CN107739753A - The detection reagent that Pygo2 genes R46S is mutated in Wnt signal paths based on peptide nucleic acid probe - Google Patents

The detection reagent that Pygo2 genes R46S is mutated in Wnt signal paths based on peptide nucleic acid probe Download PDF

Info

Publication number
CN107739753A
CN107739753A CN201711188137.4A CN201711188137A CN107739753A CN 107739753 A CN107739753 A CN 107739753A CN 201711188137 A CN201711188137 A CN 201711188137A CN 107739753 A CN107739753 A CN 107739753A
Authority
CN
China
Prior art keywords
pygo2
nucleic acid
genes
peptide nucleic
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201711188137.4A
Other languages
Chinese (zh)
Inventor
唐景峰
周策凡
陈兴珍
张毅
代俊
周梦舟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hubei University of Technology
Original Assignee
Hubei University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hubei University of Technology filed Critical Hubei University of Technology
Priority to CN201711188137.4A priority Critical patent/CN107739753A/en
Publication of CN107739753A publication Critical patent/CN107739753A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification

Abstract

The invention discloses detection reagent, PCR detection method and the application that Pygo2 genes R46S in a kind of Wnt signal paths based on peptide nucleic acid probe is mutated, detection reagent includes the complementary peptide nucleic acid sequence of primer, peptide nucleic acid fluorescence probe and wild type, SEQ ID NO.1, NO.3, NO.5, NO.7 in forward primer such as sequence table；SEQ ID NO.2, NO.4, NO.6, NO.8 in reverse primer such as sequence table；SEQ ID NO.9, NO.10, NO.11, NO.12 in peptide nucleic acid fluorescence probe such as sequence table；SEQ ID NO.13, NO.14, NO.15, NO.16 in wild type complementary peptide nucleic acid sequence such as sequence table.The present invention can quickly have found the change situation of Pygo2 genes in Wnt signal paths from transcriptional level, be screening anticancer medicine, and new targeted drug is inquired into, basic scientific research provides instrument.

