CN105713986A - Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application - Google Patents
Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application Download PDFInfo
- Publication number
- CN105713986A CN105713986A CN201610259368.9A CN201610259368A CN105713986A CN 105713986 A CN105713986 A CN 105713986A CN 201610259368 A CN201610259368 A CN 201610259368A CN 105713986 A CN105713986 A CN 105713986A
- Authority
- CN
- China
- Prior art keywords
- gsk3
- gene
- detection
- seq
- pna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a reagent used for detecting glycogen synthase kinase (GSK3beta) gene mutation, a polymerase chain reaction (PCR) detection method and an application, belonging to the technical field of basic biological research and biological detection. The detection reagent comprises primers, peptide nucleic acid (PNA) fluorescent probes and wild type complementary PNA sequences, wherein the forward primers are shown in SEQ ID NO.1 and NO.3 in a sequence table; the reverse primers are shown in SEQ ID NO.2 and NO.4 in the sequence table; the PNA fluorescent probes are shown in SEQ ID NO.5 and NO.6 in the sequence table; and the wild type complementary PNA sequences are shown in SEQ ID NO.7 and NO.8 in the sequence table. The reagent can rapidly discover mutation of the GSK3beta gene in a Wnt signal pathway from the transcriptional level, has the obvious advantages of strong specificity, high sensitivity, and the like and provides a tool for anti-cancer drug screening, new targeted drug discussion and basic scientific research.
Description
Technical field
The present invention relates to molecular biology and clinical molecular diagnosis technical field, particularly relate to a kind of for glycogen synthase kinase-3 β (GSK3 β) reagent of detection in Gene Mutation, PCR detection method and application.
Background technology
Wnt signal path is widely present in invertebrates and vertebrates, is a class at the conservative signal path of spore process camber.Wnt signal, in the early development of animal embryo, orga-nogenesis, tissue regeneration and other physiological process, has vital effect.If the key protein in this signal paths is undergone mutation or unconventionality expression, cause that abnormal signal activates, it is possible to the generation of induced cancer.Wnt signal path includes the Wnt signal path of classics and non-classical Wnt signal path, in classical path and Wnt-β-catenin signal path, the Wnt factor is by suppressing phosphorylation and the degraded of endocellular liberation β-catenin albumen after the Frizzle/LRP5/6 cooperative expert systems on active cell film, the core displacement of β-catenin albumen will be there is in the β-catenin protein level in Cytoplasm after raising, cause that in nucleus, β-catenin albumen raises, in karyon, β-catenin albumen can combine Pygo2, Bcl-9 and FoxM1 albumen jointly forms complex with TCF/LEF-1 transcription factor family and activates the transcriptional activation of Wnt signal path downstream target gene.
GSK3 β albumen is one of β-catenin upstream important member in Wnt signal path, and increasing research at present has been found that GSK3 β albumen all presents sudden change in various degree in a lot of tumors.
Study the core element regulatory mechanism of core signal path at present, and the expression that some important member is in cell, have become as a kind of key means for the treatment of tumor, Wnt signal path research in cancer in recent years, and GSK3 β albumen is as the research of its sudden change level of Wnt signal path important member, have become as the major issue that research and development tumour medicine is badly in need of solving, particularly in the sudden change occurred in GSK3 β protein kinase domain, GSK3 β protein exhibits function is played very important effect, such as in Colon and rectum adenocarcinoma cell, detect that Y140CS suddenlys change, squamous cell carcinoma of the head and neck cell detects E249K sudden change etc..
Peptide nucleic acid(PNA) (peptidenucleicacids, PNA) is that a class replaces the DNA analog of sugar phosphate backbone with polypeptide backbone.It is the first generation, second filial generation antisense agent basis on, the third generation antisense agent of also final synthetic is built by Computer Design, it it is a kind of brand-new DNA analog, namely instead of the pentose phosphate diester linkage skeleton in DNA with neutral peptide chain amide 2-aminoethylglycine key, remaining is identical with DNA, PNA can pass through the form identification of Watson-Crick base pairing and in conjunction with DNA or RNA sequence, forms stable double-spiral structure.Owing to PNA is not electronegative, and between DNA and RNA, it is absent from electrostatic repulsion, thus the stability combined and specificity all greatly improve；It is different from the hybridization between DNA or DNA, RNA, the hybridization of PNA and DNA or RNA is little affected by the impact of hybridization system salinity, be much better than DNA/DNA or DNA/RNA with the hybridization ability of DNA or RNA molecule, show significantly high hybridization stability, excellent distinguished sequence identification ability, not by nuclease and protease hydrolysis.
