CN106222296A - The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application - Google Patents

The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application Download PDF

Info

Publication number
CN106222296A
CN106222296A CN201610863561.3A CN201610863561A CN106222296A CN 106222296 A CN106222296 A CN 106222296A CN 201610863561 A CN201610863561 A CN 201610863561A CN 106222296 A CN106222296 A CN 106222296A
Authority
CN
China
Prior art keywords
lrp6
seq
gene
detection
pna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610863561.3A
Other languages
Chinese (zh)
Inventor
唐景峰
陈兴珍
周策凡
张毅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hubei University of Technology
Original Assignee
Hubei University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hubei University of Technology filed Critical Hubei University of Technology
Priority to CN201610863561.3A priority Critical patent/CN106222296A/en
Publication of CN106222296A publication Critical patent/CN106222296A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of for LDH receptor related protein 6(LRP6) reagent of detection in Gene Mutation, PCR detection method and application, belong to underlying biological research and technical field of biological.Detectable includes the peptide nucleic acid sequence that primer, peptide nucleic acid(PNA) fluorescent probe and wild type are complementary, SEQ ID NO.1, NO.3 in forward primer such as sequence table；SEQ ID NO.2, NO.4 in reverse primer such as sequence table；SEQ ID NO.5, NO.6 in peptide nucleic acid(PNA) fluorescent probe such as sequence table；Wild type complementary peptide nucleic acid sequence such as SEQ ID NO.7, NO.8 in sequence table.The present invention can quickly find Wnt signal path downstream LRP6 gene mutation situation from transcriptional level, has the remarkable advantage such as high specificity, sensitivity height, and for screening anticancer medicine, new targeted drug is inquired into, basic scientific research provides instrument.

