CN105838796A - AXIN2 gene mutation detection reagent and application - Google Patents
AXIN2 gene mutation detection reagent and application Download PDFInfo
- Publication number
- CN105838796A CN105838796A CN201610273761.3A CN201610273761A CN105838796A CN 105838796 A CN105838796 A CN 105838796A CN 201610273761 A CN201610273761 A CN 201610273761A CN 105838796 A CN105838796 A CN 105838796A
- Authority
- CN
- China
- Prior art keywords
- seq
- detection
- axin2
- gene
- sequence table
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses reagent for AXIN2 gene mutation detection, a PCR detection method and application and belongs to the technical field of basic biological research and biological detection .The detection reagent comprises a primer, a peptide nucleic acid fluorescent probe and a wild type complementary peptide nucleic acid sequence .A forward primer is as shown in SEQ ID NO.1 or NO.3 in a sequence table; a reverse primer is as shown in SEQ ID NO.2 or NO.4 in the sequence table; the peptide nucleic acid fluorescent probe is as shown in SEQ ID NO.5 or NO.6 in the sequence table; the wild type complementary peptide nucleic acid sequence is as shown in SEQ ID NO.7 or NO.8 in the sequence table .The AXIN2 gene mutation situation in a Wnt signal channel can be found rapidly from the transcriptional level, the reagent has the remarkable advantages of being high in specificity, high in sensitivity and the like, and a tool for anti-cancer medicine screening, new targeted medicine discussion and basic science research is provided.
Description
Technical field
The present invention relates to molecular biology and clinical molecular diagnosis technical field, be specifically related to a kind of axle suppression egg
White 2 (AXIN2) detection in Gene Mutation reagent and application.
Background technology
Wnt signal path is widely present in invertebrates and vertebrates, is that a class is in spore mistake
The signal path that journey camber is conservative.Wnt signal is at the early development of animal embryo, orga-nogenesis, tissue
In regeneration and other physiological process, there is vital effect.If the crucial egg in this signal paths
Undergo mutation in vain or unconventionality expression, cause abnormal signal to activate, it is possible to the generation of induced cancer.Wnt
Signal path includes the Wnt signal path of classics and non-classical Wnt signal path, at classical path i.e.
In Wnt-β-catenin signal path, the Wnt factor is subject to by the Frizzle/LRP5/6 on active cell film is collaborative
Phosphorylation and degraded, the β-catenin albumen in Cytoplasm of endocellular liberation β-catenin albumen is suppressed after body
Level will occur the core displacement of β-catenin albumen after raising, and cause β-catenin albumen in nucleus to raise,
In karyon, β-catenin albumen can combine that Pygo2, Bcl-9 and FoxM1 albumen is common and TCF/LEF-1
Transcription factor family forms complex and activates the transcriptional activation of Wnt signal path downstream target gene.
AXIN2 albumen is one of β-catenin upstream important member in Wnt signal path.Its Main Function is
Complex can be formed with the protein binding such as APC (adenomatous polyposis coli), GSK3 β, CK1,
Promote the degraded of β-catenin in Cytoplasm.The most increasing research has been found that in a lot of tumors
AXIN2 albumen all presents sudden change in various degree.
Study the core element regulatory mechanism of core signal path at present, and some important member is in cell
Expression, have become as treatment tumor a kind of key means.Wnt signal path is in cancer in recent years
In research, and AXIN2 albumen as Wnt signal path important member its sudden change level research,
Through becoming the major issue that research and development tumour medicine is badly in need of solving, especially combine at AXIN2-β-catenin
The sudden change occurred in domain, plays very important effect, such as at knot to AXIN2 protein exhibits function
Rectal Adenocarcinoma Cells detecting, D434ES suddenlys change, lung adenocarcinoma cell detects R463C sudden change etc..
Peptide nucleic acid(PNA) (peptide nucleic acids, PNA) is that a class replaces sugar phosphate backbone with polypeptide backbone
DNA analog.It is on the basis of the first generation, second filial generation antisense agent, is built by Computer Design
And the third generation antisense agent of final synthetic, it is a kind of brand-new DNA analog, i.e. with neutral peptide
Chain amide 2-aminoethylglycine key instead of the pentose phosphate diester linkage skeleton in DNA, remaining
Identical with DNA, PNA can pass through the form identification of Watson-Crick base pairing and combine DNA
Or RNA sequence, form stable double-spiral structure.Owing to PNA is the most electronegative, with DNA and RNA
Between there is not electrostatic repulsion, thus the stability combined and specificity all greatly improve；Be different from DNA or
The hybridization of the hybridization between DNA, RNA, PNA Yu DNA or RNA is little affected by hybridization system salinity
Impact, is much better than DNA/DNA or DNA/RNA with the hybridization ability of DNA or RNA molecule, performance
The highest hybridization stability, excellent distinguished sequence identification ability, not by nuclease and protease hydrolysis.