This method adopts the PNA oligomer of distinguished sequence as probe.It it is the analog of the nucleic acid of a kind of synthetic due to PNA, and it is achirality, uncharged molecule, avoid oligonucleotide and its target gene in conjunction with time because of mutually exclusive the caused hybridization unstability of electric charge, in conjunction with the impact being susceptible to hybridization solution ionic strength, thus demonstrating extremely strong heterosis, hybrid vigor, substantially increase detection sensitivity.
Summary of the invention
It is an object of the invention to for the signaling molecule GSK3 β gene mutation situation how determining core in Wnt signal path in prior art, and how to explain the difficulty that core element GSK3 β sudden change level in tumor cell changes, it is provided that GSK3 β detection in Gene Mutation reagent, PCR detection method and application in a kind of detection Wnt signal path.
It is an object of the invention to provide a kind of reagent for glycogen synthase kinase-3 β GSK3 β detection in Gene Mutation, including the wild type PNA sequence for blocking wild type GSK3 β gene amplification, for one group of primer pair of specific amplification Y140C, E249K saltant type GSK3 beta gene sequence and saltant type PNA fluorescent probe:
Described detection GSK3 β gene Y140C mutant forward primer such as SEQ ID NO.1；
Described detection GSK3 β gene Y140C sudden change reverse primer such as SEQ ID NO.2；
Described detection GSK3 β gene E249K mutant forward primer such as SEQ ID NO.3；
Described detection GSK3 β gene E249K sudden change reverse primer such as SEQ ID NO.4；
Described detection GSK3 β gene Y140C sudden change PNA fluorescent probe such as SEQ ID NO.5；
Described detection GSK3 β gene E249K sudden change PNA fluorescent probe such as SEQ ID NO.6；
Described specific binding comprise GSK3 β gene 140 codon wild type PNA sequence such as SEQ ID NO.7.
Described specific binding comprise GSK3 β gene 249 codon wild type PNA sequence such as SEQ ID NO.8.
The described fluorescent reporter group modifying described 5' end is: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5, and the quenching group modifying described 3' end is: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.
Detectable of the present invention also includes PCR reactant liquor, 140 codons and 249 codon mutation type reference materials, 140 codons and 249 codon reference wild-type product, and wherein PCR reactant liquor includes: DEPC water, have exo-acting for 5' → 3' archaeal dna polymerase, dNTPs, 10 × PCRBuffer, RNASIN, M-MLV reverse transcriptase, oligo (dT) and the solution containing Mg ion.
Described 140 codon mutation type reference materials are the recombinant plasmid dna containing SEQNO.9；
Described 140 codon reference wild-type product are the recombinant plasmid dna containing SEQNO.10；
Described 249 codon mutation type reference materials are the recombinant plasmid dna containing SEQNO.11；
Described 249 codon reference wild-type product are the recombinant plasmid dna containing SEQNO.12；
Archaeal dna polymerase exo-acting for the described 5' of having → 3' is Taq enzyme；
Final concentration of in pcr amplification reaction system of the described each component of PCR reactant liquor: Taq enzyme 0.01U/ μ l～0.05U/ μ l, dNTPs0.2～0.6mM, 10 × PCRBuffer1 ×, RNASIN40U/ μ l～60U/ μ l, M-MLV reverse transcriptase 200U/ μ l～320U/ μ l, MgCl21.5～5.0mM, solvent is DEPC water.
Specifically, final concentration of 0.05～0.9 μM of described forward primer, final concentration of 0.05～0.9 μM of described reverse primer, final concentration of 0.05～0.9 μM of described oligo (dT), described complementary final concentration of 0.05～0.9 μM of PNA sequence, final concentration of 0.05～0.9 μM of described fluorescent probe.