Description

A kind of reagent of LDH receptor related protein 6 detection in Gene Mutation and Application
Technical field
The present invention relates to molecular biology and clinical molecular diagnosis technical field, particularly relate to a kind of low density lipoprotein, LDL The reagent of receptor associated protein(RAP) 6 (LRP6) detection in Gene Mutation and application.
Background technology
Wnt signal path is widely present in invertebrates and vertebrates, is that a class is high during spore The signal path that degree is conservative.Wnt signal is at early development, orga-nogenesis, tissue regeneration and other physiological process of animal embryo In, there is vital effect.If the key protein in this signal paths is undergone mutation or unconventionality expression, cause letter Number abnormal activation, it is possible to the generation of induced cancer.Wnt signal path includes the Wnt signal path of classics and non-classical Wnt Signal path, in classical path i.e. Wnt-β-catenin signal path, the Wnt factor is by active cell film Phosphorylation and the degraded of endocellular liberation β-catenin albumen is suppressed, in Cytoplasm after Frizzle/LRP5/6 cooperative expert systems β-catenin protein level will occur the core displacement of β-catenin albumen after raising, and cause β-catenin albumen in nucleus Raise, in karyon β-catenin albumen can combine that Pygo2, Bcl-9 and FoxM1 albumen is common and TCF/LEF-1 transcribe because of Zijia race forms complex and activates the transcriptional activation of Wnt signal path downstream target gene.
LRP6 albumen is one of β-catenin upstream important member in Wnt signal path.After it is combined with part, activate Wnt signal path, thus activate grow to cell, breed, the relevant target gene such as differentiation, promotion tumor cell proliferation.At present Increasing research has been found that LRP6 albumen all presents sudden change in various degree in a lot of tumors.
Study the core element regulatory mechanism of core signal path, and the expression that some important member is in cell at present Level, has become as a kind of key means for the treatment of tumor.Wnt signal path research in cancer, and LRP6 in recent years Albumen, as Wnt signal path important member, the research of its sudden change level, has become as research and development tumour medicine and is badly in need of solving Major issue.The sudden change especially occurred in LRP6 albumen low density lipoprotein receptor domain (LDLR), to LRP6 egg Poliosis waves the very important effect of function on.Such as detecting in non-small cell lung cancer cell that S148L suddenlys change, cancer of pancreas is thin Born of the same parents detect R1269W sudden change etc..
Peptide nucleic acid(PNA) (peptide nucleic acids, PNA) is that a class replaces the DNA of sugar phosphate backbone with polypeptide backbone Analog.It is on the basis of the first generation, second filial generation antisense agent, builds the most final synthetic by Computer Design Third generation antisense agent, is a kind of brand-new DNA analog, i.e. replaces with neutral peptide chain amide 2-aminoethylglycine key Pentose phosphate diester linkage skeleton in DNA, remaining is identical with DNA, and PNA can be by Watson-Crick base pairing Form identification also combines DNA or RNA sequence, forms stable double-spiral structure.Owing to PNA is the most electronegative, with DNA and RNA Between there is not electrostatic repulsion, thus the stability combined and specificity all greatly improve；It is different between DNA or DNA, RNA Hybridization, the hybridization of PNA Yu DNA or RNA is little affected by the impact of hybridization system salinity, remote with the hybridization ability of DNA or RNA molecule Be better than DNA/DNA or DNA/RNA, show the highest hybridization stability, excellent distinguished sequence identification ability, not by nuclease And protease hydrolysis.
This method uses the PNA oligomer of distinguished sequence as probe.It it is the class of the nucleic acid of a kind of synthetic due to PNA Like thing, and it is achirality, uncharged molecule, it is to avoid oligonucleotide is mutually exclusive because of electric charge when its target gene is combined The hybridization unstability caused, in conjunction with being susceptible to the impact of hybridization solution ionic strength, thus demonstrates extremely strong heterosis, hybrid vigor, Substantially increase detection sensitivity.
Summary of the invention
It is an object of the invention to for the core signal molecule L RP6 base how determined in prior art in Wnt signal path Because of catastrophe, and how to explain the difficulty of core element LRP6 sudden change level change in tumor cell, it is provided that one Plant LRP6 detection in Gene Mutation reagent and application in detection Wnt signal path.
It is an object of the invention to provide a kind of reagent for LRP6 detection in Gene Mutation, including for blocking wild type The wild type PNA sequence of LRP6 gene amplification, for the one of specific amplification S148L, R1269W saltant type LRP6 gene order Group primer to and saltant type PNA fluorescent probe:
Described detection LRP6 gene S148L mutant forward primer such as SEQ ID NO.1 in sequence table；
SEQ ID NO.2 in described detection LRP6 gene S148L sudden change reverse primer such as sequence table；
Described detection LRP6 gene R1269W mutant forward primer such as SEQ ID NO.3 in sequence table；
SEQ ID NO.4 in described detection LRP6 gene R1269W sudden change reverse primer such as sequence table；
