CN106367518A - Reagent for detecting gene mutation of Ras related C3 butulinum toxins 1 and application - Google Patents

Reagent for detecting gene mutation of Ras related C3 butulinum toxins 1 and application Download PDF

Info

Publication number
CN106367518A
CN106367518A CN201610860175.9A CN201610860175A CN106367518A CN 106367518 A CN106367518 A CN 106367518A CN 201610860175 A CN201610860175 A CN 201610860175A CN 106367518 A CN106367518 A CN 106367518A
Authority
CN
China
Prior art keywords
rac1
seq
gene
detection
mutation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610860175.9A
Other languages
Chinese (zh)
Inventor
周策凡
唐景峰
陈兴珍
张毅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hubei University of Technology
Original Assignee
Hubei University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hubei University of Technology filed Critical Hubei University of Technology
Priority to CN201610860175.9A priority Critical patent/CN106367518A/en
Publication of CN106367518A publication Critical patent/CN106367518A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a reagent for detecting gene mutation of Ras related C3 butulinum toxins 1 (Rac1), a PCR detection method and application and belongs to the technical field of basic biological research and biological detection. The detection reagent comprises primers, peptide nucleic acid fluorescent probes and wild type complementary nucleotide sequences. The forward primer is shown in SEQ ID NO.1 in a sequence table, and the reverse primer is shown in SEQ ID NO.2 in the sequence table. The peptide nucleic acid fluorescent probes are shown in SEQ ID NO.3 and SEQ ID NO.4 in the sequence table. The wild type complementary nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6 in the sequence table. The condition of gene mutation of the Wnt signal channel downstream Rac1 can be rapidly found from the transcriptional level, the remarkable advantages of being high in specificity and sensitivity and the like are achieved, and tools are provided for anti-cancer drug screening, new targeted drug discussion and basic scientific research.