This method uses the PNA oligomer of distinguished sequence as probe.Owing to PNA is a kind of synthetic
The analog of nucleic acid, and be achirality, uncharged molecule, it is to avoid oligonucleotide and its target gene
In conjunction with time because of mutually exclusive the caused hybridization unstability of electric charge, in conjunction with being susceptible to hybridization solution ionic strength
Impact, thus demonstrate extremely strong heterosis, hybrid vigor, substantially increase detection sensitivity.
Summary of the invention
It is an object of the invention to for how prior art determines the signaling molecule of core in Wnt signal path
AXIN2 gene mutation situation, and how to explain core element AXIN2 sudden change level in tumor cell
The difficulty of change, it is provided that AXIN2 detection in Gene Mutation reagent, PCR in a kind of detection Wnt signal path
Detection method and application.
It is an object of the invention to provide a kind of detection Wnt signal path axis suppression albumen 2AXIN2 gene to dash forward
The detectable become, including for blocking the wild type PNA sequence of wild type AXIN2 gene amplification, use
In specific amplification D434E, R463C saltant type AXIN2 gene order one group of primer to and saltant type
PNA fluorescent probe:
Described detection AXIN2 gene D434E mutant forward primer such as SEQ ID NO.1 in sequence table；
SEQ ID NO.2 in described detection AXIN2 gene D434E sudden change reverse primer such as sequence table；
Described detection AXIN2 gene R463C mutant forward primer such as SEQ ID NO.3 in sequence table；
SEQ ID NO.4 in described detection AXIN2 gene R463C sudden change reverse primer such as sequence table；
SEQ ID NO.5 in described detection AXIN2 gene D434E sudden change PNA fluorescent probe such as sequence table；
SEQ ID NO.6 in described detection AXIN2 gene R463C sudden change PNA fluorescent probe such as sequence table；
The described specific binding AXIN2 gene 434 codon wild type PNA sequence that comprises is as in sequence table
SEQ ID NO.7。
The described specific binding AXIN2 gene 463 codon wild type PNA sequence that comprises is as in sequence table
SEQ ID NO.8。
The described fluorescent reporter group modifying described 5' end is: FAM, HEX, TET, JOE, VIC, ROX,
Cy3 or Cy5, the quenching group modifying described 3' end is: TAMRA, Eclipse, BHQ1, BHQ2,
BHQ3 or DABCYL.
Detectable of the present invention also includes PCR reactant liquor, 434 codons and 463 codon mutations
Type reference material, 434 codons and 463 codon reference wild-type product, wherein PCR reactant liquor includes: DEPC
Water, have exo-acting for 5' → 3' archaeal dna polymerase, dNTPs, 10 × PCR Buffer, RNASIN,
M-MLV reverse transcriptase, oligo (dT) and the solution containing Mg ion.
Described 434 codon mutation type reference materials are the recombinant plasmid dna containing SEQ NO.9；
Described 434 codon reference wild-type product are the recombinant plasmid dna containing SEQ NO.10；
Described 463 codon mutation type reference materials are the recombinant plasmid dna containing SEQ NO.11；
Described 463 codon reference wild-type product are the recombinant plasmid dna containing SEQ NO.12；
Archaeal dna polymerase exo-acting for the described 5' of having → 3' is Taq enzyme；
Final concentration of in pcr amplification reaction system of the described each component of PCR reactant liquor: Taq enzyme
0.01U/ μ l～0.05U/ μ l, dNTPs 0.2～0.6mM, 10 × PCR Buffer 1 ×, RNASIN 40U/ μ l～
60U/ μ l, M-MLV reverse transcriptase 200U/ μ l～320U/ μ l, MgCl21.5～5.0mM, solvent is DEPC
Water.
Specifically, final concentration of 0.05～0.9 μM of described forward primer, described reverse primer final concentration of
0.05～0.9 μM, final concentration of 0.05～0.9 μM of described oligo (dT), described complementary PNA sequence is eventually
Concentration is 0.05～0.9 μM, final concentration of 0.05～0.9 μM of described fluorescent probe.
Reagent of the present invention carries out the response procedures of real-time fluorescence quantitative PCR: 42 DEG C of reverse transcriptions 20
min；94 DEG C of denaturations, 2min；95 DEG C of degeneration, 30s, 58 DEG C, 45s (collection fluorescence), carry out 40
Individual circulation.