SEQ ID NO.5 in described detection LRP6 gene S148L sudden change PNA fluorescent probe such as sequence table；
SEQ ID NO.6 in described detection LRP6 gene R1269W sudden change PNA fluorescent probe such as sequence table；
Described specific binding comprise LRP6 gene 148 codon wild type PNA sequence such as SEQ ID in sequence table NO.7；
Described specific binding comprise LRP6 gene 1269 codon wild type PNA sequence such as SEQ ID in sequence table NO.8；
The fluorescent reporter group of the 5' end of described PNA fluorescent probe is: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or The quenching group of Cy5,3' end is: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.
Detectable of the present invention also includes PCR reactant liquor, 148 codons and 1269 codon mutation type references Product, containing 148 codons and 1269 codon reference wild-type product, wherein PCR reactant liquor includes: DEPC water, have outside 5' → 3' Cut activity archaeal dna polymerase, dNTPs, 10 × PCR Buffer, RNASIN, M-MLV reverse transcriptase, oligo (dT) and containing Mg from The solution of son.
The described 148 codon mutation type reference materials that contain are the recombinant plasmid dna containing SEQ NO.9；
The described 1269 codon mutation type reference materials that contain are the recombinant plasmid dna containing SEQ NO.10；
The described 148 codon reference wild-type product that contain are the recombinant plasmid dna containing SEQ NO.11；
The described 1269 codon reference wild-type product that contain are the recombinant plasmid dna containing SEQ NO.12；
Archaeal dna polymerase exo-acting for the described 5' of having → 3' is Taq enzyme；
Final concentration of in pcr amplification reaction system of the described each component of PCR reactant liquor: Taq enzyme 0.01U/ μ L～ 0.05U/ μ L, dNTPs 0.2～0.6mM, 10 × PCR Buffer 1 ×, RNASIN40U/ μ L～60U/ μ L, M-MLV reverse transcription Enzyme 200U/ μ L～320U/ μ L, MgCl21.5～5.0mM, solvent is DEPC water.
Specifically, final concentration of 0.05～0.9 μM of described forward primer, described reverse primer final concentration of 0.05～ 0.9 μM, final concentration of 0.05～0.9 μM of described oligo (dT), described complementary final concentration of 0.05～0.9 μM of PNA sequence, institute State fluorescent probe final concentration of 0.05～0.9 μM.
Reagent of the present invention carries out the response procedures of real-time fluorescence quantitative PCR: 42 DEG C of reverse transcription 20min；94℃ Denaturation, 2min；95 DEG C of degeneration, 30s, 58 DEG C, 45s (collection fluorescence), carry out 40 circulations.
The principle of the present invention is by building the one section peptide nucleic acid(PNA) PNA sequence complementary with LRP6 gene wild type, when peptide core Acid PNA sequence is when LRP6 gene complementation is combined, and arbitrary sudden change all may result in PNA/DNA and produces mispairing, so that dissolve temperature Degree changes.And then design specific peptide nucleic acid(PNA) PNA probe and primer to LRP6 sudden change according to LRP6 genic mutation type Type gene carries out fluorescent quantitative PCR, after the PCR amplification that takes turns, can be entered with wild type by LRP6 genic mutation type Row makes a distinction.
Further, present invention also offers the application in the detectable of preparation detection cancerous cell of the described reagent, Described cancerous cell is nonsmall-cell lung cancer, cancer of pancreas.
Compared with prior art, advantages of the present invention and good effect are: LRP6 gene be β in Wnt signal path- Catenin albumen upstream plays the gene of critical function, the invention provides and directly detects LRP6 gene in Wnt signal path The reagent of abrupt climatic change, quickly can be detected at transcriptional level by quantitative real-time PCR by means of described detectable Go out the sudden change of LRP6 gene, and unlike common real-time fluorescence quantitative PCR, the present invention designs wild type PNA sequence, can have Effect suppression wild type gene group amplification, only the amplification of enrichment mutated genes, substantially increases detection specificity, and it is prominent that we use Modification PNA fluorescent probe is sensitiveer, and the present invention is the screening of cancer therapy drug, and the Mechanism Study of new targeted drug both provides non- The instrument of Chang Youli.
The experimental system of the present invention can be carried out on any real-time fluorescence quantitative PCR instrument simultaneously, above-mentioned primer Being placed in eight unions, carry out real-time fluorescence quantitative PCR detection, experimental implementation is simple, low cost, result repeatability, sensitivity Good, it is the research tumor related drugs mechanism of action and a kind of important means of basic scientific research.
Accompanying drawing explanation
Fig. 1 is peptide nucleic acid(PNA) mass spectrum described in the embodiment of the present invention；
Fig. 2 is sample, S148L saltant type and reference wild-type product PCR amplification figure；
Fig. 3 is sample, R1269W saltant type and reference wild-type product PCR amplification figure；
Detailed description of the invention
By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.The enforcement provided Example is only the explanation to the inventive method, and limits remaining content that the present invention discloses never in any form.
The present invention is illustrated by pancreatic cancer cell, but the present invention is not limited to pancreatic cancer cell, the present invention Described detectable can also be applied to nonsmall-cell lung cancer.
