CN105950720A - Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent - Google Patents
Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent Download PDFInfo
- Publication number
- CN105950720A CN105950720A CN201610279215.0A CN201610279215A CN105950720A CN 105950720 A CN105950720 A CN 105950720A CN 201610279215 A CN201610279215 A CN 201610279215A CN 105950720 A CN105950720 A CN 105950720A
- Authority
- CN
- China
- Prior art keywords
- beta
- seq
- catenin gene
- catenin
- sequence table
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a beta-catenin gene mutation detection reagent in a Wnt signal path based on a peptide nucleic acid probe, a PCR detection method and applications of the beta-catenin gene mutation detection reagent, belonging to the technical fields of fundamental biology research and biological detection. The detection reagent comprises primers, peptide nucleic acid fluorescence probes and wild type complementary peptide nucleic acid sequences, wherein the forward primers are shown as SEQ ID NO.1 and SEQ ID NO.3 in the sequence table, and the reverse primers are shown as SEQ ID NO.2 and SEQ ID NO.4 in the sequence table; the peptide nucleic acid fluorescence probes are shown as SEQ ID NO.5 and SEQ ID NO.6 in the sequence table; and the wild type complementary peptide nucleic acid sequences are shown as SEQ ID NO.7 and SEQ ID NO.8 in the sequence table. According to the invention, the beta-catenin gene mutation condition in the Wnt signal path can be rapidly found from the aspect of the transcriptional level, the beta-catenin gene mutation detection reagent has the advantages of strong specificity, high sensitivity and the like, and therefore, a tool is provided for screening the anti-cancer drugs, studying the novel targeted drugs, and researching the basic scientific.
Description
Technical field
The present invention relates to molecular biology and clinical molecular diagnosis technical field, particularly relate to a kind of based on peptide
Beta-catenin gene abrupt climatic change reagent, PCR detection side in the Wnt signal path of nucleic acid (PNA) probe
Method and application.
Background technology
Wnt signal path is widely present in invertebrates and vertebrates, is that a class is in spore mistake
The signal path that journey camber is conservative.Wnt signal is at the early development of animal embryo, orga-nogenesis, tissue
In regeneration and other physiological process, there is vital effect.If the crucial egg in this signal paths
Undergo mutation in vain or unconventionality expression, cause abnormal signal to activate, it is possible to the generation of induced cancer.Wnt
Signal path includes the Wnt signal path of classics and non-classical Wnt signal path, at classical path i.e.
In Wnt-β-catenin signal path, the Wnt factor is subject to by the Frizzle/LRP5/6 on active cell film is collaborative
Phosphorylation and degraded, the β-catenin albumen in Cytoplasm of endocellular liberation β-catenin albumen is suppressed after body
Level will occur the core displacement of β-catenin albumen after raising, and cause β-catenin albumen in nucleus to raise,
In karyon, β-catenin albumen can combine that Pygo2, Bcl-9 and FoxM1 albumen is common and TCF/LEF-1
Transcription factor family forms complex and activates the transcriptional activation of Wnt signal path downstream target gene.
The most increasing research has been found that β-catenin albumen all presents different journey in a lot of tumors
The sudden change of degree.
Study the core element regulatory mechanism of core signal path at present, and some important member is in cell
Expression, have become as treatment tumor a kind of key means, Wnt signal path is in cancer in recent years
In research, and β-catenin albumen as Wnt signal path important member its sudden change level research,
Have become as the major issue that research and development tumour medicine is badly in need of solving, especially at β-catenin protein A rms
The sudden change occurred in repetitive structure territory, plays very important effect, example to β-catenin protein exhibits function
As detected that R225C suddenlys change in Colon and rectum adenocarcinoma cell, lung adenocarcinoma cell detects V600G sudden change etc..
Peptide nucleic acid(PNA) (peptide nucleic acids, PNA) is that a class replaces sugar phosphate backbone with polypeptide backbone
DNA analog.It is on the basis of the first generation, second filial generation antisense agent, is built by Computer Design
And the third generation antisense agent of final synthetic, it is a kind of brand-new DNA analog, i.e. with neutral peptide
Chain amide 2-aminoethylglycine key instead of the pentose phosphate diester linkage skeleton in DNA, remaining
Identical with DNA, PNA can pass through the form identification of Watson-Crick base pairing and combine DNA
Or RNA sequence, form stable double-spiral structure.Owing to PNA is the most electronegative, with DNA and RNA
Between there is not electrostatic repulsion, thus the stability combined and specificity all greatly improve；Be different from DNA or
The hybridization of the hybridization between DNA, RNA, PNA Yu DNA or RNA is little affected by hybridization system salinity
Impact, is much better than DNA/DNA or DNA/RNA with the hybridization ability of DNA or RNA molecule, performance
The highest hybridization stability, excellent distinguished sequence identification ability, not by nuclease and protease hydrolysis.