Description

A kind of reagent of ras correlation c3 clostridium botulinum toxin 1 detection in Gene Mutation and application
Technical field
The present invention relates to molecular biology and clinical molecular diagnosis technical field, more particularly to a kind of ras correlation c3 meat The reagent of malicious clostridial toxin 1 (rac1) detection in Gene Mutation and application.
Background technology
Wnt signal path is widely present in invertebratess and vertebratess, is that a class is high during spore The conservative signal path of degree.Wnt signal is in the early development of animal embryo, orga- nogenesis, tissue regeneration and other physiological process In, there is vital effect.If the key protein in this signal paths is undergone mutation or unconventionality expression, lead to letter Number abnormal activation is it is possible to the generation of induced cancer.Wnt signal path includes the wnt signal path of classics and non-classical wnt Signal path, is in wnt- β-catenin signal path in classical path, and the wnt factor is passed through on active cell film Suppress phosphorylation and the degraded of endocellular liberation β-catenin albumen, in Cytoplasm after frizzle/lrp5/6 cooperative expert systems β-catenin protein level will occur the core displacement of β-catenin albumen after raising, and lead to β-catenin albumen in nucleus Raise, in karyon β-catenin albumen can combine pygo2, bcl-9 and foxm1 albumen common transcribe with tcf/lef-1 because Sub-family forms complex and activates the transcriptional activation of wnt signal path downstream target gene.
Rac1 is one of Major Members of little g albumen rho family rac subfamily.The rac1 of activation participates in cytoskeleton weight Group, cell migration, apoptosis and genetic transcription are adjusted.Rac1 in wnt signal path mainly by with albumen at random (dishevelled-3, dvl-3) contact activation, leads to gsk3b-axin2-apc complex to disintegrate, and promotes β-catenin to enter Core, the wnt downstream target gene transcription stimulating tcf mediation, thus the malignant phenotype of modulate tumor cell, is sent out in wnt signal path Wave important effect.Increasing research has been found that rac1 albumen all presents in various degree in a lot of tumors at present Mutation.
The core element regulatory mechanism of research on the core signal path, and expression in cell for some important members at present Level, has become as a kind of key means for the treatment of tumor.Research in cancer for the wnt signal path, and rac1 in recent years Albumen, as regulation and control wnt signal path active factorses, the research of its mutation level, has become as research and development tumour medicine and is badly in need of The major issue solving.The mutation occurring especially in rac1 albumen ras family conserved domain, to rac1 protein exhibits work( Very important effect can be started.In clear cell carcinoma of kidney, for example detect that y40s is mutated, examine in squamous cell carcinoma of the head and neck Measure g142s mutation etc..
Peptide nucleic acid(PNA) (peptide nucleic acids, pna) is that a class replaces the dna of sugared phosphate backbone with polypeptide backbone Analog.It is on the basis of the first generation, second filial generation antisense agent, is built by Computer Design and final synthetic Third generation antisense agent, is a kind of brand-new dna analog, is replaced with neutral peptide chain amide 2- aminoethylglycine key Pentose phosphate diester linkage skeleton in dna, remaining is identical with dna, and pna can pass through watson-crick base pairing Form identifies and combines dna or rna sequence, forms stable double-spiral structure.Because pna is not negatively charged, with dna and rna Between there is not electrostatic repulsion, thus the stability combining and specificity all greatly improve；Different between dna or dna, rna Hybridization, the hybridization of pna and dna or rna is hardly affected by hybridization system salinity, remote with the hybridization ability of dna or rna molecule Better than dna/dna or dna/rna, show very high hybridization stability, excellent distinguished sequence identification ability, not by nuclease And protease hydrolysiss.
This method adopts the pna oligomer of distinguished sequence as probe.Because pna is a kind of class of the nucleic acid of synthetic Like thing, and it is achirality, uncharged molecule, it is to avoid oligonucleotide is when its target gene is combined because electric charge is mutually exclusive The hybridization unstability being led to, in conjunction with being difficult to be affected by hybridization solution ionic strength, thus showing extremely strong heterosis, hybrid vigor, Substantially increase detection sensitivity.
Content of the invention
The purpose of the present invention is for the core Molecular regulator rac1 base how determining in prior art in wnt signal path Because of catastrophe, and the difficulty how explaining mutation level change in tumor cell for the core element rac1, there is provided one Plant rac1 detection in Gene Mutation reagent and application in detection wnt signal path.