Relevant DNA and RNA basic operation in embodiment is all with reference to " molecular cloning: LABORATORY MANUAL " (Jin Dongyan Etc. translating, Science Press, Beijing (1998)) and " fine works Molecular Biology " (Yan Ziyi, Science Press, Beijing (1998))。
In the present invention, PNAC-1 (human pancreatic cancer cell) is purchased from U.S. ATCC, cultivates the RPMI-1640 that cell is used Culture medium and 10% hyclone are purchased from handsome company, and other reagent are mainly purchased from precious biological engineering (Dalian) company limited.
[embodiment 1] primed probe designs
According to American National Biotechnology Information center (National Center for Biotechnology Information, NCBI) (http://www.ncbi.nlm.nih.gov) LRP6 mRNA sequence (NCBI (NCBI of reporting Reference Sequence:NM_002336), use the Primer Express of Applied Biosystems company exploitation LRP6 primer that Software for Real-Time PCR software design is special and probe.
LRP6 S148L:
LRP6-F:5'-GTCATGGCTTGATATACTGGAGTGAT-3'；(SEQ NO.1)
LRP6-R:5'-CTGTTTATTATAATGAAGCGACTTGAACC-3'；(SEQ NO.2)
Saltant type LRP6 (PNA)-P:5'FAM-CTTAGATCCTTTAAGTGGGTTC-BHQ 3'；(SEQ NO.5)
Wild type LRP6-PNA:5'-GAACCCACTTGAAGGATCTAAG-3'；(SEQ NO.7)
Target sequence:
GACTTTGTGTTTAGTCATGGCTTGATATACTGGAGTGATGTCAGCGAAGAAGCCATTAAACGAACAGAA TTTAACAAAACTGAGAGTGTGCAGAATGTTGTTGTTTCTGGATTATTGTCCCCCGATGGGCTGGCATGTGATTGGCT TGGAGAAAAATTGTACTGGACAGATTCTGAAACTAATCGGATTGAAGTTTCTAATTTAGATGGATCTTTACGAAAAG TTTTATTTTGGCAAGAGTTGGATCAACCCAGAGCTATTGCCTTAGATCCTTCAAGTGGGTTCATGTACTGGACAGAC TGGGGAGAAGTGCCAAAGATAGAACGTGCTGGAATGGATGGTTCAAGTCGCTTCATTATAATAAACAGTGAAATTTA CTGGC
LRP6R1269W:
LRP6-F:5'-CCATGCACCTGGTTCTACTTCA-3'；(SEQ NO.3)
LRP6-R:5'-CTTGTCACTGCAATCCACATTATG-3'；(SEQ NO.4)
Saltant type LRP6 (PNA)-P:5'FAM-CTTGGTGGTGCGATGG-BHQ 3'；(SEQ NO.6)
Wild type LRP6-PNA:5'-CCATCGCACCGCCAAG-3'(SEQ NO.8)
Target sequence:
TACTACAAGGTGTTCTTGCCCCATGCACCTGGTTCTACTTCAAGATGAGCTATCATGTGGAGAACCTCCAACATGTT CTCCTCAGCAGTTTACTTGTTTCACGGGGGAAATTGACTGTATCCCTGTGGCTTGGCGGTGCGATGGGTTTACTGAA TGTGAAGACCACAGTGATGAACTCAATTGTCCTGTATGCTCAGAGTCCCAGTTCCAGTGTGCCAGTGGGCAGTGTAT TGATGGTGCCCTCCGATGCAATGGAGATGCAAACTGCCAGGACAAATCAGATGAGAAGAACTGTGAAGTGCTTTGTT TAATTGATCAGTTCCGCTGTGCCAATGGTCAGTGCATTGGAAAGCACAAGAAGTGTGATCATAATGTGGATTGCAGT GACAAGTCAGATGAAC；
Above: F:forward, forward；LRP6-F represents the forward primer for detecting nucleic acid.
R:reverse, reversely；LRP6-R represents the reverse primer for detecting nucleic acid.
P:probe, fluorescent probe；LRP6-P represents the fluorescent probe for detecting nucleic acid, and this fluorescent probe is TaqMan Fluorescent probe.
In embodiments of the present invention, the fluorescent reporter group of the 5' end modifying fluorescent probe can be: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5；The quenching group of the 3' end modifying fluorescent probe can be: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL, this fluorescent reporter group and quenching group do not affect the amplification of quantitative fluorescent PCR, only need to be according to spy The model of the instrument used by the fluorescent reporter group of pin and quenching group selection arranges detectable fluorescence signal scope.The present invention The fluorescent probe fluorescent reporter group that embodiment provides: the excitation wavelength of FAM, HEX, TET and FAM is 470-650nm, receives ripple A length of 500-700nm；Quenching group: Eclipse, TAMRA, BHQ1.Way of purification after primer synthesis can be: HAP, PAGE With HPLC way of purification.
[embodiment 2] builds containing LRP6-P genic mutation type and the recombiant plasmid of the DNA fragmentation of wild type
One, human pancreas cancer PNAC-1 cell line is cultivated and is passed on
1) cell is cultivated
All cells system uses RPMI-1640 culture medium (Invitrogen, Carlsbad, CA), 10% hyclone (Invitrogen, Carlsbad, CA), in 37 DEG C, 5%CO2Cultivate under environment.
2) passage
First by sterilizing suction pipe by the culture fluid sucking-off in Tissue Culture Dish, add PBS and clean 2 times, toward thin Born of the same parents slowly drip appropriate trypsin, treat cell rounding, adjust angle cell can add after moving 3ml containing 10% tire cattle The DMEM culture medium of serum, the most gently after piping and druming, basis of microscopic observation cellular morphology also counts, according to cell in culture dish Content, by the culture dish of appropriate passage to other sterilizings, puts into 5%CO after adding the DMEM culture medium of 5ml2Cultivate Case.
Cell counting formula (individual/ml): (4 big lattice total cellular score) × 104× extension rate/4
Two, the extraction of total serum IgE
1) outwell culture medium, after PBS, directly 1ml Trizol is injected culture bottle (wherein cell 5 × 106Individual/ Ml), suction is uniform repeatedly；
2) adding the chloroform (for the 1/5 of Trizol cumulative volume) of 0.2ml in equipped with the centrifuge tube of lysate, vibration is mixed 30 seconds, left at room temperature 5 minutes；
3) centrifugal 15 minutes of 12000rpm 4 DEG C, split-phase is three layers.Upper strata: RNA (the 60% of about Trizol)；Middle: DNA；Lower floor: protein (phenol-chloroform)；
4) careful Aspirate supernatant, transfers in another EP pipe.1ml lysate produce supernatant volume be about 0.4～ 0.6ml.DNA and protein are contained in organic facies and intermediate layer, avoid touching；
5) supernatant adds the isopropanol of about 0.5ml, and vibration is mixed 30 seconds.Left at room temperature 10 minutes；