The principle of the present invention is by building the one section peptide nucleic acid(PNA) PNA sequence complementary with AXIN2 gene wild type
Row, when peptide nucleic acid(PNA) PNA sequence is combined with AXIN2 gene complementation, arbitrary sudden change all may result in PNA/DNA
Produce mispairing, so that solution temperature changes.And then it is special according to the design of AXIN2 genic mutation type
Peptide nucleic acid(PNA) PNA probe and the primer of property carry out fluorescent quantitative PCR to AXIN2 mutated genes,
After the PCR amplification that takes turns, AXIN2 genic mutation type can be made a distinction with wild type and come.
Further, present invention also offers described reagent in the detectable of preparation detection cancerous cell
Application, described cancerous cell is Colon and rectum adenocarcinoma, adenocarcinoma of lung.
Compared with prior art, advantages of the present invention and good effect are: AXIN2 gene is that Wnt signal leads to
In road, β-catenin albumen upstream plays the gene of critical function, the invention provides directly detection Wnt letter
In number path, the reagent of AXIN2 detection in Gene Mutation, can pass through real-time fluorescence by means of described detectable
Quantitative PCR method quickly detects the sudden change of AXIN2 gene at transcriptional level, and with common real time fluorescent quantitative
Unlike PCR, the present invention designs wild type PNA sequence, can effectively suppress wild type gene group to expand,
Only the amplification of enrichment mutated genes, substantially increases detection specificity, the saltant type PNA fluorescence that we use
Probe is sensitiveer, and the present invention is the screening of cancer therapy drug, and the Mechanism Study of new targeted drug both provides non-
The instrument of Chang Youli.
The experimental system of the present invention can be carried out on any real-time fluorescence quantitative PCR instrument simultaneously, on
Stating primer to be placed in eight unions, carry out real-time fluorescence quantitative PCR detection, experimental implementation is simple, low cost,
Result repeatability, sensitivity is good, is the research tumor related drugs mechanism of action and the one of basic scientific research
Important means.
Accompanying drawing explanation
Fig. 1 is peptide nucleic acid(PNA) mass spectrum described in the embodiment of the present invention；
Fig. 2 is sample, D434E saltant type and reference wild-type product PCR amplification figure；
Fig. 3 is sample, R463C saltant type and reference wild-type product PCR amplification figure；
Detailed description of the invention
By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.Thered is provided
Embodiment be only the explanation to the inventive method, and limit never in any form the present invention disclose remaining in
Hold.
The present invention is illustrated by Colon and rectum adenocarcinoma cell, but the present invention is not limited to Colon and rectum gland
Cancerous cell, detectable of the present invention can also be applied to adenocarcinoma of lung.
Relevant DNA and RNA basic operation in embodiment is all with reference to " molecular cloning: LABORATORY MANUAL "
(gold winter wild goose etc. are translated, Science Press, Beijing (1998)) and " fine works Molecular Biology " (Yan Zi
Translate, Science Press, Beijing (1998)).
In the present invention, SW480 (people's Colon and rectum adenocarcinoma SW480 cell line) is purchased from U.S. ATCC, cultivates thin
RPMI-1640 culture medium and 10% hyclone that born of the same parents are used are purchased from handsome company, and other reagent are main
Purchased from precious biological engineering (Dalian) company limited.
[embodiment 1] primed probe designs
According to American National Biotechnology Information center (National Center for Biotechnology
Information, NCBI) (http://www.ncbi.nlm.nih.gov) AXIN2mRNA sequence of reporting
(NCBI Reference Sequence:XM_011525319.1), uses the exploitation of Applied Biosystems company
The special AXIN2 primer of Primer Express Software for Real-Time PCR software design and spy
Pin.