Reagent of the present invention carries out the response procedures of real-time fluorescence quantitative PCR: 42 DEG C of reverse transcription 20min；94 DEG C of denaturations, 2min；95 DEG C of degeneration, 30s, 58 DEG C, 45s (collection fluorescence), carry out 40 circulations.
Principles of the invention is by building the one section peptide nucleic acid(PNA) PNA sequence complementary with GSK3 β gene wild type, when peptide nucleic acid(PNA) PNA sequence and GSK3 β gene complementation in conjunction with time, arbitrary sudden change all may result in PNA/DNA generation mispairing, so that solution temperature changes.And then specific peptide nucleic acid(PNA) PNA probe and primer is designed according to GSK3 β genic mutation type, GSK3 β mutated genes is carried out fluorescent quantitative PCR, after the pcr amplification that takes turns, GSK3 β genic mutation type and wild type can be made a distinction.
Further, present invention also offers the application in the detectable of preparation detection cancerous cell of the described reagent, described cancerous cell is Colon and rectum adenocarcinoma, squamous cell carcinoma of the head and neck.
Compared with prior art, advantages of the present invention and have the benefit effect that GSK3 β gene is the gene that in Wnt signal path, β-catenin albumen upstream plays critical function, the invention provides and directly detect the reagent of GSK3 β detection in Gene Mutation in Wnt signal path, quantitative real-time PCR can be passed through by means of described detectable and quickly detect the sudden change of GSK3 β gene at transcriptional level, and with common real-time fluorescence quantitative PCR the difference is that, the present invention designs wild type PNA sequence, wild type gene group can be effectively suppressed to expand, only enrichment mutated genes amplification, substantially increase detection specificity, the peptide nucleic acid(PNA) PNA fluorescent probe that we use is sensitiveer, the present invention is the screening of cancer therapy drug, the Mechanism Study of new targeted drug both provides very strong instrument.
The experimental system of the present invention can carry out on any real-time fluorescence quantitative PCR instrument simultaneously, above-mentioned primer is placed in eight unions, carry out real-time fluorescence quantitative PCR detection, experimental implementation is simple, low cost, result repeatability, sensitivity is good, is a kind of important means of the research tumor related drugs mechanism of action and basic scientific research.
Accompanying drawing explanation
Fig. 1 is peptide nucleic acid(PNA) mass spectrum described in the embodiment of the present invention；
Fig. 2 is sample, Y140C saltant type and reference wild-type product pcr amplification figure；
Fig. 3 is sample, E249K saltant type and reference wild-type product pcr amplification figure；
Detailed description of the invention
By described further below in conjunction with accompanying drawing it will be further appreciated that the features and advantages of the invention.The embodiment provided is only the explanation to the inventive method, and does not limit the present invention in any way all the other contents of announcement.
The present invention is illustrated by Colon and rectum adenocarcinoma cell, but the present invention is not limited to Colon and rectum adenocarcinoma cell, and detectable of the present invention can also be applied to squamous cell carcinoma of the head and neck.
All with reference to " molecular cloning: LABORATORY MANUAL ", (gold winter wild goose etc. are translated in relevant DNA and RNA basic operation in embodiment, Science Press, Beijing (1998)) and " fine works Molecular Biology " (Yan Ziyi, Science Press, Beijing (1998)).
SW480 (people's Colon and rectum adenocarcinoma SW480 cell line) purchased from American ATCC in the present invention, cultivating the RPMI-1640 culture medium that uses of cell and 10% hyclone all purchased from handsome company, other reagent are mainly purchased from precious biological engineering (Dalian) company limited.
[embodiment 1] primed probe designs
According to American National Biotechnology Information center (NationalCenterforBiotechnologyInformation, NCBI) GSK3 β mRNA sequence (NCBIReferenceSequence:NM_001146156.1) that (http://www.ncbi.nlm.nih.gov) reports, uses the special GSK3 β primer of PrimerExpressSoftwareforReal-TimePCR software design and the probe of the exploitation of AppliedBiosystems company.