6) centrifugal 10 minutes of 12000rpm 4 DEG C；
7) side at the centrifugal end is formed by RNA precipitate.Careful suction abandons supernatant, notes avoiding suction to abandon RNA precipitate；
8) centrifuge tube adds 75% ethanol (1ml Trizol at least 1ml ethanol purge DNA) of 1ml pre-cooling, and vibration is mixed 30 seconds, making precipitation vibrate, room temperature 12000rpm is centrifuged 1～2 minute.Inhale as far as possible and abandon supernatant, prevent RNA precipitate from losing Lose.Repeat above cleaning step once.In 75% ethanol, RNA at least preserves 1 week at 4 DEG C, and-20 DEG C at least preserve 1 year；
9) room temperature selecting liquidity is little, and inversion centrifuge tube, on filter paper, is dried RNA, but can not be completely dried (5～10 points Clock).With DEPC water 15 μ L dissolution precipitation, hatch 10～15 minutes for 55-60 DEG C.
10) RNA purity detecting
Drip 2 μ L RNA solution in ultramicrospectrophotometer (model: P330-311), and read OD260/ in instrument OD280 ratio.
Three, construction recombination plasmid
1) DNA fragmentation containing LRP6 genic mutation type and wild type is carried out PCR amplification；
DNA fragmentation containing S148L codon mutation type is the sequence shown in SEQ NO.9；
TTAGTCATGGCTTGATATACTGGAGTGATGTCAGCGAAGAAGCCATTAAACGAACAGAATTTAACAAAACTGAGAGT GTGCAGAATGTTGTTGTTTCTGGATTATTGTCCCCCGATGGGCTGGCATGTGATTGGCTTGGAGAAAAATTGTACTG GACAGATTCTGAAACTAATCGGATTGAAGTTTCTAATTTAGATGGATCTTTACGAAAAGTTTTATTTTGGCAAGAGT TGGATCAACCCAGAGCTATTGCCTTAGATCCTTTAAGTGGGTTCATGTACTGGACAGACTGGGGAGAAGTGCCAAAG ATAGAACGTGCTGGAATGGATGGTTCAAGTCGCTTCATTATAATAAACAGTGAAATTTACTGGCCA；(SEQ NO.9)
DNA fragmentation containing R1269W codon mutation type is the sequence shown in SEQ NO.10；
GGTGTTCTTGCCCCATGCACCTGGTTCTACTTCAAGATGAGCTATCATGTGGAGAACCTCCAACATGTTCTCCTCAG CAGTTTACTTGTTTCACGGGGGAAATTGACTGTATCCCTGTGGCTTGGTGGTGCGATGGGTTTACTGAATGTGAAGA CCACAGTGATGAACTCAATTGTCCTGTATGCTCAGAGTCCCAGTTCCAGTGTGCCAGTGGGCAGTGTATTGATGGTG CCCTCCGATGCAATGGAGATGCAAACTGCCAGGACAAATCAGATGAGAAGAACTGTGAAGTGCTTTGTTTAATTGAT CAGTTCCGCTGTGCCAATGGTCAGTGCATTGGAAAGCACAAGAAGTGTGATCATAATGTGGATTGCAGTGACAAGTC AGATGAACTGGATTGTT；(SEQ NO.10)
DNA fragmentation containing 185 codon wild types is the sequence shown in SEQ NO.11；
TTAGTCATGGCTTGATATACTGGAGTGATGTCAGCGAAGAAGCCATTAAACGAACAGAATTTAACAAAACTGAGAGT GTGCAGAATGTTGTTGTTTCTGGATTATTGTCCCCCGATGGGCTGGCATGTGATTGGCTTGGAGAAAAATTGTACTG GACAGATTCTGAAACTAATCGGATTGAAGTTTCTAATTTAGATGGATCTTTACGAAAAGTTTTATTTTGGCAAGAGT TGGATCAACCCAGAGCTATTGCCTTAGATCCTTCAAGTGGGTTCATGTACTGGACAGACTGGGGAGAAGTGCCAAAG ATAGAACGTGCTGGAATGGATGGTTCAAGTCGCTTCATTATAATAAACAGTGAAATTTACTGGCCA；(SEQ NO.11)
DNA fragmentation containing 1269 codon wild types is the sequence shown in SEQ NO.12；
GGTGTTCTTGCCCCATGCACCTGGTTCTACTTCAAGATGAGCTATCATGTGGAGAACCTCCAACATGTTCTCCTCAG CAGTTTACTTGTTTCACGGGGGAAATTGACTGTATCCCTGTGGCTTGGCGGTGCGATGGGTTTACTGAATGTGAAGA CCACAGTGATGAACTCAATTGTCCTGTATGCTCAGAGTCCCAGTTCCAGTGTGCCAGTGGGCAGTGTATTGATGGTG CCCTCCGATGCAATGGAGATGCAAACTGCCAGGACAAATCAGATGAGAAGAACTGTGAAGTGCTTTGTTTAATTGAT CAGTTCCGCTGTGCCAATGGTCAGTGCATTGGAAAGCACAAGAAGTGTGATCATAATGTGGATTGCAGTGACAAGTC AGATGAACTGGATTGTT；(SEQ NO.12)
2) PCR primer is carried out double digestion；
Carrier and PCR primer carry out double digestion by condition once respectively, and (reaction system is 30 μ l, and 37 DEG C, enzyme action 2 is little Time)；
3) (operating according to test kit description) is reclaimed in rubber tapping after double digestion product electrophoresis；
4) digestion products is attached with plasmid vector；
Above-mentioned double digestion product through purification, (wherein reclaim, purification step after PCR fragment enzyme action by the rubber tapping of carrier digestion products Identical with above-mentioned PCR primer purification step), under T4 DNA ligase effect, 16 DEG C connect overnight.Linked system is as follows: carry Body, 2 μ l；PCR fragment, 6 μ l；10xT4 buffer, 1 μ l；T4 DNA ligase, 1 μ l.
5) E. coli competent is converted；
Take above-mentioned connection liquid 5 μ l to be transformed in previously prepared DH5 α Competent cell, ice bath 30 minutes, 42 DEG C of heat Swashing 2min, put 5min on ice, add 37 DEG C of shaking table 45min of 1mlLB culture fluid, centrifugal 5000rpm, 1-5min (are centrifuged too For a long time, in order to avoid the most real), finally it is uniformly coated on (100-150 μ l) on the LB flat board containing 100ng/ml antibiotic.By flat board 37 DEG C be inverted overnight incubation.Picking positive colony bacterium colony turns to draw and contains on the LB flat board of 100ng/ml antibiotic to another block, and right Be numbered, 37 DEG C be inverted overnight incubation.
6) QIAGEN test kit extracting plasmid (carrying out to specifications), makes reference material.
[embodiment 3] quantitative real-time PCR amplified sample
Taking the total serum IgE 1-5 μ g of extraction, add PCR reactant liquor, PCR reactant liquor includes: sterilized water, to have 5' → 3' circumscribed Archaeal dna polymerase, dNTPs, 10 × PCR Buffer, RNASIN, M-MLV reverse transcriptase, oligo (dT) and the ion Han Mg of activity Solution.Wherein, concentration be 5U/ μ L there is archaeal dna polymerase 0.3 μ L exo-acting for 5' → 3', concentration is 10mmol/L's DNTPs 2 μ L, 10 × PCR Buffer5 μ L, concentration is the RNASIN 0.6 μ L of 40U/ μ L, and concentration is that the M-MLV of 200U/ μ L is inverse Transcriptase 0.6 μ L, concentration is the MgCl of 25mmol/L2Solution 5 μ L, adding sterilized water to volume is 50 μ L.Wherein, have 5' → Archaeal dna polymerase exo-acting for 3' can be Taq enzyme.