This method uses the PNA oligomer of distinguished sequence as probe.Owing to PNA is a kind of synthetic
The analog of nucleic acid, and be achirality, uncharged molecule, it is to avoid oligonucleotide and its target gene
In conjunction with time because of mutually exclusive the caused hybridization unstability of electric charge, in conjunction with being susceptible to hybridization solution ionic strength
Impact, thus demonstrate extremely strong heterosis, hybrid vigor, substantially increase detection sensitivity.
Summary of the invention
It is an object of the invention to for how prior art determines the signaling molecule of core in Wnt signal path
Beta-catenin gene catastrophe, and how to explain core element β-catenin sudden change in tumor cell
The difficulty of level change, it is provided that beta-catenin gene abrupt climatic change reagent in a kind of detection Wnt signal path,
PCR detection method and application.
It is an object of the invention to provide a kind of signaling molecule β-catenin base of core in Wnt signal path
Because of the reagent of abrupt climatic change, including the wild type PNA sequence for blocking wild-type beta-catenin gene amplification,
For specific amplification R225C, V600G saltant type beta-catenin gene sequence one group of primer to and sudden change
Type PNA fluorescent probe:
Described detection beta-catenin gene R225C mutant forward primer such as SEQ ID NO.1 in sequence table；
SEQ ID NO.2 in described detection beta-catenin gene R225C sudden change reverse primer such as sequence table；
Described detection beta-catenin gene V600G mutant forward primer such as SEQ ID NO.3 in sequence table；
SEQ ID NO.4 in described detection beta-catenin gene V600G sudden change reverse primer such as sequence table；
Described detection beta-catenin gene R225C saltant type PNA fluorescent probe such as SEQ ID in sequence table
NO.5；
Described detection beta-catenin gene V600G saltant type PNA fluorescent probe such as SEQ ID in sequence table
NO.6；
The described specific binding beta-catenin gene 225 codon wild type PNA sequence that comprises is as in sequence table
SEQ ID NO.7。
The described specific binding beta-catenin gene 600 codon wild type PNA sequence that comprises is as in sequence table
SEQ ID NO.8。
The described fluorescent reporter group modifying described 5' end is: FAM, HEX, TET, JOE, VIC, ROX,
Cy3 or Cy5, the quenching group modifying described 3' end is: TAMRA, Eclipse, BHQ1, BHQ2,
BHQ3 or DABCYL.
Detectable of the present invention also includes PCR reactant liquor, 225 codons and 600 codon mutations
Type reference material, 225 codons and 600 codon reference wild-type product, wherein PCR reactant liquor includes: DEPC
Water, have exo-acting for 5' → 3' archaeal dna polymerase, dNTPs, 10 × PCR buffer, RNASIN,
M-MLV reverse transcriptase, oligo (dT) and the solution containing Mg ion.
Described 225 codon mutation type reference materials are the recombinant plasmid dna containing SEQ NO.9；
Described 225 codon reference wild-type product are the recombinant plasmid dna containing SEQ NO.10；
Described 600 codon mutation type reference materials are the recombinant plasmid dna containing SEQ NO.11；
Described 600 codon reference wild-type product are the recombinant plasmid dna containing SEQ NO.12；
Archaeal dna polymerase exo-acting for the described 5' of having → 3' is Taq enzyme；
Final concentration of in pcr amplification reaction system of the described each component of PCR reactant liquor: Taq enzyme
0.01U/ μ l～0.05U/ μ l, dNTPs 0.2～0.6mM, 10 × PCR buffer 1 ×, RNASIN
40U/ μ l～60U/ μ l, M-MLV reverse transcriptase 200U/ μ l～320U/ μ l, MgCl21.5～5.0mM, molten
Agent is DEPC water.