GSK3 β Y140C:
GSK3 β-F:5'-GATGAGGTCTATCTTAATCTGGTGC-3'；(SEQNO.1)
GSK3 β-R:5'-GAGCGTCTGTTTGGCTCGA-3'；(SEQNO.2)
Saltant type GSK3 β (PNA)-P:5'FAM-CGGAAACAGTATGCAGAGT-BHQ3'；(SEQNO.5)
Wild type GSK3 β-PNA:5'-CGGAAACAGTATACAGAGT-3'(SEQNO.7)
Saltant type target sequence:
ATTTCTTCTACTCCAGTGGTGAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTG GACTATGTTCCGGAAACAGTATGCAGAGTTGCCAGACACTATAGTCGAGCCAAACA GACGCTCCCTGTGATTTATGTCAAGTTGTATATGTATCAGCTGTTCCGAA；(SEQNO.9)
Wild-type target sequence:
AAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATA CAGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTG；(SEQNO.10)
GSK3βE249K:
GSK3 β-F:5'-CCTCTAGTATAGATGTATGGTCTGC-3'；(SEQNO.3)
GSK3 β-R:5'-CAACTGATCCACACCACTATCC-3'；(SEQNO.4)
Saltant type GSK3 β (PNA)-P:5'FAM-TGTTGGCTAAGCTGTTACTA-BHQ3'；(SEQNO.6)
Wild type GSK3 β-PNA:TGTTGGCTGAGCTGTTACTA；(SEQNO.8)
Saltant type target sequence:
ATCTTTGGAGCCACTGATTATACCTCTAGTATAGATGTATGGTCTGCTGGCTGTGT GTTGGCTAAGCTGTTACTAGGACAACCAATATTTCCAGGGGATAGTGGTGTGGATC AGTTGGTAGAAATAATCAAGGTCCTGGGAA；(SEQNO.11)
Wild-type target sequence:
TGATTATACCTCTAGTATAGATGTATGGTCTGCTGGCTGTGTGTTGGCTGAGCTGT TACTAGGACAACCAATATTTCCAGGGGATAGTGGTGTGGATCAGTTGGTAG；(SEQNO.12)
Above: F:forward, forward；GSK3 β-F represents the forward primer for detecting nucleic acid.
R:reverse, reversely；GSK3 β-R represents the reverse primer for detecting nucleic acid.
P:probe, fluorescent probe；HW-P represents the fluorescent probe for detecting nucleic acid, and this fluorescent probe is TaqMan fluorescent probe.
In embodiments of the present invention, the fluorescent reporter group of the 5' end modifying fluorescent probe can be: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5；The quenching group of the 3' end modifying fluorescent probe can be: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL, this fluorescent reporter group and quenching group do not affect the amplification of quantitative fluorescent PCR, only the model of instrument used need to be selected to arrange detectable fluorescence signal scope according to the fluorescent reporter group of probe and quenching group.The embodiment of the present invention provide fluorescent probe fluorescent reporter group: FAM, HEX, TET and FAM excitation wavelength be 470-650nm, reception wavelength is 500-700nm；Quenching group: Eclipse, TAMRA, BHQ1.Way of purification after primer synthesis can be: HAP, PAGE and HPLC way of purification.
[embodiment 2] builds the recombiant plasmid containing GSK3 β genic mutation type and the DNA fragmentation of wild type
One, people's Colon and rectum adenocarcinoma SW480 cell line is cultivated and goes down to posterity
1) cell is cultivated
All cells system uses RPMI-1640 culture medium (Invitrogen, Carlsbad, CA), and 10% hyclone (Invitrogen, Carlsbad, CA), in 37 DEG C, 5%CO2Cultivate under environment.
2) passage
First by sterilizing suction pipe by the culture fluid sucking-off in Tissue Culture Dish, add PBS to clean 2 times, appropriate trypsin is slowly dripped in cell, treat cell rounding, adjusting angle cell can the add 3ml DMEM culture medium containing 10% hyclone after moving, after repeatedly blowing and beating gently, basis of microscopic observation cellular morphology also counts, according to, in the content of the cell culture dish by appropriate passage to other sterilizings in culture dish, putting into 5%CO after adding the DMEM culture medium of 5ml2Incubator.