It is an object of the invention to provide a kind of reagent for rac1 detection in Gene Mutation, including for blocking wild type The wild type pna sequence of rac1 gene amplification, for one group of specific amplification y40s, g142s saltant type rac1 gene order Primer pair and saltant type pna fluorescent probe:
Seq id no.1 in described detection rac1 gene y40s or g142s mutant forward primer such as sequence table；
Described detection rac1 gene y40s or g142s mutation reverse primer such as seq id no.2 in sequence table；
Described detection rac1 gene y40s mutation pna fluorescent probe such as seq id no.3 in sequence table；
Described detection rac1 gene g142s mutation pna fluorescent probe such as seq id no.4 in sequence table；
Described specific binding comprises seq id no.5 in rac1 gene 40 codon wild type pna sequence such as sequence table；
Described specific binding comprises seq id in rac1 gene 142 codon wild type pna sequence such as sequence table no.6；
The fluorescent reporter group at the 5' end of described pna fluorescent probe is: fam, hex, tet, joe, vic, rox, cy3 or The quenching group at cy5,3' end is: tamra, eclipse, bhq1, bhq2, bhq3 or dabcyl.
Detectable of the present invention also include pcr reactant liquor, 40 codons and 142 codon mutation type reference materials, Containing 40 codons and 142 codon reference wild-type product, wherein pcr reactant liquor includes: depc water, to have 5' → 3' exo-acting Dna polymerase, dntps, 10 × pcr buffer, rnasin, m-mlv reverse transcriptase, oligo (dt) and molten containing mg ion Liquid.
Described contain the recombinant plasmid dna that 40,142 codon mutation type reference materials are containing seq no.7；
Described contain the recombinant plasmid dna that 40,142 codon reference wild-type product are containing seq no.8；
Described have the exo-acting dna polymerase of 5' → 3' for taq enzyme；
The each component of described pcr reactant liquor is final concentration of in pcr amplification reaction system: taq enzyme 0.01u/ μ l～ 0.05u/ μ l, dntps 0.2～0.6mm, 10 × pcr buffer 1 ×, rnasin 40u/ μ l～60u/ μ l, m-mlv reverse Record enzyme 200u/ μ l～320u/ μ l, mgcl21.5～5.0mm, solvent is depc water.
Specifically, final concentration of 0.05～0.9 μm of described forward primer, described reverse primer final concentration of 0.05～ 0.9 μm, final concentration of 0.05～0.9 μm of described oligo (dt), described final concentration of 0.05～0.9 μm of pna sequence of complementation, institute State fluorescent probe final concentration of 0.05～0.9 μm.
The response procedures that reagent of the present invention carries out real time fluorescent quantitative pcr are: 42 DEG C of reverse transcription 20min；94℃ Denaturation, 2min；95 DEG C of degeneration, 30s, 58 DEG C, 45s (collection fluorescence), carry out 40 circulations.
The principle of the present invention is by building the one section peptide nucleic acid(PNA) pna sequence complementary with rac1 gene wild type, when peptide core When rac1 gene complementation is combined, arbitrary mutation all may result in pna/dna to produce mispairing to sour pna sequence, so that dissolving temperature Degree changes.And then specific peptide nucleic acid(PNA) pna probe and the mutation of primer pair rac1 are designed according to rac1 genic mutation type Type gene carries out fluorescent quantitation pcr amplification, after the pcr amplification of a wheel, you can enter rac1 genic mutation type and wild type Row makes a distinction.
Further, present invention also offers described reagent detects the application in the detectable of cancerous cell in preparation, Described cancerous cell is clear cell carcinoma of kidney, squamous cell carcinoma of the head and neck.
Compared with prior art, advantages of the present invention and good effect are: rac1 gene be β in wnt signal path- Catenin albumen upstream plays the gene of critical function, the invention provides rac1 gene in direct detection wnt signal path The reagent of abrupt climatic change, can be by real time fluorescent quantitative pcr method in transcriptional level quick detection by means of described detectable Go out the mutation of rac1 gene, and from unlike common real time fluorescent quantitative pcr, the present invention designs wild type pna sequence, can have Effect suppression wild type gene group amplification, only the amplification of enrichment mutated genes, substantially increases detection specificity, and it is prominent that we use Modification pna fluorescent probe is sensitiveer, and the present invention is the screening of cancer therapy drug, and the Mechanism Study of new targeted drug both provides non- The instrument of Chang Youli.
The experimental system of the present invention can be carried out on any real time fluorescent quantitative pcr instrument simultaneously, above-mentioned primer It is placed in eight unions, carries out real time fluorescent quantitative pcr detection, experimental implementation is simple, low cost, result repeatability, sensitivity Good, it is the research tumor related drugs mechanism of action and a kind of important means of basic scientific research.
Brief description