AXIN2 D434E:
AXIN2-F:5'-CCGAGCTCACACTCAATTCG-3'；(SEQ NO.1)
AXIN2-R:5'-GTGACCAAGCAGACGACGAAG-3'；(SEQ NO.2)
Saltant type AXIN2 (PNA)-P:5'FAM-CTACGAGGAAGAACCGCAGA-BHQ 3'；
(SEQ NO.5)
Wild type AXIN2-PNA:5'-CTACGAGGAAGACCCGC-3'；(SEQ NO.7)
Saltant type target sequence:
ACAGCCTGGAGGAGCGCCTGCAGCAGATCCGAGAGGATGAAGAGAG
AGAGGGCTCCGAGCTCACACTCAATTCGCGGGAGGGGGCGCCCACGCAG
CACCCCCTCTCCCTACTGCCCTCCGGCAGCTACGAGGAAGAACCGCAGAC
GATACTGGACGATCACCTGTCCAGGGTCCTCAAGACCCCTGGCTGCCAGT
CTCCAGGCGTAGGCCGCTATAGCCCCCGCTCCCGCTCCCCGGACCACCACC
ACCACCACCATTCGCAGTACCACTCCCTGCTCCCGCCCGGTGGCAAGCTG
CCTCCCGCGGCCGCCTCGCCGGGCGCCTGCCCCCTCCTCGGGGGCAAAGG
CTTTGTGACCAAGCAGACGACGAAGCATGTCCACCACCACTACATCCACC
ACCATGCCGTCCCCAAGACCAAGGAGGAG；(SEQ NO.9)
Wild-type target sequence:
GAGAGAGGGCTCCGAGCTCACACTCAATTCGCGGGAGGGGGCGCCC
ACGCAGCACCCCCTCTCCCTACTGCCCTCCGGCAGCTACGAGGAAGACCC
GCAGACGATACTGGACGATCACCTGTCCAGGGTCCTCAAGACCCCTGGCT
GCCAGTCTCCAGGCGTAGGCCGCTATAGCCCCCGCTCCCGCTCCCCGGACC
ACCACCACCACCACCATTCGCAGTACCACTCCCTGCTCCCGCCCGGTGGC
AAGCTGCCTCCCGCGGCCGCCTCGCCGGGCGCCTGCCCCCTCCTCGGGGG
CAAAGGCTTTGTGACCAAGCAGACGACGAAGCATGTCCAC；(SEQ NO.10)
AXIN2 R463C:
AXIN2-F:5'-CCGAGCTCACACTCAATTCG-3'；(SEQ NO.3)
AXIN2-R:5'-GTGACCAAGCAGACGACGAAG-3'；(SEQ NO.4)
Saltant type AXIN2 (PNA)-P:5'FAM-CTATAGCCCCTGCTCC-BHQ 3'；(SEQ
NO.6)
Wild type AXIN2-PNA:5 '-CTATAGCCCCCGCTCC-3 '；(SEQ NO.8)
Saltant type target sequence:
ACAGCCTGGAGGAGCGCCTGCAGCAGATCCGAGAGGATGAAGAGAG
AGAGGGCTCCGAGCTCACACTCAATTCGCGGGAGGGGGCGCCCACGCAG
CACCCCCTCTCCCTACTGCCCTCCGGCAGCTACGAGGAAGACCCGCAGAC
GATACTGGACGATCACCTGTCCAGGGTCCTCAAGACCCCTGGCTGCCAGT
CTCCAGGCGTAGGCCGCTATAGCCCCTGCTCCCGCTCCCCGGACCACCACC
ACCACCACCATTCGCAGTACCACTCCCTGCTCCCGCCCGGTGGCAAGCTG
CCTCCCGCGGCCGCCTCGCCGGGCGCCTGCCCCCTCCTCGGGGGCAAAGG
CTTTGTGACCAAGCAGACGACGAAGCATGTCCACCACCACTACATCCACC
ACCATGCCGTCCCCAAGACCAAGGAGGAG；(SEQ NO.11)
Wild-type target sequence:
GAGAGAGGGCTCCGAGCTCACACTCAATTCGCGGGAGGGGGCGCCC
ACGCAGCACCCCCTCTCCCTACTGCCCTCCGGCAGCTACGAGGAAGACCC
GCAGACGATACTGGACGATCACCTGTCCAGGGTCCTCAAGACCCCTGGCT
GCCAGTCTCCAGGCGTAGGCCGCTATAGCCCCCGCTCCCGCTCCCCGGACC
ACCACCACCACCACCATTCGCAGTACCACTCCCTGCTCCCGCCCGGTGGC
AAGCTGCCTCCCGCGGCCGCCTCGCCGGGCGCCTGCCCCCTCCTCGGGGG
CAAAGGCTTTGTGACCAAGCAGACGACGAAGCATGTCCAC；(SEQ NO.12)
Above: F:forward, forward；AXIN2-F represents the forward primer for detecting nucleic acid.
R:reverse, reversely；AXIN2-R represents the reverse primer for detecting nucleic acid.
P:probe, fluorescent probe；AXIN2-P represents the fluorescent probe for detecting nucleic acid, this fluorescence
Probe is TaqMan fluorescent probe.