Cell counting formula (individual/ml): (4 big lattice total cellular score) × 104× extension rate/4
Two, the extraction of total serum IgE
1) outwell culture medium, after PBS, directly 1mlTrizol is injected culture bottle (wherein cell 5 × 106Individual/ml), suction is uniformly repeatedly；
2) adding the chloroform (for Trizol cumulative volume 1/5) of 0.2ml in equipped with the centrifuge tube of lysate, vibration is mixed 30 seconds, left at room temperature 5 minutes；
3) 12000rpm4 DEG C centrifugal 15 minutes, dividing is three layers mutually.Upper strata: RNA (is about the 60% of Trizol)；Middle: DNA；Lower floor: protein (phenol-chloroform)；
4) careful Aspirate supernatant, transfers in another EP pipe.The supernatant volume that 1ml lysate produces is about 0.4～0.6ml.DNA and protein are contained in organic facies and intermediate layer, avoid touching；
5) supernatant adds the isopropanol of about 0.5ml, and vibration is mixed 30 seconds.Left at room temperature 10 minutes；
6) 12000rpm4 DEG C centrifugal 10 minutes；
7) side at the centrifugal end is formed by RNA precipitate.Careful suction abandons supernatant, notes avoiding suction to abandon RNA precipitate；
8) centrifuge tube adds 75% ethanol (1mlTrizol is 1ml ethanol purge DNA at least) of 1ml pre-cooling, and vibration is mixed 30 seconds, makes precipitation vibrate, centrifugal 1～2 minute of room temperature 12000rpm.Inhale as far as possible and abandon supernatant, prevent RNA precipitate from losing.Repeat above cleaning step once.In 75% ethanol, RNA at least preserves 1 week at 4 DEG C, and-20 DEG C at least preserve 1 year；
9) room temperature selecting liquidity is little, is inverted centrifuge tube on filter paper, dry RNA, but can not be completely dried (5～10 minutes).With DEPC water 15 μ l dissolution precipitation, hatch 10～15 minutes for 55-60 DEG C.
10) RNA purity detecting
Drip 2 μ lRNA solution in ultramicrospectrophotometer (model: P330-311), and read OD260/OD280 ratio in instrument.
Three, construction recombination plasmid
1) DNA fragmentation containing GSK3 β genic mutation type and wild type is carried out pcr amplification；
2) PCR primer is carried out double digestion；
Carrier and PCR primer carry out double digestion (reaction system is 30 μ l, 37 DEG C, enzyme action 2 hours) by condition once respectively；
3) (being operated according to test kit description) is reclaimed in rubber tapping after double digestion product electrophoresis；
4) digestion products and plasmid vector are attached；
Above-mentioned double digestion product is through purification (wherein the rubber tapping of carrier digestion products is reclaimed, and after PCR fragment enzyme action, purification step is identical with above-mentioned PCR primer purification step), and under T4DNA ligase effect, 16 DEG C connect overnight.Linked system is as follows: carrier, 2 μ l；PCR fragment, 6 μ l；10xT4buffer, 1 μ l；T4DNAligase, 1 μ l.
5) E. coli competent is converted；
Take above-mentioned connection liquid 5 μ l and be transformed in previously prepared DH5 α Competent cell, ice bath 30 minutes, 42 DEG C of heat shock 2min, put 5min on ice, adding 37 DEG C of shaking table 45min of 1mlLB culture fluid, centrifugal 5000rpm, 1-5min are (centrifugal too not of a specified duration, in order to avoid too real), finally it is uniformly coated on containing on the antibiotic LB flat board of 100ng/ml (100-150 μ l).Flat board is inverted overnight incubation at 37 DEG C.Picking positive colony bacterium colony turns to draw and contains on the antibiotic LB flat board of 100ng/ml to another block, and it is numbered, is inverted overnight incubation for 37 DEG C.
6) QIAGEN test kit extracting plasmid (carrying out to specifications), makes reference material.