Fig. 1 is peptide nucleic acid(PNA) mass spectrum described in the embodiment of the present invention；
Fig. 2 is sample, y40s saltant type and reference wild-type product pcr amplification figure；
Fig. 3 is sample, g142s saltant type and reference wild-type product pcr amplification figure；
Specific embodiment
By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.The enforcement being provided Example is only the explanation to the inventive method, and limits remaining content of present invention announcement never in any form.
The present invention is illustrated by clear cell carcinoma of kidney cell, but the present invention is not limited to clear cell carcinoma of kidney Cell, detectable of the present invention can also be applied to squamous cell carcinoma of the head and neck.
Relevant dna and rna basic operation in embodiment is all with reference to " molecular cloning: LABORATORY MANUAL " (Jin Dongyan Etc. translating, Science Press, Beijing (1998)) and " fine works Molecular Biology " (Yan Ziyi, Science Press, Beijing (1998)).
In the present invention, caki-2 (people's clear cell carcinoma of kidney cell line) is purchased from U.S. atcc, and cultured cells is used Rpmi-1640 culture medium and 10% hyclone are purchased from handsome (invitrogen) company, and other reagent are mainly purchased from precious raw Thing engineering (Dalian) company limited.
[embodiment 1] primed probe designs
According to American National Biotechnology Information center (national center for biotechnology Information, ncbi) (http://www.ncbi.nlm.nih.gov) rac1mrna sequence (ncbi of reporting Reference sequence:nm_006908.4), using the primer of applied biosystems company exploitation The special rac1 primer of express software for real-time pcr software design and probe.
Rac1y40s:
rac1-f:5'-cttgcctactgatcagttacacaacc-3'；(seq no.1)
rac1-r:5'-cggatcgcttcgtcaaacac-3'；(seq no.2)
Saltant type rac1 (pna)-p:5'fam-ctttgacaattcttctgccaatgt-bhq 3'；(seq no.3)
Wild type rac1-pna:5'-acattggcagaataattgtcaaag-3'；(seq no.5)
Target sequence:
gacggagctgtaggtaaaacttgcctactgatcagttacacaaccaatgcatttcctggagaatatatc cctactgtctttgacaattattctgccaatgttatggtagatggaaaaccggtgaatctgggcttatgggatacagc tggacaagaagattatgacagattacgccccctatcctatccgcaaacagatgtgttcttaatttgcttttcccttg tgagtcctgcatcatttgaaaatgtccgtgcaaagtggtatcctgaggtgcggcaccactgtcccaacactcccatc atcctagtgggaactaaacttgatcttagggatgataaagacacgatcgagaaactgaaggagaagaagctgactcc catcacctatccgcagggtctagccatggctaaggagattggtgctgtaaaatacctggagtgctcggcgctcacac agcgaggcctcaagacagtgtttgacgaagcgatccgagcagtcctctgc
rac1g142s:
rac1-f:5'–cttgcctactgatcagttacacaacc-3'；(seq no.1)
rac1-r:5'-cggatcgcttcgtcaaacac-3'；(seq no.2)
rac1(pna)-p:5'fam-tatccgcagagtctagccat-bhq 3'；(seq no.4)
Rac1-pna:5'-atggctagaccctgcggata-3'；(seq no.6)
Target sequence is ibid；
More than: f:forward, positive；Rac1-f represents the forward primer for detecting nucleic acid.
R:reverse, reversely；Rac1-r represents the reverse primer for detecting nucleic acid.
P:probe, fluorescent probe；Rac1-p represents the fluorescent probe for detecting nucleic acid, and this fluorescent probe is taqman Fluorescent probe.
In embodiments of the present invention, the fluorescent reporter group modifying the 5' end of fluorescent probe can be: fam, hex, tet, Joe, vic, rox, cy3 or cy5；The quenching group modifying the 3' end of fluorescent probe can be: tamra, eclipse, bhq1, Bhq2, bhq3 or dabcyl, this fluorescent reporter group and quenching group do not affect the amplification of fluorescent quantitation pcr, only need to be according to spy The fluorescent reporter group of pin and quenching group select the model of instrument used to arrange detectable fluorescence signal scope.The present invention The fluorescent probe fluorescent reporter group that embodiment provides: the excitation wavelength of fam, hex, tet and fam is 470-650nm, received wave A length of 500-700nm；Quenching group: eclipse, tamra, bhq1.Way of purification after primer synthesis can be: hap, page With hplc way of purification.
[embodiment 2] builds the recombiant plasmid of the dna fragment containing rac1 genic mutation type and wild type
First, people's clear cell carcinoma of kidney caki-2 cell line is cultivated and is passed on
1) cell culture
All cell lines use rpmi-1640 culture medium (invitrogen, carlsbad, ca), 10% hyclone (invitrogen, carlsbad, ca), in 37 DEG C, 5%co2Cultivate under environment.
2) passage
First by sterilized straw, the culture fluid in Tissue Culture Dish is suctioned out, addition pbs buffer solution for cleaning 2 times, toward carefully The slowly appropriate trypsin of Deca in born of the same parents, treats cell rounding, adjustment angle cell can add after moving 3ml containing 10% tire cattle The dmem culture medium of serum, after repeatedly gently blowing and beating, basis of microscopic observation cellular morphology simultaneously counts, according to cell in culture dish In the culture dish that appropriate passage is sterilized to other by content, after the dmem culture medium adding 5ml, put into 5%co2Culture Case.
Cell counting formula (individual/ml): (4 big lattice total cellular score) × 104× extension rate/4
2nd, the extraction of total rna