In embodiments of the present invention, the fluorescent reporter group of the 5' end modifying fluorescent probe can be: FAM,
HEX, TET, JOE, VIC, ROX, Cy3 or Cy5；Modify the quenching group of the 3' end of fluorescent probe
Can be: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL, this fluorescence report
Group and quenching group do not affect the amplification of quantitative fluorescent PCR, only need to according to the fluorescent reporter group of probe and
The model of the instrument used by quenching group selection arranges detectable fluorescence signal scope.The embodiment of the present invention carries
The fluorescent probe fluorescent reporter group of confession: the excitation wavelength of FAM, HEX, TET and FAM is 470-650nm,
Reception wavelength is 500-700nm；Quenching group: Eclipse, TAMRA, BHQ1.After primer synthesis
Way of purification can be: HAP, PAGE and HPLC way of purification.
[embodiment 2] builds containing AXIN2 genic mutation type and the recombiant plasmid of the DNA fragmentation of wild type
One, people's Colon and rectum adenocarcinoma SW480 cell line is cultivated and is passed on
1) cell is cultivated
All cells system uses RPMI-1640 culture medium (Invitrogen, Carlsbad, CA), 10% tire Sanguis Bovis seu Bubali
Clearly (Invitrogen, Carlsbad, CA), in 37 DEG C, 5%CO2Cultivate under environment.
2) passage
First by sterilizing suction pipe by the culture fluid sucking-off in Tissue Culture Dish, add PBS and clean 2
Time, in cell, slowly drip appropriate trypsin, treat cell rounding, after adjustment angle cell can move
Add the DMEM culture medium containing 10% hyclone of 3ml, the most gently after piping and druming, basis of microscopic observation
Cellular morphology also counts, according to the content of cell in culture dish by the training of appropriate passage to other sterilizings
Support in ware, after adding the DMEM culture medium of 5ml, put into 5%CO2Incubator.
Cell counting formula (individual/ml): (4 big lattice total cellular score) × 104× extension rate/4
Two, the extraction of total serum IgE
1) outwell culture medium, after PBS, directly 1ml Trizol is injected culture bottle (wherein cell 5 × 106
Individual/ml), suction is uniformly repeatedly；
2) in equipped with the centrifuge tube of lysate, add the chloroform (for the 1/5 of Trizol cumulative volume) of 0.2ml, shake
Swing and be mixed 30 seconds, left at room temperature 5 minutes；
3) centrifugal 15 minutes of 12000rpm 4 DEG C, split-phase is three layers.Upper strata: RNA (the 60% of about Trizol)；
Middle: DNA；Lower floor: protein (phenol-chloroform)；
4) careful Aspirate supernatant, transfers in another EP pipe.The supernatant volume that 1ml lysate produces
It is about 0.4～0.6ml.DNA and protein are contained in organic facies and intermediate layer, avoid touching；
5) supernatant adds the isopropanol of about 0.5ml, and vibration is mixed 30 seconds.Left at room temperature 10 minutes；
6) centrifugal 10 minutes of 12000rpm 4 DEG C；
7) side at the centrifugal end is formed by RNA precipitate.Careful suction abandons supernatant, notes avoiding suction to abandon RNA
Precipitation；
8) centrifuge tube adds 75% ethanol (1ml Trizol at least 1ml ethanol purge DNA) of 1ml pre-cooling,
Vibration is mixed 30 seconds, makes precipitation vibrate, and room temperature 12000rpm is centrifuged 1～2 minute.Inhale as far as possible and abandon
Supernatant, prevents RNA precipitate from losing.Repeat above cleaning step once.In 75% ethanol, RNA exists
4 DEG C at least preserve 1 week, and-20 DEG C at least preserve 1 year；
9) room temperature selecting liquidity is little, and inversion centrifuge tube, on filter paper, is dried RNA, but can not be completely dried
(5～10 minutes).With DEPC water 15 μ l dissolution precipitation, hatch 10～15 minutes for 55-60 DEG C.
10) RNA purity detecting
Drip 2 μ l RNA solution in ultramicrospectrophotometer (model: P330-311), and read in instrument
OD260/OD280 ratio.
Three, construction recombination plasmid
1) DNA fragmentation containing AXIN2 genic mutation type and wild type is carried out PCR amplification；
2) PCR primer is carried out double digestion；
Carrier and PCR primer respectively with condition once carry out double digestion (reaction system is 30 μ l, 37 DEG C,
Enzyme action 2 hours)；
3) (operating according to test kit description) is reclaimed in rubber tapping after double digestion product electrophoresis；
4) digestion products is attached with plasmid vector；
Above-mentioned double digestion product through purification, (wherein reclaim, after PCR fragment enzyme action by the rubber tapping of carrier digestion products
Purification step is identical with above-mentioned PCR primer purification step), 16 DEG C of connections under T4DNA ligase effect
Overnight.Linked system is as follows: carrier, 2 μ l；PCR fragment, 6 μ l；10xT4buffer, 1 μ l；T4DNA
Ligase, 1 μ l.
