 21

<210> 8

<211> 19

<212> DNA/RNA

<213> Small interfering RNA (siRNA)

<400> 8

uucuccgaac gugucacgu 19

<210> 9

<211> 60

<212> DNA/RNA

<213> Probe (Probe)

<400> 9

ggagccaaca gtgaggggcc gtgagactta tgaaatgctg ttgaagatca aagagtccct 60

Claims

1. Use of cyclic TP63 for the preparation of a diagnostic agent for the diagnosis of squamous cell lung carcinoma.

2. The application of the diagnostic reagent for specifically recognizing or amplifying the circular TP63 in preparing the kit for diagnosing the squamous cell lung carcinoma.

3. The use according to claim 1 or 2, wherein the diagnostic agent comprises:

a primer for specifically amplifying circular TP 63; or

A probe that specifically recognizes circular TP 63; or

Chip specifically recognizing circular TP 63.

4. A kit for diagnosing squamous cell lung carcinoma, comprising:

A probe that specifically recognizes circular TP 63; or

Chip specifically recognizing circular TP 63.

5. The use of a down-regulator of cyclic TP63 in the preparation of a pharmaceutical composition for alleviating or treating squamous cell lung carcinoma, or in the preparation of a pharmaceutical composition for arresting the cell cycle of squamous cell lung carcinoma at G2/M.

6. The use according to claim 5, wherein the downregulator of cyclic TP63 comprises: interfering molecules which specifically interfere the expression of the cyclic TP63, small molecular compounds which specifically inhibit the cyclic TP63, and gene editing reagents for specifically knocking out the cyclic TP 63; preferably, the circular TP63 down-regulator specifically targets the reverse cleavage point of circTP63, thereby specifically targeting circTP63 without affecting the function of TP 63; preferably, the interfering molecule is siRNA, antisense nucleic acid, miRNA, dsRNA, shRNA targeting cyclic TP63 for inhibition or silencing, or a construct capable of expressing or forming the siRNA, antisense nucleic acid, miRNA, dsRNA, shRNA; more preferably, the interfering molecule is siRNA selected from the nucleotide sequences shown in SEQ ID NO 6 or SED ID NO 7.

7. Use of annular TP63 for screening for a potential agent for ameliorating or treating squamous cell lung cancer.

8. A method of screening for potential agents for ameliorating or treating squamous cell lung carcinoma, the method comprising:

(1) treating a system expressing circular TP63 with a candidate substance; and

(2) detecting expression of cyclic TP63 in said system;

wherein, if the candidate substance can reduce the expression of ring TP63, the candidate substance is a potential substance for relieving or treating lung squamous carcinoma.

9. The method of claim 8, wherein step (1) comprises: in the test group, the candidate substance was added to a system expressing circular TP 63; and/or

The step (2) comprises the following steps: detecting the expression of cyclic TP63 in the test group of systems and comparing the expression with a control group, wherein the control group is a system which does not add the candidate substance and expresses cyclic TP 63;

if the expression of cyclic TP63 in the test group is statistically lower than in the control group, it indicates that the candidate is a potential agent for alleviating or treating squamous cell lung carcinoma.

10. A pharmaceutical composition for alleviating or treating squamous cell lung carcinoma or retarding the cell cycle of squamous cell lung carcinoma to G2/M, wherein said pharmaceutical composition comprises: a downregulator of cyclic TP63 and a pharmaceutically acceptable carrier; wherein the down regulator is an interfering molecule which specifically interferes with the expression of the cyclic TP63, a small molecule compound which specifically inhibits the cyclic TP63, and a gene editing reagent which specifically knocks out the cyclic TP 63; preferably, the interfering molecule is siRNA, antisense nucleic acid, miRNA, dsRNA, shRNA targeting cyclic TP63 for inhibition or silencing, or a construct capable of expressing or forming the siRNA, antisense nucleic acid, miRNA, dsRNA, shRNA; more preferably, the interfering molecule is siRNA selected from the nucleotide sequences shown in SEQ ID NO 6 or SED ID NO 7.