Specifically, final concentration of 0.05～0.9 μM of described forward primer, described reverse primer final concentration of
0.05～0.9 μM, final concentration of 0.05～0.9 μM of described oligo (dT), described complementary PNA sequence is eventually
Concentration is 0.05～0.9 μM, final concentration of 0.05～0.9 μM of described fluorescent probe.
Reagent of the present invention carries out the response procedures of real-time fluorescence quantitative PCR: 42 DEG C of reverse transcriptions 20
min；94 DEG C of denaturations, 2min；95 DEG C of degeneration, 30s, 58 DEG C, 45s (collection fluorescence), carry out 40
Individual circulation.
The principle of the present invention is by building the one section peptide nucleic acid(PNA) PNA sequence complementary with beta-catenin gene wild type
Row, when peptide nucleic acid(PNA) PNA sequence is combined with beta-catenin gene complementation, arbitrary sudden change all may result in
PNA/DNA produces mispairing, so that solution temperature changes.And then dash forward according to beta-catenin gene
It is fixed that Variant Design specific peptide nucleic acid(PNA) PNA probe and primer carry out fluorescence to β-catenin mutated genes
Amount PCR amplification, after the PCR amplification that takes turns, can be by beta-catenin gene saltant type and wild type
Make a distinction and come.
Further, present invention also offers described reagent in the detectable of preparation detection cancerous cell
Application, described cancerous cell is Colon and rectum adenocarcinoma, adenocarcinoma of lung.
Compared with prior art, advantages of the present invention and good effect are: the invention provides and directly detect Wnt
The reagent of beta-catenin gene abrupt climatic change in signal path, can be by real time by means of described detectable
Fluorescence quantitative PCR method quickly detects the sudden change of beta-catenin gene at transcriptional level, and with the most glimmering
Unlike Fluorescent Quantitative PCR, the present invention designs wild type PNA sequence, can effectively suppress wild type gene group
Amplification, only the amplification of enrichment mutated genes, substantially increases detection specificity, peptide nucleic acid(PNA) PNA that we use
Fluorescent probe is sensitiveer, and the present invention is the screening of cancer therapy drug, and the Mechanism Study of new targeted drug all provides
The strongest instrument.
The experimental system of the present invention can be carried out on any real-time fluorescence quantitative PCR instrument simultaneously, on
Stating primer to be placed in eight unions, carry out real-time fluorescence quantitative PCR detection, experimental implementation is simple, low cost,
Result repeatability, sensitivity is good, is the research tumor related drugs mechanism of action and the one of basic scientific research
Important means.
Accompanying drawing explanation
Fig. 1 is peptide nucleic acid(PNA) mass spectrum described in the embodiment of the present invention；
Fig. 2 is sample, R225C saltant type and reference wild-type product PCR amplification figure；
Fig. 3 is sample, V600G saltant type and reference wild-type product PCR amplification figure；
Detailed description of the invention
By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.Thered is provided
Embodiment be only the explanation to the inventive method, and limit never in any form the present invention disclose remaining in
Hold.
The present invention is illustrated by Colon and rectum adenocarcinoma cell, but the present invention is not limited to Colon and rectum gland
Cancerous cell, detectable of the present invention can also be applied to adenocarcinoma of lung.
Relevant DNA and RNA basic operation in embodiment is all with reference to " molecular cloning: laboratory operation refers to
South " (gold winter wild goose etc. are translated, Science Press, Beijing (1998)) and " fine works Molecular Biology " (face
Son is translated, Science Press, Beijing (1998)).
In the present invention, SW480 (people's Colon and rectum adenocarcinoma SW480 cell line) is purchased from U.S. ATCC, cultivates thin
RPMI-1640 culture medium and 10% hyclone that born of the same parents are used are purchased from handsome company, and other reagent are main
Purchased from precious biological engineering (Dalian) company limited.
[embodiment 1] primed probe designs
According to American National Biotechnology Information center (National Center for Biotechnology
Information, NCBI) (http://www.ncbi.nlm.nih.gov) β-catenin mRNA sequence of reporting
(NCBI Reference Sequence:NM_001098209.1), uses the exploitation of Applied Biosystems company
The special β-catenin primer of Primer Express Software for Real-Time PCR software design and spy
Pin.