PCR expand: each reaction tube is put into the reactive tank of quantitative fluorescent PCR instrument, arrange mark fluorescent radical species, Sample ID and type, (this product fluorescent reporter group is FAM, HEX, TAT, fluorescence to select Taqman fluorescence probe to be used Quenching group is Eclipse), define sample well, and the amplification program that according to the form below provides carries out PCR amplification:
Table 1 is pcr amplification reaction amplification program
Fluorescent value is read in end of a period in the 3rd step of amplification program；
Data analysis judges:
Select institute's sample this saltant type corresponding with this pattern detection site and reference wild-type sample wells simultaneously, contrast three holes PCR amplification curve (CTARepresent sample aperture CT value, CTWRepresent wild type CT value, CTMRepresent saltant type CT value):
Work as CTM≤CTA＜ CTWTime, show that this sample exists sudden change；
Work as CTW=CTATime, show that this sample is wild type.
Fig. 1 is peptide nucleic acid(PNA) mass spectrum described in the embodiment of the present invention；
Fig. 2 is S148L saltant type described in the embodiment of the present invention and reference wild-type product PCR amplification figure, upper in figure, in, Lower three bars of lines respectively represent LRP6 the 148th bit codon mutation type reference material, sample and the amplification curve of reference wild-type product；
Fig. 3 is R1269W saltant type described in the embodiment of the present invention and reference wild-type product PCR amplification figure, upper in figure, in, Lower three bars of lines respectively represent LRP6 the 1269th bit codon mutation type reference material, sample and the amplification curve of reference wild-type product；
Above example is only used for technical scheme is described, rather than is limited, although with reference to aforementioned reality Execute example the present invention has been described in detail, for the person of ordinary skill of the art, still can be to aforementioned enforcement Technical scheme described in example is modified, or wherein portion of techniques feature carries out equivalent, and these amendment or Replace, do not make the essence of appropriate technical solution depart from the spirit and scope of claimed technical solution of the invention.
SEQUENCE LISTING
<110>Hubei University Of Technology
<120>reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 26
<212> DNA
<213> Unknown
<220>
<223>S148L mutant forward primer
<400> 1
gtcatggctt gatatactgg agtgat 26
<210> 2
<211> 29
<212> DNA
<213> Unknown
<220>
<223>S148L sudden change reverse primer
<400> 2
ctgtttatta taatgaagcg acttgaacc 29
<210> 3
<211> 22
<212> DNA
<213> Unknown
<220>
<223>R1269W mutant forward primer
<400> 3
ccatgcacct ggttctactt ca 22
<210> 4
<211> 24
<212> DNA
<213> Unknown
<220>
<223>R1269W sudden change reverse primer
<400> 4
cttgtcactg caatccacat tatg 24
<210> 5
<211> 22
<212> DNA
<213> Unknown
<220>
<223>S148L sudden change PNA fluorescent probe
<400> 5
cttagatcct ttaagtgggt tc 22
<210> 6
<211> 16
<212> DNA
<213> Unknown
<220>
<223>R1269W sudden change PNA fluorescent probe
<400> 6
cttggtggtg cgatgg 16
<210> 7
<211> 22
<212> DNA
<213> Unknown
<220>
<223>148 codon wild type PNA sequences
<400> 7
gaacccactt gaaggatcta ag 22
<210> 8
<211> 16
<212> DNA
<213> Unknown
<220>
<223>1269 codon wild type PNA sequences
<400> 8
ccatcgcacc gccaag 16
<210> 9
<211> 374
<212> DNA
<213> Unknown
<220>
<223>148 codon mutation type reference materials
<400> 9
ttagtcatgg cttgatatac tggagtgatg tcagcgaaga agccattaaa cgaacagaat 60
ttaacaaaac tgagagtgtg cagaatgttg ttgtttctgg attattgtcc cccgatgggc 120
tggcatgtga ttggcttgga gaaaaattgt actggacaga ttctgaaact aatcggattg 180
aagtttctaa tttagatgga tctttacgaa aagttttatt ttggcaagag ttggatcaac 240
ccagagctat tgccttagat cctttaagtg ggttcatgta ctggacagac tggggagaag 300
tgccaaagat agaacgtgct ggaatggatg gttcaagtcg cttcattata ataaacagtg 360
aaatttactg gcca 374
<210> 10
<211> 402
<212> DNA
<213> Unknown
<220>
<223>1269 codon mutation type reference materials
<400> 10
ggtgttcttg ccccatgcac ctggttctac ttcaagatga gctatcatgt ggagaacctc 60
caacatgttc tcctcagcag tttacttgtt tcacggggga aattgactgt atccctgtgg 120
cttggtggtg cgatgggttt actgaatgtg aagaccacag tgatgaactc aattgtcctg 180
tatgctcaga gtcccagttc cagtgtgcca gtgggcagtg tattgatggt gccctccgat 240
gcaatggaga tgcaaactgc caggacaaat cagatgagaa gaactgtgaa gtgctttgtt 300
taattgatca gttccgctgt gccaatggtc agtgcattgg aaagcacaag aagtgtgatc 360
ataatgtgga ttgcagtgac aagtcagatg aactggattg tt 402
<210> 11
<211> 374
<212> DNA
<213> Unknown
<220>
<223>148 codon reference wild-type product
<400> 11
ttagtcatgg cttgatatac tggagtgatg tcagcgaaga agccattaaa cgaacagaat 60
ttaacaaaac tgagagtgtg cagaatgttg ttgtttctgg attattgtcc cccgatgggc 120
tggcatgtga ttggcttgga gaaaaattgt actggacaga ttctgaaact aatcggattg 180
aagtttctaa tttagatgga tctttacgaa aagttttatt ttggcaagag ttggatcaac 240
ccagagctat tgccttagat ccttcaagtg ggttcatgta ctggacagac tggggagaag 300
tgccaaagat agaacgtgct ggaatggatg gttcaagtcg cttcattata ataaacagtg 360
aaatttactg gcca 374
<210> 12
<211> 402
<212> DNA
<213> Unknown
<220>
<223>1269 codon reference wild-type product
<400> 12
ggtgttcttg ccccatgcac ctggttctac ttcaagatga gctatcatgt ggagaacctc 60
caacatgttc tcctcagcag tttacttgtt tcacggggga aattgactgt atccctgtgg 120
cttggcggtg cgatgggttt actgaatgtg aagaccacag tgatgaactc aattgtcctg 180
tatgctcaga gtcccagttc cagtgtgcca gtgggcagtg tattgatggt gccctccgat 240
gcaatggaga tgcaaactgc caggacaaat cagatgagaa gaactgtgaa gtgctttgtt 300
taattgatca gttccgctgt gccaatggtc agtgcattgg aaagcacaag aagtgtgatc 360
ataatgtgga ttgcagtgac aagtcagatg aactggattg tt 402