5) E. coli competent is converted；
Take above-mentioned connection liquid 5 μ l to be transformed in previously prepared DH5 α Competent cell, ice bath 30 points
Clock, 42 DEG C of heat shock 2min, put 5min on ice, add 37 DEG C of shaking table 45min of 1mlLB culture fluid, centrifugal
5000rpm, 1-5min (not centrifugal too long, in order to avoid the most real), finally it is uniformly coated on containing 100ng/ml
On the LB flat board of antibiotic (100-150 μ l).Flat board is inverted overnight incubation at 37 DEG C.Positive gram of picking
Grand bacterium colony turns to draw and contains on the LB flat board of 100ng/ml antibiotic to another block, and is numbered it, 37 DEG C
It is inverted overnight incubation.
6) QIAGEN test kit extracting plasmid (carrying out to specifications), makes reference material.
[embodiment 3] quantitative real-time PCR amplified sample
Taking the total serum IgE 1-5 μ g of extraction, add PCR reactant liquor, PCR reactant liquor includes: sterilized water, tool
There are exo-acting for 5' → 3' archaeal dna polymerase, dNTPs, 10 × PCR Buffer, RNASIN, M-MLV
Reverse transcriptase, oligo (dT) and the solution containing Mg ion.Wherein, concentration be 5U/ μ l there is 5' → 3'
Exo-acting archaeal dna polymerase 0.3 μ l, concentration is the dNTPs 2 μ l, 10 × PCR Buffer of 10mmol/L
5 μ l, concentration is the RNASIN 0.6 μ l of 40U/ μ l, and concentration is the M-MLV reverse transcriptase 0.6 μ l of 200U/ μ l,
Concentration is the MgCl of 25mmol/L2Solution 5 μ l, adding sterilized water to volume is 50 μ l.Wherein, have
Archaeal dna polymerase exo-acting for 5' → 3' can be Taq enzyme.
PCR expands: each reaction tube is put into the reactive tank of quantitative fluorescent PCR instrument, arranges mark fluorescent
Radical species, sample ID and type, select Taqman fluorescence probe (this product fluorescence report to be used
Group is FAM, HEX, TAT, and fluorescent quenching group is Eclipse), define sample well, and according to the form below carries
The amplification program of confession carries out PCR amplification:
Table 1 is pcr amplification reaction amplification program
Fluorescent value is read in end of a period in the 3rd step of amplification program；
Data analysis judges:
Select institute's sample this saltant type corresponding with this pattern detection site and reference wild-type sample wells simultaneously, right
Ratio three hole PCR amplification curve (CTARepresent sample aperture CT value, CTWRepresent wild type CT value, CTM
Represent saltant type CT value):
Work as CTM≤CTA＜ CTWTime, show that this sample exists sudden change；
Work as CTW=CTATime, show that this sample is wild type.
Fig. 1 is peptide nucleic acid(PNA) mass spectrum described in the embodiment of the present invention；
Fig. 2 is D434E saltant type described in the embodiment of the present invention and reference wild-type product PCR amplification figure, figure
Three bars, middle upper, middle and lower line respectively represents AXIN2 the 434th bit codon mutation type reference material, sample and open country
The amplification curve of raw type reference material；
Fig. 3 is R463C saltant type described in the embodiment of the present invention and reference wild-type product PCR amplification figure, figure
Three bars, middle upper, middle and lower line respectively represents AXIIN2 the 463rd bit codon mutation type reference material, sample and open country
The amplification curve of raw type reference material；
Above example is only used for technical scheme is described, rather than is limited, although reference
The present invention has been described in detail by previous embodiment, for the person of ordinary skill of the art, depends on
So the technical scheme described in previous embodiment can be modified, or wherein portion of techniques feature is entered
Row equivalent, and these amendments or replacement, do not make the essence of appropriate technical solution depart from institute of the present invention
The spirit and scope of claimed technical scheme.