Description

The detection that Pygo2 genes R46S is mutated in Wnt signal paths based on peptide nucleic acid probe Reagent
The present invention is《The detection reagent of Pygo2 gene mutations, PCR detections in Wnt signal paths based on peptide nucleic acid probe Method and application》The divisional application of (number of patent application 2015103553148, the applying date 20150624).
Technical field
The invention belongs to molecular biology technical field of biological nucleic acid detection, and in particular to a kind of based on peptide nucleic acid probe The detection reagent that Pygo2 genes R46S is mutated in Wnt signal paths.
Background technology
Wnt signal paths are widely present in invertebrate and vertebrate, are that one kind is high during spore The conservative signal path of degree.Wnt signals are in the early development of animal embryo, orga- nogenesis, regeneration and other physiology courses In, there is vital effect.If the key protein in this signal paths is undergone mutation or unconventionality expression, cause letter Number abnormal activation, it is possible to the generation of induced cancer.Wnt signal paths include classical Wnt signal paths and non-classical Wnt Signal path, in classical path is Wnt- β-catenin signal paths, the Wnt factors pass through on active cell film Suppress phosphorylation and the degraded of endocellular liberation β-catenin albumen after Frizzle/LRP5/6 cooperative expert systems, in cytoplasm The core that β-catenin albumen occurs is shifted after the rise of β-catenin protein levels, causes β-catenin albumen in nucleus Rise, in karyon β-catenin albumen can combine Pygo2, Bcl-9 and FoxM1 albumen jointly with TCF/LEF-1 transcriptions because Sub-family forms complex and activates the transcriptional activation of Wnt signal path downstream target genes.
Pygo2 albumen is one of β-catenin downstream important members in Wnt signal paths, at present increasing research It has been found that high expression is presented in Pygo2 albumen in many tumours.
The core element regulatory mechanism of research core signal path at present, and expression of some important members in cell Level, have become a kind of key means for the treatment of tumour, although research of the Wnt signal paths in cancer in recent years, and Research of the Pygo2 albumen as its expression of Wnt signal path important members, have become research and development tumour medicine and be badly in need of The major issue of solution, but the mutation of its gene in many tumour cells is also more and more simultaneously, especially in Pygo2 eggs The mutation that white NHD ends and PHD ends occur, to the very important effect of Pygo2 protein exhibits function ons, for example (,) it is thin in carcinoma of urinary bladder Detect that NHD ends R46S is mutated in born of the same parents, the PHD ends that P98H is mutated, and is detected in lung adenocarcinoma cell are detected in pancreatic cancer cell The R356P mutation detected in R334Q mutation and acute myelogenous leukemia.
Peptide nucleic acid (peptide nucleic acids, PNA) is a kind of DNA for substituting sugared phosphate backbone with polypeptide backbone Analog.It is on the basis of the first generation, second generation antisense agent, is built by Computer Design and final artificial synthesized Third generation antisense agent, it is a kind of brand-new DNA analogs, i.e., is substituted with the peptide chain acid amides 2- aminoethylglycines key of neutrality Pentose phosphate diester linkage skeleton in DNA, remaining is identical with DNA, PNA can pass through Watson-Crick base pairings Form identifies and combines DNA or RNA sequence, forms stable double-spiral structure.Because PNA is not negatively charged, with DNA and RNA Between be not present electrostatic repulsion, thus the stability and specificity that combine all greatly improve；Different between DNA or DNA, RNA Hybridization, PNA and DNA or RNA hybridization are hardly influenceed by hybridization system salinity, remote with the hybridization ability of DNA or RNA molecule Better than DNA/DNA or DNA/RNA, very high hybridization stability, excellent distinguished sequence recognition capability are shown, not by nuclease And protease hydrolytic.
The content of the invention
The purpose of the present invention is to be directed to above-mentioned present situation, it is desirable to provide a kind of signal that can determine that core in Wnt signal paths Molecule Pygo2 gene mutation situations, can explain that core element Pygo2 changes in tumour cell, as a result repeated, and sensitiveness is good The Wnt signal paths based on peptide nucleic acid probe in Pygo2 genes R46S be mutated detection reagent.
The implementation of the object of the invention is that Pygo2 genes R46S is mutated in the Wnt signal paths based on peptide nucleic acid probe Detection reagent, including primer and probe, the primer includes forward primer and reverse primer, and the probe is that peptide nucleic acid is visited Pin, it is characterised in that：
SEQ ID NO.1 in the detection Pygo2 gene R46S mutant forward primers such as sequence table；
SEQ ID NO.2 in the detection Pygo2 genes R46S mutation reverse primers such as sequence table；
SEQ ID NO.9 in the detection Pygo2 genes R46S mutation PNA fluorescence probes such as sequence table；
The 5' ends and 3' ends of the peptide nucleic acid fluorescence probe are modified with fluorescent reporter group and quenching group respectively, modify institute The fluorescent reporter group for stating 5' ends is：FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5, that modifies the 3' ends is quenched base Roll into a ball and be：TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.
The method that the detection reagent of Pygo2 gene mutations is detected in Wnt signal paths based on peptide nucleic acid probe, inspection Survey method is based on the real time fluorescence quantifying PCR method that peptide nucleic acid is fluorescence probe；
The reaction system of the real-time fluorescence quantitative PCR is：Forward primer, reverse primer, DEPC water, have 5' → 3' outside Cut activity archaeal dna polymerase, dNTPs, 10 × PCR Buffer, RNASIN, M-MLV reverse transcriptase, oligo (dT) and containing Mg from The solution of son；
The archaeal dna polymerase exo-acting with 5' → 3' is Taq enzyme.
The application of the detection reagent of Pygo2 gene mutations in Wnt signal paths based on peptide nucleic acid probe, examined for preparing Survey the detection reagent of tumour cell and normal cell, the cancer cell be transitional cell bladder carcinoma cell line, pancreatic cancer cell, lung adenocarcinoma cell or Acute myelogenous leukemia haemocyte.