β-catenin R225C:
β-catenin-F:5'-CGTTCTCCTCAGATGGTGTCTG-3'；(SEQ NO.1)
β-catenin-R:5'-ACCAGCTAAACGCACTGCC-3'；(SEQ NO.2)
Saltant type β-catenin (PNA)-P:5'FAM-CCTTTCCCATCATTGTGAGG-BHQ 3'；
(SEQ NO.5)
Wild-type beta-catenin-PNA:5'-CCTTTCCCATCATCGTGAGG-3'；(SEQ NO.7)
Saltant type target sequence:
AAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTAT
TGTACGTACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGC
TGGGACCTTGCATAACCTTTCCCATCATTGTGAGGGCTTACTGGCCATCTTT
AAGTCTGGAGGCATTCCTGCCCTGGTGAAAATGCTTGGTTCACCAGTGGAT
TCTGTGTTGTTTTATGCCATTACAACTCTCCACAACCTTTTATTACATCAAG
AAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAGAAAATGGTT
G；(SEQ NO.9)
Wild-type target sequence:
CGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGTACCATG
CAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCAT
AACCTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGC
ATTCCTGCCCTGGTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTT
ATGCCATTACAACTCTCCACAACCTTTTATTACATCAAGAAGGAGCTAAAAT
GGCAGTGCGTTTAGCTGGTGGGCT；(SEQ NO.10)
β-catenin V600G:
β-catenin-F:5'-AGGTTGTACCGGAGCCCTTC-3'；(SEQ NO.3)
β-catenin-R:5'-GCAGCTTCCTTGTCCTGAGC-3'；(SEQ NO.4)
Saltant type β-catenin (PNA)-P:5'FAM-ATTCCATTGTTTGGGCAGCT-BHQ 3'；
(SEQ NO.6)
Wild-type beta-catenin-PNA:5'-ATTCCATTGTTTGTGCAGCT-3'；(SEQ NO.8)
Saltant type target sequence:
GAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTAGCTCGGGATG
TTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGGGCA
GCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCT
CTGTGAACTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGG
GAGCCACAGC；(SEQ NO.11)
Wild-type target sequence:
ATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTAGCTCGGGATGTT
CACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTGCAG
CTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTC
TGTGAACTTGCTCAGGACAAGGAAGCTGCAGAAGCTAT；(SEQ NO.12)
Above: F:forward, forward；β-catenin-F represents the forward primer for detecting nucleic acid.
R:reverse, reversely；β-catenin-R represents the reverse primer for detecting nucleic acid.
P:probe, fluorescent probe；β-catenin-P represents the fluorescent probe for detecting nucleic acid, should
Fluorescent probe is TaqMan fluorescent probe.
In embodiments of the present invention, the fluorescent reporter group of the 5' end modifying fluorescent probe can be: FAM,
HEX, TET, JOE, VIC, ROX, Cy3 or Cy5；Modify the quenching group of the 3' end of fluorescent probe
Can be: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL, this fluorescence report
Group and quenching group do not affect the amplification of quantitative fluorescent PCR, only need to according to the fluorescent reporter group of probe and
The model of the instrument used by quenching group selection arranges detectable fluorescence signal scope.The embodiment of the present invention carries
The fluorescent probe fluorescent reporter group of confession: the excitation wavelength of FAM, HEX, TET and FAM is 470-650nm,
Reception wavelength is 500-700nm；Quenching group: Eclipse, TAMRA, BHQ1.After primer synthesis
Way of purification can be: HAP, PAGE and HPLC way of purification.
[embodiment 2] builds containing beta-catenin gene saltant type and the recombiant plasmid of the DNA fragmentation of wild type
One, people's Colon and rectum adenocarcinoma SW480 cell line is cultivated and is passed on
1) cell is cultivated
All cells system uses RPMI-1640 culture medium (Invitrogen, Carlsbad, CA), 10% tire Sanguis Bovis seu Bubali
Clearly (Invitrogen, Carlsbad, CA), in 37 DEG C, 5%CO2Cultivate under environment.
2) passage
First by sterilizing suction pipe by the culture fluid sucking-off in Tissue Culture Dish, add PBS and clean 2
Time, in cell, slowly drip appropriate trypsin, treat cell rounding, after adjustment angle cell can move
Add the DMEM culture medium containing 10% hyclone of 3ml, the most gently after piping and druming, basis of microscopic observation
Cellular morphology also counts, according to the content of cell in culture dish by the training of appropriate passage to other sterilizings
Support in ware, after adding the DMEM culture medium of 5ml, put into 5%CO2Incubator.