Claims (6)
1. one kind for axle suppression albumen 2AXIN2 detection in Gene Mutation reagent, it is characterised in that include for
Block the wild type PNA sequence of wild type AXIN2 gene amplification, for specific amplification D434E, R463C
One group of primer of saltant type AXIN2 gene order to and saltant type PNA fluorescent probe:
Described detection AXIN2 gene D434E mutant forward primer such as SEQ ID NO.1 in sequence table；
SEQ ID NO.2 in described detection AXIN2 gene D434E sudden change reverse primer such as sequence table；
Described detection AXIN2 gene R463C mutant forward primer such as SEQ ID NO.3 in sequence table；
SEQ ID NO.4 in described detection AXIN2 gene R463C sudden change reverse primer such as sequence table；
SEQ ID NO.5 in described detection AXIN2 gene D434E sudden change PNA fluorescent probe such as sequence table；
SEQ ID NO.6 in described detection AXIN2 gene R463C sudden change PNA fluorescent probe such as sequence table；
The described specific binding AXIN2 gene 434 codon wild type PNA sequence that comprises is as in sequence table
SEQ ID NO.7；
The described specific binding AXIN2 gene 463 codon wild type PNA sequence that comprises is as in sequence table
SEQ ID NO.8；
The described fluorescent reporter group modifying described 5' end is: FAM, HEX, TET, JOE, VIC, ROX,
Cy3 or Cy5, the quenching group modifying described 3' end is: TAMRA, Eclipse, BHQ1, BHQ2,
BHQ3 or DABCYL.
Reagent for axle suppression albumen 2AXIN2 detection in Gene Mutation the most according to claim 1, it is special
Levying and be, described detectable also includes PCR reactant liquor, 434 codons and 463 codon mutation types
Reference material, 434 codons and 463 codon reference wild-type product, wherein PCR reactant liquor includes: DEPC
Water, have exo-acting for 5' → 3' archaeal dna polymerase, dNTPs, 10 × PCR Buffer, RNASIN,
M-MLV reverse transcriptase, oligo (dT) and the solution containing Mg ion；Described 434 codon mutation type ginsengs
The product of examining are the recombinant plasmid dna containing SEQ NO.9；Described 434 codon reference wild-type product are containing SEQ
The recombinant plasmid dna of NO.10；Described 463 codon mutation type reference materials are the restructuring containing SEQ NO.11
Plasmid DNA；Described 463 codon reference wild-type product are the recombinant plasmid dna containing SEQ NO.12.
Reagent for axle suppression albumen 2AXIN2 detection in Gene Mutation the most according to claim 2, it is special
Levy and be, described in have archaeal dna polymerase exo-acting for 5' → 3' be Taq enzyme.
Reagent for axle suppression albumen 2AXIN2 detection in Gene Mutation the most according to claim 3, it is special
Levy and be, final concentration of in pcr amplification reaction system of the described each component of PCR reactant liquor: Taq enzyme
0.01U/ μ l～0.05U/ μ l, dNTPs 0.2～0.6mM, 10 × PCR Buffer 1 ×, RNASIN 40U/ μ l～
60U/ μ l, M-MLV reverse transcriptase 200U/ μ l～320U/ μ l, MgCl21.5～5.0mM, solvent is DEPC
Water；Final concentration of 0.05～0.9 μM of described forward primer, described reverse primer final concentration of 0.05～
0.9 μM, final concentration of 0.05～0.9 μM of described oligo (dT), described complementary PNA sequence is final concentration of
0.05～0.9 μM, final concentration of 0.05～0.9 μM of described fluorescent probe.
5. according to the reagent for axle suppression albumen 2AXIN2 detection in Gene Mutation described in claim 1-4, its
It is characterised by, it is characterised in that described reagent carries out the response procedures of real-time fluorescence quantitative PCR and is: 42 DEG C
Reverse transcription 20min；94 DEG C of denaturations, 2min；95 DEG C of degeneration, 30s, 58 DEG C, 45s, now collects
Fluorescence, carries out 40 circulations.