1) outwell culture medium, after pbs cleaning, directly 1ml trizol is injected culture bottle (wherein cell 5 × 106Individual/ Ml), repeatedly aspirate uniformly；
2) add the chloroform (for the 1/5 of trizol cumulative volume) of 0.2ml in the centrifuge tube equipped with lysate, vibration is mixed 30 seconds, under room temperature, stand 5 minutes；
3) 4 DEG C of 12000rpm is centrifuged 15 minutes, and split-phase is three layers.Upper strata: rna (about the 60% of trizol)；Middle: dna；Lower floor: protein (phenol-chloroform)；
4) careful Aspirate supernatant, transfers in another ep pipe.1ml lysate produce supernatant volume be about 0.4～ 0.6ml.Dna and protein are contained in organic faciess and intermediate layer, avoid touching；
5) supernatant adds the isopropanol of about 0.5ml, and vibration is mixed 30 seconds.10 minutes are stood under room temperature；
6) 4 DEG C of 12000rpm is centrifuged 10 minutes；
7) rna precipitation will be formed in the side at centrifugation bottom.Careful suction abandons supernatant, notes avoiding suction to abandon rna precipitation；
8) centrifuge tube adds 75% ethanol (1ml trizol at least 1ml ethanol purge dna) of 1ml pre-cooling, and vibration is mixed 30 seconds, precipitation is made to vibrate, room temperature 12000rpm is centrifuged 1～2 minute.Inhale as far as possible and abandon supernatant, prevent rna precipitation from losing Lose.Repeat above cleaning step once.In 75% ethanol, rna at least preserves 1 week at 4 DEG C, and -20 DEG C at least preserve 1 year；
9) room temperature selecting liquidity is little, is inverted centrifuge tube on filter paper, rna is dried, but can not be completely dried (5～10 points Clock).With depc water 15 μ l dissolution precipitation, 55-60 DEG C is incubated 10～15 minutes.
10) rna purity detecting
Deca 2 μ l rna solution is in ultramicrospectrophotometer (model: p330-311), and reads od260/ in instrument Od280 ratio.
3rd, construction recombination plasmid
1) the dna fragment containing rac1 genic mutation type and wild type is carried out pcr amplification；
Dna fragment containing y40s, g142s codon mutation type is the sequence shown in seq no.7；
ggagctgtaggtaaaacttgcctactgatcagttacacaaccaatgcatttcctggagaatatatccctactgtctt tgacaattcttctgccaatgttatggtagatggaaaaccggtgaatctgggcttatgggatacagctggacaagaag attatgacagattacgccccctatcctatccgcaaacagatgtgttcttaatttgcttttcccttgtgagtcctgca tcatttgaaaatgtccgtgcaaagtggtatcctgaggtgcggcaccactgtcccaacactcccatcatcctagtggg aactaaacttgatcttagggatgataaagacacgatcgagaaactgaaggagaagaagctgactcccatcacctatc cgcagagtctagccatggctaaggagattggtgctgtaaaatacctggagtgctcggcgctcacacagcgaggcctc aagacagtgtttgacgaagcgatccgagcagtcctctgcccgcct；(seq no.7)
Dna fragment containing 40,142 codon wild types is the sequence shown in seq no.8；
ggagctgtaggtaaaacttgcctactgatcagttacacaaccaatgcatttcctggagaatatatccctactgtctt tgacaattattctgccaatgttatggtagatggaaaaccggtgaatctgggcttatgggatacagctggacaagaag attatgacagattacgccccctatcctatccgcaaacagatgtgttcttaatttgcttttcccttgtgagtcctgca tcatttgaaaatgtccgtgcaaagtggtatcctgaggtgcggcaccactgtcccaacactcccatcatcctagtggg aactaaacttgatcttagggatgataaagacacgatcgagaaactgaaggagaagaagctgactcccatcacctatc cgcagggtctagccatggctaaggagattggtgctgtaaaatacctggagtgctcggcgctcacacagcgaggcctc aagacagtgtttgacgaagcgatccgagcagtcctctgcccgcct；(seq no.8)
2) pcr product is carried out double digestion；
Carrier and pcr product carry out double digestion respectively with condition once, and (reaction system is 30ul, 37 DEG C, and enzyme action 2 is little When)；
3) (being operated according to kit specification) is reclaimed in rubber tapping after double digestion product electrophoresis；
4) digestion products are attached with plasmid vector；
Above-mentioned double digestion product through purification, (reclaim, purification step after pcr fragment enzyme action by wherein carrier digestion products rubber tapping Identical with above-mentioned pcr product purification steps), under t4dna connection enzyme effect, 16 DEG C connect overnight.Linked system is as follows: carrier, 2μl；Pcr fragment, 6 μ l；10xt4buffer, 1 μ l；T4dna ligase, 1 μ l.
5) convert E. coli competent；
Above-mentioned connection liquid 5 μ l is taken to be transformed in previously prepared dh5 α Competent cell, ice bath 30 minutes, 42 DEG C of heat Sharp 2min, puts 5min on ice, adds 37 DEG C of shaking table 45min of 1mllb culture fluid, is centrifuged 5000rpm, and 1-5min (must not be centrifuged too Long, in order to avoid too real), finally it is uniformly coated on (100-150 μ l) on the lb flat board containing 100ng/ml antibiotic.By flat board 37 DEG C be inverted overnight incubation.Picking positive colony bacterium colony turn draw on another piece of lb flat board containing 100ng/ml antibiotic and right Be numbered, 37 DEG C inversion overnight incubation.
6) qiagen test kit extracting plasmid (carrying out to specifications), makes reference material.
[embodiment 3] real time fluorescent quantitative pcr method amplified sample