Cell counting formula (individual/ml): (4 big lattice total cellular score) × 104× extension rate/4
Two, the extraction of total serum IgE
1) outwell culture medium, after PBS, directly 1ml Trizol is injected culture bottle (wherein cell 5 × 106
Individual/ml), suction is uniformly repeatedly；
2) in equipped with the centrifuge tube of lysate, add the chloroform (for the 1/5 of Trizol cumulative volume) of 0.2ml, shake
Swing and be mixed 30 seconds, left at room temperature 5 minutes；
3) centrifugal 15 minutes of 12000rpm 4 DEG C, split-phase is three layers.Upper strata: RNA (the 60% of about Trizol)；
Middle: DNA；Lower floor: protein (phenol-chloroform)；
4) careful Aspirate supernatant, transfers in another EP pipe.The supernatant volume that 1ml lysate produces
It is about 0.4～0.6ml.DNA and protein are contained in organic facies and intermediate layer, avoid touching；
5) supernatant adds the isopropanol of about 0.5ml, and vibration is mixed 30 seconds.Left at room temperature 10 minutes；
6) centrifugal 10 minutes of 12000rpm 4 DEG C；
7) side at the centrifugal end is formed by RNA precipitate.Careful suction abandons supernatant, notes avoiding suction to abandon RNA
Precipitation；
8) centrifuge tube adds 75% ethanol (1ml Trizol at least 1ml ethanol purge DNA) of 1ml pre-cooling,
Vibration is mixed 30 seconds, makes precipitation vibrate, and room temperature 12000rpm is centrifuged 1～2 minute.Inhale as far as possible and abandon
Supernatant, prevents RNA precipitate from losing.Repeat above cleaning step once.In 75% ethanol, RNA exists
4 DEG C at least preserve 1 week, and-20 DEG C at least preserve 1 year；
9) room temperature selecting liquidity is little, and inversion centrifuge tube, on filter paper, is dried RNA, but can not be completely dried
(5～10 minutes).With DEPC water 15 μ l dissolution precipitation, hatch 10～15 minutes for 55-60 DEG C.
10) RNA purity detecting
Drip 2 μ l RNA solution in ultramicrospectrophotometer (model: P330-311), and read in instrument
OD260/OD280 ratio.
Three, construction recombination plasmid
1) DNA fragmentation containing beta-catenin gene saltant type and wild type is carried out PCR amplification；
2) PCR primer is carried out double digestion；
Carrier and PCR primer respectively with condition once carry out double digestion (reaction system is 30 μ l, 37 DEG C,
Enzyme action 2 hours)；
3) (operating according to test kit description) is reclaimed in rubber tapping after double digestion product electrophoresis；
4) digestion products is attached with plasmid vector；
Above-mentioned double digestion product through purification, (wherein reclaim, after PCR fragment enzyme action by the rubber tapping of carrier digestion products
Purification step is identical with above-mentioned PCR primer purification step), 16 DEG C of connections under T4DNA ligase effect
Overnight.Linked system is as follows: carrier, 2 μ l；PCR fragment, 6 μ l；10xT4 buffer, 1 μ l；T4 DNA
Ligase, 1 μ l.
5) E. coli competent is converted；
Take above-mentioned connection liquid 5 μ l to be transformed in previously prepared DH5 α Competent cell, ice bath 30 points
Clock, 42 DEG C of heat shock 2min, put 5min on ice, add 37 DEG C of shaking table 45min of 1mlLB culture fluid, centrifugal
5000rpm, 1-5min (not centrifugal too long, in order to avoid the most real), finally it is uniformly coated on containing 100ng/ml
On the LB flat board of antibiotic (100-150 μ l).Flat board is inverted overnight incubation at 37 DEG C.Positive gram of picking
Grand bacterium colony turns to draw and contains on the LB flat board of 100ng/ml antibiotic to another block, and is numbered it, 37 DEG C
It is inverted overnight incubation.
6) QIAGEN test kit extracting plasmid (carrying out to specifications), makes reference material.