[embodiment 3] quantitative real-time PCR amplified sample
Take the total serum IgE 1-5 μ g of extraction, adding PCR reactant liquor, PCR reactant liquor includes: sterilized water, have exo-acting for 5' → 3' archaeal dna polymerase, dNTPs, 10 × PCRBuffer, RNASIN, M-MLV reverse transcriptase, oligo (dT) and the solution containing Mg ion.Wherein, concentration be 5U/ μ l there is archaeal dna polymerase 0.3 μ l exo-acting for 5' → 3', concentration is the dNTPs2 μ l of 10mmol/L, 10 × PCRBuffer5 μ l, concentration is the RNASIN0.6 μ l of 40U/ μ l, concentration is the M-MLV reverse transcriptase 0.6 μ l of 200U/ μ l, and concentration is the MgCl of 25mmol/L2Solution 5 μ l, adding sterilized water to volume is 50 μ l.Wherein, having archaeal dna polymerase exo-acting for 5' → 3' can be Taq enzyme.
Pcr amplification: each reaction tube is put into the reactive tank of quantitative fluorescent PCR instrument, mark fluorescent radical species, sample ID and type are set, (this product fluorescent reporter group is FAM, HEX, TAT to the Taqman fluorescence probe of selection, fluorescent quenching group is Eclipse), define sample well, and the amplification program that according to the form below provides carry out pcr amplification:
Table 1 is pcr amplification reaction amplification program
Fluorescent value is read in end of a period in the 3rd step of amplification program；
Data analysis judges:
This saltant type corresponding with this pattern detection site and reference wild-type sample wells of selected institute sample, contrasts three hole pcr amplification curve (CT simultaneouslyARepresent sample aperture CT value, CTWRepresent wild type CT value, CTMRepresent saltant type CT value):
Work as CTM≤CTA< CTWTime, it was shown that there is sudden change in this sample；
Work as CTW=CTATime, it was shown that this sample is wild type.
Fig. 1 is peptide nucleic acid(PNA) mass spectrum described in the embodiment of the present invention；
Fig. 2 be Y140C saltant type described in the embodiment of the present invention and in reference wild-type product pcr amplification figure, figure three bars, upper, middle and lower line respectively represent the amplification curve of GSK3 β the 140th bit codon mutation type reference material, sample and reference wild-type product；
Fig. 3 be E249K saltant type described in the embodiment of the present invention and in reference wild-type product pcr amplification figure, figure three bars, upper, middle and lower line respectively represent the amplification curve of GSK3 β the 249th bit codon mutation type reference material, sample and reference wild-type product；
Above example is only used for technical scheme is described; but not be limited; although the present invention being described in detail with reference to previous embodiment; for the person of ordinary skill of the art; still the technical scheme described in previous embodiment can be modified; or wherein portion of techniques feature is carried out equivalent replacement, and these are revised or replace, do not make the essence of appropriate technical solution depart from the spirit and scope of present invention technical scheme required for protection.
Claims (6)
1. the reagent for glycogen synthase kinase-3 β GSK3 β detection in Gene Mutation, it is characterized in that, including the wild type PNA sequence for blocking wild type GSK3 β gene amplification, for one group of primer pair of specific amplification Y140C, E249K saltant type GSK3 beta gene sequence and saltant type PNA fluorescent probe:
Described detection GSK3 β gene Y140C mutant forward primer such as SEQ ID NO.1；
Described detection GSK3 β gene Y140C sudden change reverse primer such as SEQ ID NO.2；
Described detection GSK3 β gene E249K mutant forward primer such as SEQ ID NO.3；
Described detection GSK3 β gene E249K sudden change reverse primer such as SEQ ID NO.4；
Described detection GSK3 β gene Y140C sudden change PNA fluorescent probe such as SEQ ID NO.5；
Described detection GSK3 β gene E249K sudden change PNA fluorescent probe such as SEQ ID NO.6；
Described specific binding comprise GSK3 β gene 140 codon wild type PNA sequence such as SEQ ID NO.7；
Described specific binding comprise GSK3 β gene 249 codon wild type PNA sequence such as SEQ ID NO.8；
The fluorescent reporter group of the 5' end of described PNA fluorescent probe is: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5, and the quenching group of 3' end is: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.