Take total rna 1-5 μ g of extraction, add pcr reactant liquor, pcr reactant liquor includes: sterilized water, to have 5' → 3' circumscribed The dna polymerase of activity, dntps, 10 × pcr buffer, rnasin, m-mlv reverse transcriptase, oligo (dt) and ion containing mg Solution.Wherein, concentration be 5u/ μ l there is the exo-acting dna polymerase of 5' → 3' 0.3 μ l, concentration is 10mmol/l Dntps 2 μ l, 10 × pcr buffer 5 μ l, concentration is the rnasin 0.6 μ l of 40u/ μ l, and concentration is the m-mlv of 200u/ μ l Reverse transcriptase 0.6 μ l, concentration is the mgcl of 25mmol/l2Solution 5 μ l, adding sterilized water to volume is 50 μ l.Wherein, there is 5' The exo-acting dna polymerase of → 3' can be taq enzyme.
Pcr expands: each reaction tube put in the reactive tank of fluorescent quantitation pcr instrument, setting mark fluorescent radical species, Sample ID and type, (this product fluorescent reporter group is fam, hex, tat, fluorescence to select taqman fluorescent probe to be used Quenching group is eclipse), define sample well, and the amplification program that according to the form below provides carries out pcr amplification:
Table 1 is pcr amplified reaction amplification program
Read fluorescent value in the end of a period of the 3rd step of amplification program；
Data analysiss judge:
Select institute's sample basis and this corresponding saltant type in pattern detection site and reference wild-type sample wells simultaneously, contrast three holes Pcr amplification curve (ctaRepresent sample aperture ct value, ctwRepresent wild type ct value, ctmRepresent saltant type ct value):
Work as ctm≤cta＜ ctwWhen, show that this sample has mutation；
Work as ctw=ctaWhen, show that this sample is wild type.
Fig. 1 is peptide nucleic acid(PNA) mass spectrum described in the embodiment of the present invention；
Fig. 2 is y40s saltant type described in the embodiment of the present invention and reference wild-type product pcr amplification figure, in figure upper, middle and lower Article three, line respectively represents the amplification curve of rac1 the 40th bit codon mutation type reference material, sample and reference wild-type product；
Fig. 3 is g142s saltant type described in the embodiment of the present invention and reference wild-type product pcr amplification figure, in figure, in, Lower three bars of lines respectively represent the amplification curve of rac1 the 142nd bit codon mutation type reference material, sample and reference wild-type product；
Above example is only used for technical scheme is described, rather than is limited, although with reference to aforementioned reality Apply example the present invention has been described in detail, for the person of ordinary skill of the art, still can be to aforementioned enforcement Technical scheme described in example is modified, or carries out equivalent to wherein some technical characteristics, and these modifications or Replace, do not make the essence of appropriate technical solution depart from the spirit and scope of claimed technical solution of the invention.
sequence listing
<110>Hubei University Of Technology
<120>a kind of reagent of ras correlation c3 clostridium botulinum toxin 1 detection in Gene Mutation and application
<160> 8
<170> patentin version 3.3
<210> 1
<211> 26
<212> dna
<213> unknown
<220>
<223>y40s or g142s mutant forward primer
<400> 1
cttgcctact gatcagttac acaacc 26
<210> 2
<211> 20
<212> dna
<213> unknown
<220>
<223>y40s or g142s mutation reverse primer
<400> 2
cggatcgctt cgtcaaacac 20
<210> 3
<211> 24
<212> dna
<213> unknown
<220>
<223>y40s mutation pna fluorescent probe
<400> 3
ctttgacaat tcttctgcca atgt 24
<210> 4
<211> 20
<212> dna
<213> unknown
<220>
<223>g142s mutation pna fluorescent probe
<400> 4
tatccgcaga gtctagccat 20
<210> 5
<211> 24
<212> dna
<213> unknown
<220>
<223>40 codon wild type pna sequences
<400> 5
acattggcag aataattgtc aaag 24
<210> 6
<211> 20
<212> dna
<213> unknown
<220>
<223>142 codon wild type pna sequences
<400> 6
atggctagac cctgcggata 20
<210> 7
<211> 507
<212> dna
<213> unknown
<220>
<223>40,142 codon mutation type reference materials
<400> 7
ggagctgtag gtaaaacttg cctactgatc agttacacaa ccaatgcatt tcctggagaa 60
tatatcccta ctgtctttga caattcttct gccaatgtta tggtagatgg aaaaccggtg 120
aatctgggct tatgggatac agctggacaa gaagattatg acagattacg ccccctatcc 180
tatccgcaaa cagatgtgtt cttaatttgc ttttcccttg tgagtcctgc atcatttgaa 240
aatgtccgtg caaagtggta tcctgaggtg cggcaccact gtcccaacac tcccatcatc 300
ctagtgggaa ctaaacttga tcttagggat gataaagaca cgatcgagaa actgaaggag 360
aagaagctga ctcccatcac ctatccgcag agtctagcca tggctaagga gattggtgct 420
gtaaaatacc tggagtgctc ggcgctcaca cagcgaggcc tcaagacagt gtttgacgaa 480
gcgatccgag cagtcctctg cccgcct 507
<210> 8
<211> 507
<212> dna
<213> unknown
<220>
<223>40,142 codon reference wild-type product
<400> 8
ggagctgtag gtaaaacttg cctactgatc agttacacaa ccaatgcatt tcctggagaa 60
tatatcccta ctgtctttga caattattct gccaatgtta tggtagatgg aaaaccggtg 120
aatctgggct tatgggatac agctggacaa gaagattatg acagattacg ccccctatcc 180
tatccgcaaa cagatgtgtt cttaatttgc ttttcccttg tgagtcctgc atcatttgaa 240
aatgtccgtg caaagtggta tcctgaggtg cggcaccact gtcccaacac tcccatcatc 300
ctagtgggaa ctaaacttga tcttagggat gataaagaca cgatcgagaa actgaaggag 360
aagaagctga ctcccatcac ctatccgcag ggtctagcca tggctaagga gattggtgct 420
gtaaaatacc tggagtgctc ggcgctcaca cagcgaggcc tcaagacagt gtttgacgaa 480
gcgatccgag cagtcctctg cccgcct 507