[embodiment 3] quantitative real-time PCR amplified sample
Taking the total serum IgE 1-5 μ g of extraction, add PCR reactant liquor, PCR reactant liquor includes: sterilized water, tool
There are exo-acting for 5' → 3' archaeal dna polymerase, dNTPs, 10 × PCR Buffer, RNASIN, M-MLV
Reverse transcriptase, oligo (dT) and the solution containing Mg ion.Wherein, concentration be 5U/ μ l there is 5' → 3'
Exo-acting archaeal dna polymerase 0.3 μ l, concentration is the dNTPs 2 μ l, 10 × PCR Buffer of 10mmol/L
5 μ l, concentration is the RNASIN 0.6 μ l of 40U/ μ l, and concentration is the M-MLV reverse transcriptase 0.6 μ l of 200U/ μ l,
Concentration is the MgCl of 25mmol/L2Solution 5 μ l, adding sterilized water to volume is 50 μ l.Wherein, have
Archaeal dna polymerase exo-acting for 5' → 3' can be Taq enzyme.
PCR expands: each reaction tube is put into the reactive tank of quantitative fluorescent PCR instrument, arranges mark fluorescent
Radical species, sample ID and type, select Taqman fluorescence probe (this product fluorescence report to be used
Group is FAM, HEX, TAT, and fluorescent quenching group is Eclipse), define sample well, and according to the form below carries
The amplification program of confession carries out PCR amplification:
Table 1 is pcr amplification reaction amplification program
Fluorescent value is read in end of a period in the 3rd step of amplification program；
Data analysis judges:
Select institute's sample this saltant type corresponding with this pattern detection site and reference wild-type sample wells simultaneously, right
Ratio three hole PCR amplification curve (CTARepresent sample aperture CT value, CTWRepresent wild type CT value, CTM
Represent saltant type CT value):
Work as CTM≤CTA＜ CTWTime, show that this sample exists sudden change；
Work as CTW=CTATime, show that this sample is wild type.
Fig. 1 is peptide nucleic acid(PNA) mass spectrum described in the embodiment of the present invention；
Fig. 2 is R225C saltant type described in the embodiment of the present invention and reference wild-type product PCR amplification figure, figure
Three bars, middle upper, middle and lower line respectively represent β-catenin the 225th bit codon mutation type reference material, sample and
The amplification curve of reference wild-type product；
Fig. 3 is V600G saltant type described in the embodiment of the present invention and reference wild-type product PCR amplification figure, figure
Three bars, middle upper, middle and lower line respectively represent β-catenin the 600th bit codon mutation type reference material, sample and
The amplification curve of reference wild-type product；
Above example is only used for technical scheme is described, rather than is limited, although reference
The present invention has been described in detail by previous embodiment, for the person of ordinary skill of the art, depends on
So the technical scheme described in previous embodiment can be modified, or wherein portion of techniques feature is entered
Row equivalent, and these amendments or replacement, do not make the essence of appropriate technical solution depart from institute of the present invention
The spirit and scope of claimed technical scheme.
Claims (6)
1. a reagent for the signaling molecule beta-catenin gene abrupt climatic change of core in Wnt signal path,
It is characterized in that, including the wild type PNA sequence for blocking wild-type beta-catenin gene amplification, for
One group of primer of specific amplification R225C, V600G saltant type beta-catenin gene sequence to and saltant type
PNA fluorescent probe:
Described detection beta-catenin gene R225C mutant forward primer such as SEQ ID NO.1 in sequence table；
SEQ ID NO.2 in described detection beta-catenin gene R225C sudden change reverse primer such as sequence table；
Described detection beta-catenin gene V600G mutant forward primer such as SEQ ID NO.3 in sequence table；
SEQ ID NO.4 in described detection beta-catenin gene V600G sudden change reverse primer such as sequence table；
Described detection beta-catenin gene R225C saltant type PNA fluorescent probe such as SEQ ID in sequence table
NO.5；
Described detection beta-catenin gene V600G saltant type PNA fluorescent probe such as SEQ ID in sequence table
NO.6；
The described specific binding beta-catenin gene 225 codon wild type PNA sequence that comprises is as in sequence table
SEQ ID NO.7；
The described specific binding beta-catenin gene 600 codon wild type PNA sequence that comprises is as in sequence table
SEQ ID NO.8；
The described fluorescent reporter group modifying described 5' end is: FAM, HEX, TET, JOE, VIC, ROX,
Cy3 or Cy5, the quenching group modifying described 3' end is: TAMRA, Eclipse, BHQ1, BHQ2,
BHQ3 or DABCYL.