6. the application in the detectable of preparation detection cancerous cell of the reagent described in claim 1-5, described cancer is thin
Born of the same parents are Colon and rectum adenocarcinoma, adenocarcinoma of lung.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610273761.3A CN105838796A (en) | 2016-04-28 | 2016-04-28 | AXIN2 gene mutation detection reagent and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610273761.3A CN105838796A (en) | 2016-04-28 | 2016-04-28 | AXIN2 gene mutation detection reagent and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105838796A true CN105838796A (en) | 2016-08-10 |
Family
ID=56589521
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610273761.3A Pending CN105838796A (en) | 2016-04-28 | 2016-04-28 | AXIN2 gene mutation detection reagent and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105838796A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107699621A (en) * | 2017-11-20 | 2018-02-16 | 湖北工业大学 | Suppress albumen for axle（AXIN2）The kit of gene V765A abrupt climatic changes |
| CN107699622A (en) * | 2017-11-20 | 2018-02-16 | 湖北工业大学 | A kind of disheveled protein 1（DVL1）Gene G136D mutation detection kits |
| CN107739752A (en) * | 2017-11-20 | 2018-02-27 | 湖北工业大学 | Suppress albumen for axle（AXIN2）The kit of gene P435Q abrupt climatic changes |
| CN107858406A (en) * | 2017-11-20 | 2018-03-30 | 湖北工业大学 | A kind of axle suppresses albumen（AXIN2）Gene S464F mutation detection kits |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104911268A (en) * | 2015-06-24 | 2015-09-16 | 湖北工业大学 | Detection reagent based on peptide nucleic acid probes for Pygo2 gene mutation in Wnt signal channel, PCR detection method and application |
-
2016
- 2016-04-28 CN CN201610273761.3A patent/CN105838796A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104911268A (en) * | 2015-06-24 | 2015-09-16 | 湖北工业大学 | Detection reagent based on peptide nucleic acid probes for Pygo2 gene mutation in Wnt signal channel, PCR detection method and application |
Non-Patent Citations (2)
| Title |
|---|
| RENKONEN ET: "Adenomatous polyposis families that screen APC mutation-negative by conventional methods are genetically heterogeneous", 《J CLIN ONCOL.》 * |
| SERINA M. MAZZONI: "AXIN1 and AXIN2 variants in gastrointestinal cancers", 《CANCER LETTERS》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107699621A (en) * | 2017-11-20 | 2018-02-16 | 湖北工业大学 | Suppress albumen for axle（AXIN2）The kit of gene V765A abrupt climatic changes |
| CN107699622A (en) * | 2017-11-20 | 2018-02-16 | 湖北工业大学 | A kind of disheveled protein 1（DVL1）Gene G136D mutation detection kits |
| CN107739752A (en) * | 2017-11-20 | 2018-02-27 | 湖北工业大学 | Suppress albumen for axle（AXIN2）The kit of gene P435Q abrupt climatic changes |
| CN107858406A (en) * | 2017-11-20 | 2018-03-30 | 湖北工业大学 | A kind of axle suppresses albumen（AXIN2）Gene S464F mutation detection kits |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104911268B (en) | Detection reagent, PCR detection method and the application of Pygo2 gene mutation in Wnt signal path based on peptide nucleic acid probe | |
| CN106995858A (en) | A kind of lncRNA related to liver cancer diagnosis and treatment | |
| CN105838796A (en) | AXIN2 gene mutation detection reagent and application | |
| CN107630092B (en) | Application of miR-505-3p in diagnosis, prognosis and treatment of bone metastasis of prostate cancer | |
| CN101070538B (en) | Human epiterm growth-factor receptor mutation gene and use thereof | |
| CN105821127A (en) | Adenomatous polyposis coli protein APC gene mutation detection reagent and application thereof | |
| CN106701900A (en) | Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer | |
| CN105950720A (en) | Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent | |
| CN110408703A (en) | Colorectal cancer miRNA marker and its application | |
| CN104911271A (en) | Detection reagent based on Pygo2 and FoxM1 gene expression in Wnt signal pathways of peptide nucleic acid probes, PCR detection method and application of detection reagent | |
| CN104911270A (en) | Peptide-nucleic-acid-probe-based detection reagent for Bcl-9 gene mutation in Wnt signal pathway, and PCR (polymerase chain reaction) detection method and application thereof | |
| CN105039522A (en) | Detection reagent based on FoxM1 gene mutations in Wnt signal paths of peptide nucleic acid probes, PCR detection method and application of detection reagent | |
| CN106244715A (en) | The reagent of a kind of β catenin interaction protein 1 gene abrupt climatic change and application | |
| CN105713986A (en) | Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application | |
| CN106167822A (en) | A kind of long-chain non-coding RNA and application thereof | |
| CN106520776B (en) | A kind of breast cancer kit for screening | |
| CN108192977A (en) | A kind of and relevant molecular marker of gastric cancer occurrence and development | |
| CN105713985B (en) | A kind of reagent and application for plug transcription factor O1 detection in Gene Mutation | |
| CN105695619A (en) | Casein kinase-1 gene mutation detection reagent based on peptide nucleic acid probes and application | |
| CN110241224B (en) | Use of lncRNA-T065925, kit for diagnosing colorectal cancer and medicament for treating colorectal cancer | |
| CN106319068A (en) | Reagent for Chibby homologue 1 gene mutation detection and application | |
| CN106282378A (en) | A kind of reagent for cyclin-depended kinase 8 detection in Gene Mutation and application | |
| CN106222296A (en) | The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application | |
| CN106367517A (en) | Low-density lipoprotein receptor-related protein 5 (LRP5) gene mutation detection reagents and application thereof | |
| CN106367518A (en) | Reagent for detecting gene mutation of Ras related C3 butulinum toxins 1 and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160810 |
|
| RJ01 | Rejection of invention patent application after publication |