Claims (6)

1. a kind of reagent for ras correlation c3 clostridium botulinum toxin 1 rac1 detection in Gene Mutation is it is characterised in that include using In the wild type pna sequence of blocking-up wild type rac1 gene amplification, for specific amplification y40s, g142s saltant type rac1 base One group of primer pair and saltant type pna fluorescent probe because of sequence:
Seq id no.1 in described detection rac1 gene y40s or g142s mutant forward primer such as sequence table；
Described detection rac1 gene y40s or g142s mutation reverse primer such as seq id no.2 in sequence table；
Described detection rac1 gene y40s mutation pna fluorescent probe such as seq id no.3 in sequence table；
Described detection rac1 gene g142s mutation pna fluorescent probe such as seq id no.4 in sequence table；
Described specific binding comprises seq id no.5 in rac1 gene 40 codon wild type pna sequence such as sequence table；
Described specific binding comprises seq id no.6 in rac1 gene 142 codon wild type pna sequence such as sequence table；
The fluorescent reporter group at the 5' end of described pna fluorescent probe is: fam, hex, tet, joe, vic, rox, cy3 or cy5, The quenching group at 3' end is: tamra, eclipse, bhq1, bhq2, bhq3 or dabcyl.
2. the reagent for ras correlation c3 clostridium botulinum toxin 1 rac1 detection in Gene Mutation according to claim 1, its It is characterised by, described detectable also includes pcr reactant liquor, contains 40 codons and 142 codon mutation type reference materials, contains 40 Codon and 142 codon reference wild-type product；Wherein pcr reactant liquor includes: depc water, to have 5' → 3' exo-acting Dna polymerase, dntps, 10 × pcr buffer, rnasin, m-mlv reverse transcriptase, oligo(dt) and molten containing mg ion Liquid；Described contain the recombinant plasmid dna that 40,142 codon mutation type reference materials are containing seq no.7；Described contain 40,142 codons Reference wild-type product are the recombinant plasmid dna containing seq no.8.
3. the reagent for ras correlation c3 clostridium botulinum toxin 1 rac1 detection in Gene Mutation according to claim 2, its It is characterised by, described have the exo-acting dna polymerase of 5' → 3' for taq enzyme.
4. the reagent for ras correlation c3 clostridium botulinum toxin 1 rac1 detection in Gene Mutation according to claim 3, its It is characterised by, each component of described pcr reactant liquor is final concentration of in pcr amplification reaction system: taq enzyme 0.01u/ l～ 0.05u/ l, dntps 0.2～0.6 mm, 10 × pcr buffer 1 ×, rnasin 40u/ l～60u/ l, m-mlv reverse Record enzyme 200u/ l～320u/ l, mgcl21.5～5.0mm, solvent is depc water；Final concentration of the 0.05 of described forward primer ～0.9 μm, final concentration of 0.05～0.9 μm of described reverse primer, described oligo(dt) final concentration of 0.05～0.9 m, institute State final concentration of 0.05～0.9 μm of complementary pna sequence, final concentration of 0.05～0.9 μm of described fluorescent probe.
5. according to any one of claim 1-4 for ras correlation c3 clostridium botulinum toxin 1rac1 detection in Gene Mutation Reagent is it is characterised in that the response procedures that described reagent carries out real time fluorescent quantitative pcr are: 42 ° of c reverse transcription 20 min； 94 ° of c denaturations, 2 min；95 ° of c degeneration, 30 s, 58 ° of c, 45 s, now collect fluorescence, carry out 40 circulations.
6. application in the detectable of preparation detection cancerous cell for the reagent described in claim 1, described cancerous cell is that kidney is saturating Clear cell carcinoma, squamous cell carcinoma of the head and neck.
CN201610860175.9A 2016-09-28 2016-09-28 Reagent for detecting gene mutation of Ras related C3 butulinum toxins 1 and application Pending CN106367518A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610860175.9A CN106367518A (en) 2016-09-28 2016-09-28 Reagent for detecting gene mutation of Ras related C3 butulinum toxins 1 and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610860175.9A CN106367518A (en) 2016-09-28 2016-09-28 Reagent for detecting gene mutation of Ras related C3 butulinum toxins 1 and application