Claims (6)

1. the reagent for LDH receptor related protein 6 LRP6 detection in Gene Mutation, it is characterised in that bag Include the wild type PNA sequence for blocking wild type LRP6 gene amplification, for specific amplification S148L, R1269W saltant type One group of primer of LRP6 gene order to and saltant type PNA fluorescent probe:
Described detection LRP6 gene S148L mutant forward primer such as SEQ ID NO.1 in sequence table；
SEQ ID NO.2 in described detection LRP6 gene S148L sudden change reverse primer such as sequence table；
Described detection LRP6 gene R1269W mutant forward primer such as SEQ ID NO.3 in sequence table；
SEQ ID NO.4 in described detection LRP6 gene R1269W sudden change reverse primer such as sequence table；
SEQ ID NO.5 in described detection LRP6 gene S148L sudden change PNA fluorescent probe such as sequence table；
SEQ ID NO.6 in described detection LRP6 gene R1269W sudden change PNA fluorescent probe such as sequence table；
Described specific binding comprise LRP6 gene 148 codon wild type PNA sequence such as SEQ ID NO.7 in sequence table；
Described specific binding comprise LRP6 gene 1269 codon wild type PNA sequence such as SEQ ID NO.8 in sequence table；
The fluorescent reporter group of the 5' end of described PNA fluorescent probe is: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5, The quenching group of 3' end is: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.
Examination for LDH receptor related protein 6 LRP6 detection in Gene Mutation the most according to claim 1 Agent, it is characterised in that described detectable also includes PCR reactant liquor, 148 codons and 1269 codon mutation type references Product, 148 codons and 1269 codon reference wild-type product；Wherein PCR reactant liquor includes: DEPC water, to have 5' → 3' circumscribed The archaeal dna polymerase of activity, dNTPs, 10 × PCR Buffer, RNASIN, M-MLV reverse transcriptase, oligo(dT) and the ion Han Mg Solution；The described 148 codon mutation type reference materials that contain are the recombinant plasmid dna containing SEQ NO.9；Described contain 1269 codons Saltant type reference material is the recombinant plasmid dna containing SEQ NO.10；The described 148 codon reference wild-type product that contain are for containing SEQ The recombinant plasmid dna of NO.11；The described 1269 codon reference wild-type product that contain are the recombinant plasmid dna containing SEQ NO.12.
Examination for LDH receptor related protein 6 LRP6 detection in Gene Mutation the most according to claim 2 Agent, it is characterised in that described in have archaeal dna polymerase exo-acting for 5' → 3' be Taq enzyme.
Examination for LDH receptor related protein 6 LRP6 detection in Gene Mutation the most according to claim 3 Agent, it is characterised in that final concentration of in pcr amplification reaction system of the described each component of PCR reactant liquor: Taq enzyme 0.01U/ L ～0.05U/ L, dNTPs 0.2～0.6 mM, 10 × PCR Buffer 1 ×, RNASIN 40U/ L～60U/ L, M-MLV is inverse Transcriptase 200U/ L～320U/ L, MgCl21.5～5.0mM, solvent is DEPC water；Described forward primer final concentration of 0.05～0.9 μM, final concentration of 0.05～0.9 μM of described reverse primer, described oligo(dT) final concentration of 0.05～0.9 M, described complementary final concentration of 0.05～0.9 μM of PNA sequence, final concentration of 0.05～0.9 μM of described fluorescent probe.
5. according to examining for LDH receptor related protein 6 LRP6 gene mutation described in any one of claim 1-4 The reagent surveyed, it is characterised in that described reagent carries out the response procedures of real-time fluorescence quantitative PCR and is: 42 ° of C reverse transcriptions 20 min；94 ° of C denaturations, 2 min；95 ° of C degeneration, 30 s, 58 ° of C, 45 s, now collect fluorescence, carry out 40 circulations.
6. the application in the detectable of preparation detection cancerous cell of the reagent described in claim 1, described cancerous cell is non-little Cell lung cancer, cancer of pancreas.
CN201610863561.3A 2016-09-28 2016-09-28 The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application Pending CN106222296A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610863561.3A CN106222296A (en) 2016-09-28 2016-09-28 The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610863561.3A CN106222296A (en) 2016-09-28 2016-09-28 The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application