The signaling molecule beta-catenin gene of core in Wnt signal path the most according to claim 1
The reagent of abrupt climatic change, it is characterised in that described detectable also includes PCR reactant liquor, 225 passwords
Son and 600 codon mutation type reference materials, 225 codons and 600 codon reference wild-type product；Wherein
PCR reactant liquor includes: DEPC water, have exo-acting for 5' → 3' archaeal dna polymerase, dNTPs, 10 × PCR
Buffer, RNASIN, M-MLV reverse transcriptase, oligo (dT) and the solution containing Mg ion；Described
225 codon mutation type reference materials are the recombinant plasmid dna containing SEQ NO.9；Described 225 password Ziyes
Raw type reference material is the recombinant plasmid dna containing SEQ NO.10；Described 600 codon mutation type reference materials are
Recombinant plasmid dna containing SEQ NO.11；Described 600 codon reference wild-type product are containing SEQ NO.12
Recombinant plasmid dna.
The signaling molecule beta-catenin gene of core in Wnt signal path the most according to claim 2
The reagent of abrupt climatic change, it is characterised in that described in have archaeal dna polymerase exo-acting for 5' → 3' be Taq
Enzyme.
The signaling molecule beta-catenin gene of core in Wnt signal path the most according to claim 3
The reagent of abrupt climatic change, it is characterised in that the described each component of PCR reactant liquor is in pcr amplification reaction system
Final concentration of: Taq enzyme 0.01U/ μ l～0.05U/ μ l, dNTPs 0.2～0.6mM, 10 × PCR buffer
1 ×, RNASIN 40U/ μ l～60U/ μ l, M-MLV reverse transcriptase 200U/ μ l～320U/ μ l, MgCl21.5～
5.0mM, solvent is DEPC water；Final concentration of 0.05～0.9 μM of described forward primer, described reversely draws
Final concentration of 0.05～0.9 μM of thing, final concentration of 0.05～0.9 μM of described oligo (dT), described complementation
Final concentration of 0.05～0.9 μM of PNA sequence, final concentration of 0.05～0.9 μM of described fluorescent probe.
5. according to the signaling molecule beta-catenin gene of core in Wnt signal path described in claim 1-4
The reagent of abrupt climatic change, it is characterised in that described reagent carries out the response procedures of real-time fluorescence quantitative PCR
For: 42 DEG C of reverse transcription 20min；94 DEG C of denaturations, 2min；95 DEG C of degeneration, 30s, 58 DEG C, 45s,
Now collect fluorescence, carry out 40 circulations.
6. the application in the detectable of preparation detection cancerous cell of the reagent described in claim 1-5, described cancer is thin
Born of the same parents are Colon and rectum adenocarcinoma, adenocarcinoma of lung.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610279215.0A CN105950720A (en) | 2016-04-29 | 2016-04-29 | Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610279215.0A CN105950720A (en) | 2016-04-29 | 2016-04-29 | Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105950720A true CN105950720A (en) | 2016-09-21 |
Family
ID=56916753
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610279215.0A Pending CN105950720A (en) | 2016-04-29 | 2016-04-29 | Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105950720A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107868817A (en) * | 2017-11-20 | 2018-04-03 | 湖北工业大学 | A kind of Glycogen synthesis kinases（GSK3β）The kit of gene R111Q abrupt climatic changes |
| JP2018113898A (en) * | 2017-01-18 | 2018-07-26 | 国立大学法人広島大学 | Mutant gene detection kit and mutant gene detection method |
| CN114957491A (en) * | 2022-06-29 | 2022-08-30 | 湖北工业大学 | Polypeptide and polypeptide derivative in targeted combination with beta-catenin protein and application of polypeptide and polypeptide derivative |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925582A (en) * | 2012-11-16 | 2013-02-13 | 上海赛安生物医药科技有限公司 | Quick detection method for beta-Catenin gene mutation |
| CN103667490A (en) * | 2013-12-12 | 2014-03-26 | 向华 | Preparation method for nucleic acid mass spectrum for detecting mutation of colorectal cancer K-ras gene and product for detecting mutation of colorectal cancer K-ras gene |
| CN104694622A (en) * | 2014-12-17 | 2015-06-10 | 上海长海医院 | Probe for detecting K-ras gene mutation, primer, kit and method |
-
2016