Publications (1)

Publication Number Publication Date
CN106367518A true CN106367518A (en) 2017-02-01

Family

ID=57898213

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610860175.9A Pending CN106367518A (en) 2016-09-28 2016-09-28 Reagent for detecting gene mutation of Ras related C3 butulinum toxins 1 and application

Country Status (1)

Country Link
CN (1) CN106367518A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104853765A (en) * 2012-11-30 2015-08-19 马克思-德布鲁克-分子医学中心（Mdc）柏林-布赫 Tumor specific t-cell receptors
CN104911268A (en) * 2015-06-24 2015-09-16 湖北工业大学 Detection reagent based on peptide nucleic acid probes for Pygo2 gene mutation in Wnt signal channel, PCR detection method and application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104853765A (en) * 2012-11-30 2015-08-19 马克思-德布鲁克-分子医学中心（Mdc）柏林-布赫 Tumor specific t-cell receptors
CN104911268A (en) * 2015-06-24 2015-09-16 湖北工业大学 Detection reagent based on peptide nucleic acid probes for Pygo2 gene mutation in Wnt signal channel, PCR detection method and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MAR VJ ET AL.,: "Clinical and pathological associations of the activating RAC1 P29S mutation in primary cutaneous melanoma", 《PIGMENT CELL MELANOMA RES》 *
MENGHUAN ZHANG ET AL.,: "http://canprovar2.zhang-lab.org/inforprotein.php?id=Rac1&display%5B0%5D=cancersnp&display%5B1%5D=snp&display%5B2%5D=DEP&submit=Search", 《HUMAN CACER PROTEOME VARIATION DATABASE》 *

Similar Documents

Publication Publication Date Title
CN104911268B (en) Detection reagent, PCR detection method and the application of Pygo2 gene mutation in Wnt signal path based on peptide nucleic acid probe
CN106995858A (en) A kind of lncRNA related to liver cancer diagnosis and treatment
CN106978497A (en) Detection primer, probe and the detection kit of EML4 ALK fusion gene mutations
CN107630092B (en) Application of miR-505-3p in diagnosis, prognosis and treatment of bone metastasis of prostate cancer
CN107881241A (en) Application of the gene marker in breast cancer diagnosis and treatment
CN101070538B (en) Human epiterm growth-factor receptor mutation gene and use thereof
CN105821127A (en) Adenomatous polyposis coli protein APC gene mutation detection reagent and application thereof
CN105838796A (en) AXIN2 gene mutation detection reagent and application
US20090258928A1 (en) Methods and compositions for diagnosing and modulating human papillomavirus (hpv)
CN104911271A (en) Detection reagent based on Pygo2 and FoxM1 gene expression in Wnt signal pathways of peptide nucleic acid probes, PCR detection method and application of detection reagent
CN105950720A (en) Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent
CN110408703A (en) Colorectal cancer miRNA marker and its application
CN107828873A (en) The detection reagent that the gene P546R of Bcl 9 are mutated in Wnt signal paths based on peptide nucleic acid probe
CN107893105A (en) The detection reagent that FoxM1 genes R256G is mutated in Wnt signal paths based on peptide nucleic acid probe
CN106244715A (en) The reagent of a kind of β catenin interaction protein 1 gene abrupt climatic change and application
CN105713986A (en) Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application
CN107267616A (en) A kind of application of Noncoding gene biomarker in liver cancer
CN104774966B (en) Adenocarcinoma of lung miRNA labels
CN105713985B (en) A kind of reagent and application for plug transcription factor O1 detection in Gene Mutation
CN106520776B (en) A kind of breast cancer kit for screening
CN106367518A (en) Reagent for detecting gene mutation of Ras related C3 butulinum toxins 1 and application
CN110452989A (en) Application of the biomarker in gastric cancer is detected, diagnosed
CN108192977A (en) A kind of and relevant molecular marker of gastric cancer occurrence and development
CN105695619A (en) Casein kinase-1 gene mutation detection reagent based on peptide nucleic acid probes and application
CN106282378A (en) A kind of reagent for cyclin-depended kinase 8 detection in Gene Mutation and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20170201

RJ01 Rejection of invention patent application after publication