Publications (1)

Publication Number Publication Date
CN106222296A true CN106222296A (en) 2016-12-14

Family

ID=58077425

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610863561.3A Pending CN106222296A (en) 2016-09-28 2016-09-28 The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application

Country Status (1)

Country Link
CN (1) CN106222296A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060263791A1 (en) * 2005-05-20 2006-11-23 Moon Randall T Methods for diagnosis of Alzheimer disease
CN103667492A (en) * 2013-12-13 2014-03-26 青岛大学医学院附属医院 WNT signal channel detecting reagent, PCR (polymerase chain reaction) detection method and application thereof
CN105821127A (en) * 2016-04-22 2016-08-03 湖北工业大学 Adenomatous polyposis coli protein APC gene mutation detection reagent and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060263791A1 (en) * 2005-05-20 2006-11-23 Moon Randall T Methods for diagnosis of Alzheimer disease
CN103667492A (en) * 2013-12-13 2014-03-26 青岛大学医学院附属医院 WNT signal channel detecting reagent, PCR (polymerase chain reaction) detection method and application thereof
CN105821127A (en) * 2016-04-22 2016-08-03 湖北工业大学 Adenomatous polyposis coli protein APC gene mutation detection reagent and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MAARTEN P G MASSINK等: "Loss-of-Function Mutations in the WNT Co-receptor LRP6 Cause Autosomal-Dominant Oligodontia", 《AMERICAN JOURNAL OF HUMAN GENETICS》 *

Similar Documents

Publication Publication Date Title
CN104911268B (en) Detection reagent, PCR detection method and the application of Pygo2 gene mutation in Wnt signal path based on peptide nucleic acid probe
JP5345857B2 (en) DNA three-dimensional structure (loop structure) in normal and abnormal gene expression
CN106995858A (en) A kind of lncRNA related to liver cancer diagnosis and treatment
CN105821127A (en) Adenomatous polyposis coli protein APC gene mutation detection reagent and application thereof
CN105838796A (en) AXIN2 gene mutation detection reagent and application
CN105950720A (en) Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent
CN104911271A (en) Detection reagent based on Pygo2 and FoxM1 gene expression in Wnt signal pathways of peptide nucleic acid probes, PCR detection method and application of detection reagent
CN107828873A (en) The detection reagent that the gene P546R of Bcl 9 are mutated in Wnt signal paths based on peptide nucleic acid probe
CN107893105A (en) The detection reagent that FoxM1 genes R256G is mutated in Wnt signal paths based on peptide nucleic acid probe
CN106244715A (en) The reagent of a kind of β catenin interaction protein 1 gene abrupt climatic change and application
CN110408703A (en) Colorectal cancer miRNA marker and its application
CN101070538B (en) Human epiterm growth-factor receptor mutation gene and use thereof
CN105713986A (en) Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application
CN110452989B (en) Application of biomarker in detection and diagnosis of gastric cancer
CN107267616A (en) A kind of application of Noncoding gene biomarker in liver cancer
CN105441405B (en) BMX spliced body and its application in drug resistance of lung cancer
CN105713985B (en) A kind of reagent and application for plug transcription factor O1 detection in Gene Mutation
CN105695619A (en) Casein kinase-1 gene mutation detection reagent based on peptide nucleic acid probes and application
CN106222296A (en) The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application
CN106636444B (en) Use of FAM78A gene
CN108192977A (en) A kind of and relevant molecular marker of gastric cancer occurrence and development
CN106319068A (en) Reagent for Chibby homologue 1 gene mutation detection and application
US10487328B2 (en) Blocking Hepatitis C Virus infection associated liver tumor development with HCV-specific antisense RNA
CN106367517A (en) Low-density lipoprotein receptor-related protein 5 (LRP5) gene mutation detection reagents and application thereof
CN106282378A (en) A kind of reagent for cyclin-depended kinase 8 detection in Gene Mutation and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20161214

RJ01 Rejection of invention patent application after publication