2. the reagent for glycogen synthase kinase-3 β GSK3 β detection in Gene Mutation according to claim 1, it is characterized in that, described detectable also includes PCR reactant liquor, 140 codons and 249 codon mutation type reference materials, 140 codons and 249 codon reference wild-type product, and wherein PCR reactant liquor includes: DEPC water, have exo-acting for 5' → 3' archaeal dna polymerase, dNTPs, 10 × PCRBuffer, RNASIN, M-MLV reverse transcriptase, oligo (dT) and the solution containing Mg ion；Described 140 codon mutation type reference materials are the recombinant plasmid dna containing SEQNO.9；Described 140 codon reference wild-type product are the recombinant plasmid dna containing SEQNO.10；Described 249 codon mutation type reference materials are the recombinant plasmid dna containing SEQNO.11；Described 249 codon reference wild-type product are the recombinant plasmid dna containing SEQNO.12.
3. the reagent for glycogen synthase kinase-3 β GSK3 β detection in Gene Mutation according to claim 2, it is characterised in that described in have archaeal dna polymerase exo-acting for 5' → 3' be Taq enzyme.
4. the reagent for glycogen synthase kinase-3 β GSK3 β detection in Gene Mutation according to claim 3, it is characterized in that, final concentration of in pcr amplification reaction system of the described each component of PCR reactant liquor: Taq enzyme 0.01U/ μ L～0.05U/ μ L, dNTPs0.2～0.6mM, 10 × PCRBuffer1 ×, RNASIN40U/ μ L～60U/ μ L, M-MLV reverse transcriptase 200U/ μ L～320U/ μ L, MgCl21.5～5.0mM, solvent is DEPC water；Final concentration of 0.05～0.9 μM of described forward primer, final concentration of 0.05～0.9 μM of described reverse primer, final concentration of 0.05～0.9 μM of described oligo (dT), described complementary final concentration of 0.05～0.9 μM of PNA sequence, final concentration of 0.05～0.9 μM of described fluorescent probe.
5. the reagent for glycogen synthase kinase-3 β GSK3 β detection in Gene Mutation according to claim 1-4, it is characterised in that described reagent carries out the response procedures of real-time fluorescence quantitative PCR and is: 42 DEG C of reverse transcription 20min；94 DEG C of denaturations, 2min；95 DEG C of degeneration, 30s, 58 DEG C, 45s, now collects fluorescence, carries out 40 circulations.
6. the application in the detectable of preparation detection cancerous cell of the reagent described in claim 1-5, described cancerous cell is Colon and rectum adenocarcinoma, squamous cell carcinoma of the head and neck.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610259368.9A CN105713986A (en) | 2016-04-25 | 2016-04-25 | Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610259368.9A CN105713986A (en) | 2016-04-25 | 2016-04-25 | Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105713986A true CN105713986A (en) | 2016-06-29 |
Family
ID=56162175
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610259368.9A Pending CN105713986A (en) | 2016-04-25 | 2016-04-25 | Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105713986A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107868817A (en) * | 2017-11-20 | 2018-04-03 | 湖北工业大学 | A kind of Glycogen synthesis kinases（GSK3β）The kit of gene R111Q abrupt climatic changes |
| CN107904291A (en) * | 2017-11-20 | 2018-04-13 | 湖北工业大学 | For Glycogen synthesis kinases（GSK3β）The kit of gene V272D abrupt climatic changes |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667492A (en) * | 2013-12-13 | 2014-03-26 | 青岛大学医学院附属医院 | WNT signal channel detecting reagent, PCR (polymerase chain reaction) detection method and application thereof |
| CN104911268A (en) * | 2015-06-24 | 2015-09-16 | 湖北工业大学 | Detection reagent based on peptide nucleic acid probes for Pygo2 gene mutation in Wnt signal channel, PCR detection method and application |
| CN104911270A (en) * | 2015-06-24 | 2015-09-16 | 湖北工业大学 | Peptide-nucleic-acid-probe-based detection reagent for Bcl-9 gene mutation in Wnt signal pathway, and PCR (polymerase chain reaction) detection method and application thereof |