- 2016-04-29 CN CN201610279215.0A patent/CN105950720A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925582A (en) * | 2012-11-16 | 2013-02-13 | 上海赛安生物医药科技有限公司 | Quick detection method for beta-Catenin gene mutation |
| CN103667490A (en) * | 2013-12-12 | 2014-03-26 | 向华 | Preparation method for nucleic acid mass spectrum for detecting mutation of colorectal cancer K-ras gene and product for detecting mutation of colorectal cancer K-ras gene |
| CN104694622A (en) * | 2014-12-17 | 2015-06-10 | 上海长海医院 | Probe for detecting K-ras gene mutation, primer, kit and method |
Non-Patent Citations (3)
| Title |
|---|
| YASUHIRO YAMADA ET AL.,: "β-Catenin mutation is selected during malignant transformation in colon carcinogenesis", 《CARCINOGENESIS》 * |
| 徐洪涛等: "β-catenin在NSCLC中的表达盒突变研究", 《中国肺癌杂志》 * |
| 那冬晨: "《环境分子生物学研究技术与方法》", 31 August 2012 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2018113898A (en) * | 2017-01-18 | 2018-07-26 | 国立大学法人広島大学 | Mutant gene detection kit and mutant gene detection method |
| CN107868817A (en) * | 2017-11-20 | 2018-04-03 | 湖北工业大学 | A kind of Glycogen synthesis kinases（GSK3β）The kit of gene R111Q abrupt climatic changes |
| CN114957491A (en) * | 2022-06-29 | 2022-08-30 | 湖北工业大学 | Polypeptide and polypeptide derivative in targeted combination with beta-catenin protein and application of polypeptide and polypeptide derivative |
| CN114957491B (en) * | 2022-06-29 | 2023-05-23 | 湖北工业大学 | Polypeptide and polypeptide derivative for targeting binding beta-catenin protein and application of polypeptide and polypeptide derivative |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104911268B (en) | Detection reagent, PCR detection method and the application of Pygo2 gene mutation in Wnt signal path based on peptide nucleic acid probe | |
| CN103667514B (en) | A kind of human interleukin 2 8B gene pleiomorphism fluorescence PCR detection reagent kits | |
| CN106995858A (en) | A kind of lncRNA related to liver cancer diagnosis and treatment | |
| CN107630092B (en) | Application of miR-505-3p in diagnosis, prognosis and treatment of bone metastasis of prostate cancer | |
| CN105838796A (en) | AXIN2 gene mutation detection reagent and application | |
| CN105821127A (en) | Adenomatous polyposis coli protein APC gene mutation detection reagent and application thereof | |
| CN106701900A (en) | Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer | |
| CN105950720A (en) | Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent | |
| CN109913482B (en) | PIK3CA-I874R mutant gene and application thereof in auxiliary diagnosis of breast cancer | |
| CN104911271A (en) | Detection reagent based on Pygo2 and FoxM1 gene expression in Wnt signal pathways of peptide nucleic acid probes, PCR detection method and application of detection reagent | |
| CN108374043A (en) | The relevant biomarker of Parkinson and its application | |
| CN104911270A (en) | Peptide-nucleic-acid-probe-based detection reagent for Bcl-9 gene mutation in Wnt signal pathway, and PCR (polymerase chain reaction) detection method and application thereof | |
| CN105039522A (en) | Detection reagent based on FoxM1 gene mutations in Wnt signal paths of peptide nucleic acid probes, PCR detection method and application of detection reagent | |
| CN110408703A (en) | Colorectal cancer miRNA marker and its application | |
| CN106244715A (en) | The reagent of a kind of β catenin interaction protein 1 gene abrupt climatic change and application | |
| CN105713986A (en) | Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application | |
| CN103484551B (en) | Kit for detecting EGFR gene hot spot mutation and detection method | |
| CN101070538A (en) | Human epiterm growth-factor receptor mutation gene and use thereof | |
| CN105441405B (en) | BMX spliced body and its application in drug resistance of lung cancer | |
| CN105695619A (en) | Casein kinase-1 gene mutation detection reagent based on peptide nucleic acid probes and application | |
| CN105713985B (en) | A kind of reagent and application for plug transcription factor O1 detection in Gene Mutation | |
| CN106520776B (en) | A kind of breast cancer kit for screening | |
| CN108192977A (en) | A kind of and relevant molecular marker of gastric cancer occurrence and development | |
| CN106319068A (en) | Reagent for Chibby homologue 1 gene mutation detection and application | |
| CN106222296A (en) | The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160921 |