-
2016
- 2016-04-25 CN CN201610259368.9A patent/CN105713986A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667492A (en) * | 2013-12-13 | 2014-03-26 | 青岛大学医学院附属医院 | WNT signal channel detecting reagent, PCR (polymerase chain reaction) detection method and application thereof |
| CN104911268A (en) * | 2015-06-24 | 2015-09-16 | 湖北工业大学 | Detection reagent based on peptide nucleic acid probes for Pygo2 gene mutation in Wnt signal channel, PCR detection method and application |
| CN104911270A (en) * | 2015-06-24 | 2015-09-16 | 湖北工业大学 | Peptide-nucleic-acid-probe-based detection reagent for Bcl-9 gene mutation in Wnt signal pathway, and PCR (polymerase chain reaction) detection method and application thereof |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107868817A (en) * | 2017-11-20 | 2018-04-03 | 湖北工业大学 | A kind of Glycogen synthesis kinases（GSK3β）The kit of gene R111Q abrupt climatic changes |
| CN107904291A (en) * | 2017-11-20 | 2018-04-13 | 湖北工业大学 | For Glycogen synthesis kinases（GSK3β）The kit of gene V272D abrupt climatic changes |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104911268B (en) | Detection reagent, PCR detection method and the application of Pygo2 gene mutation in Wnt signal path based on peptide nucleic acid probe | |
| CN107881241A (en) | Application of the gene marker in breast cancer diagnosis and treatment | |
| CN107630092B (en) | Application of miR-505-3p in diagnosis, prognosis and treatment of bone metastasis of prostate cancer | |
| CN105821127A (en) | Adenomatous polyposis coli protein APC gene mutation detection reagent and application thereof | |
| CN105838796A (en) | AXIN2 gene mutation detection reagent and application | |
| CN105950720A (en) | Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent | |
| CN104911271A (en) | Detection reagent based on Pygo2 and FoxM1 gene expression in Wnt signal pathways of peptide nucleic acid probes, PCR detection method and application of detection reagent | |
| CN105039522A (en) | Detection reagent based on FoxM1 gene mutations in Wnt signal paths of peptide nucleic acid probes, PCR detection method and application of detection reagent | |
| CN104911270A (en) | Peptide-nucleic-acid-probe-based detection reagent for Bcl-9 gene mutation in Wnt signal pathway, and PCR (polymerase chain reaction) detection method and application thereof | |
| CN108374043A (en) | The relevant biomarker of Parkinson and its application | |
| CN105713986A (en) | Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application | |
| CN110408703A (en) | Colorectal cancer miRNA marker and its application | |
| CN106244715A (en) | The reagent of a kind of β catenin interaction protein 1 gene abrupt climatic change and application | |
| CN103484551B (en) | Kit for detecting EGFR gene hot spot mutation and detection method | |
| CN101070538B (en) | Human epiterm growth-factor receptor mutation gene and use thereof | |
| CN105695619A (en) | Casein kinase-1 gene mutation detection reagent based on peptide nucleic acid probes and application | |
| CN105713985A (en) | Reagent used for detecting forkhead transcription factor O1 (FOXO1) gene mutation and application | |
| CN106520776B (en) | A kind of breast cancer kit for screening | |
| CN105441405B (en) | BMX spliced body and its application in drug resistance of lung cancer | |
| CN110452989A (en) | Application of the biomarker in gastric cancer is detected, diagnosed | |
| CN108192977A (en) | A kind of and relevant molecular marker of gastric cancer occurrence and development | |
| CN110241224B (en) | Use of lncRNA-T065925, kit for diagnosing colorectal cancer and medicament for treating colorectal cancer | |
| CN106319068A (en) | Reagent for Chibby homologue 1 gene mutation detection and application | |
| CN106282378A (en) | A kind of reagent for cyclin-depended kinase 8 detection in Gene Mutation and application | |
| CN106222296A (en) | The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160629 |
|
| RJ01 | Rejection of invention patent application after publication |