The present invention is using the PNA oligomers of distinguished sequence as probe.Because PNA is a kind of class of artificial synthesized nucleic acid Like thing, and it is achirality, uncharged molecule, avoids when oligonucleotides is combined with its target gene because electric charge is mutually exclusive Caused hybridization unstability, with reference to being not easy to be influenceed by hybridization solution ionic strength, so as to show extremely strong heterosis, hybrid vigor, Substantially increase detection sensitivity.
Compared with prior art, the advantages and positive effects of the present invention are:Pygo2 genes are that newfound Wnt signals lead to The gene for playing critical function of β-catenin proteins downstreams, can pass through by detection reagent provided by the invention in road Quantitative real-time PCR goes out the mutation of Pygo2 genes in transcriptional level quick detection, and with common real-time fluorescence quantitative PCR Unlike, the peptide nucleic acid PNA fluorescence probes that the applicant uses are sensitiveer, the screening of the invention for cancer therapy drug, new target Very strong instrument is both provided to the Mechanism Study of medicine.
Brief description of the drawings
Fig. 1 is peptide nucleic acid mass spectrogram described in the embodiment of the present invention；
Fig. 2 is R46S saltant types described in the embodiment of the present invention and reference wild-type product PCR amplification figures；
Fig. 3 is P98H saltant types described in the embodiment of the present invention and reference wild-type product PCR amplification figures；
Fig. 4 is R334Q saltant types described in the embodiment of the present invention and reference wild-type product PCR amplification figures；
Fig. 5 is R356P saltant types described in the embodiment of the present invention and reference wild-type product PCR amplification figures.
Embodiment
The detection reagent of Pygo2 gene mutations in Wnt signal paths based on peptide nucleic acid probe, the primer include forward direction Primer and reverse primer, the probe are peptide nucleic acid probe, it is characterised in that：
SEQ ID NO.1 in the detection Pygo2 gene R46S mutant forward primers such as sequence table；
SEQ ID NO.2 in the detection Pygo2 genes R46S mutation reverse primers such as sequence table；
SEQ ID NO.9 in the detection Pygo2 genes R46S mutation PNA fluorescence probes such as sequence table；
The 5' ends and 3' ends of the peptide nucleic acid fluorescence probe are modified with fluorescent reporter group and quenching group respectively, modify institute The fluorescent reporter group for stating 5' ends is：FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5, that modifies the 3' ends is quenched base Roll into a ball and be：TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.
Detection reagent also contains contrast agent, and contrast agent is the peptide nucleic acid sequence complementary with Pygo2 genes wild type,
The specific binding includes SEQ ID in the codon wild type PNA sequences of Pygo2 genes 46 such as sequence table NO.13。
The mass spectrogram of peptide nucleic acid used in the present invention is shown in Fig. 1.
The method detected with the detection reagent of Pygo2 gene mutations in the Wnt signal paths based on peptide nucleic acid probe, Detection method is PCR detection method, and the PCR detection method is based on the real-time fluorescence quantitative PCR that peptide nucleic acid is fluorescence probe Method；
The reaction system of the real-time fluorescence quantitative PCR is：Forward primer, reverse primer, DEPC water, have 5' → 3' outside Cut activity archaeal dna polymerase, dNTPs, 10 × PCR Buffer, RNASIN, M-MLV reverse transcriptase, oligo (dT) and containing Mg from The solution of son；
The archaeal dna polymerase exo-acting with 5' → 3' is Taq enzyme.
The detection method of Pygo2 gene mutations in Wnt signal paths based on peptide nucleic acid probe is as follows the step of detection：
1) detect the primer in these sites for the design of the codon mutation type of Pygo2 genes 46,98,334,356 and PNA is visited Pin；
2) 4 sections for the design of the Codon sequences of Pygo2 genes 46,98,334,356 with these site wild types complementations PNA sequences；
3) plasmid containing Pygo2 genic mutation types and wild type is built, and calculates copy number, reference material is made；
4) mRNA in cell to be measured is extracted；
5) fluorescence quantitative PCR detection is carried out to reference material and sample with above-mentioned detection Pygo2 gene mutations reagent, and judged Whether the codon of Pygo2 genes 46,98,334,356 undergos mutation.
Final concentration of 0.01U/ μ L~0.05U/ μ L of Taq enzyme described in the PCR reaction solutions, the end of the dNTPs are dense Spend for 0.2~0.6mM, 10 × PCR Buffer final concentration of 1 ×, the final concentration of 40U/ μ L of the RNASIN~ 60U/ μ L, final concentration of 200U/ μ L~320U/ μ L, the MgCl of the M-MLV reverse transcriptases2Final concentration of 1.5~ 5.0mM, solvent are DEPC water, final concentration of 0.05~0.9 μM of the forward primer, the reverse primer it is final concentration of 0.05~0.9 μM, final concentration of 0.05~0.9 μM of the fluorescence probe.
The response procedures of the real-time fluorescence quantitative PCR are：42 DEG C of reverse transcription 20min；94 DEG C of pre-degenerations, 2min；95℃ Denaturation, 30s；58 DEG C, 45s；Carry out 40 circulations.
The experimental system of the present invention can be carried out on any real-time fluorescence quantitative PCR instrument, its PCR reaction kit For the type quantitative real time PCR Instrument of Applied Biosystems companies 7500.Above-mentioned primer is placed in eight unions, carries out real-time fluorescence Quantitative PCR detection, experimental implementation is simple, low-cost, and as a result repeated, sensitiveness is good, is the related drugs effect of research tumour A kind of important means of mechanism and basic scientific research.
The detection reagent of Pygo2 gene mutations is used to prepare detection tumour in Wnt signal paths based on peptide nucleic acid probe The detection reagent of cell and normal cell, the cancer cell are transitional cell bladder carcinoma cell line, pancreatic cancer cell, lung adenocarcinoma cell or acute bone Myelogenous leukemia haemocyte.
The present invention is illustrated by pancreatic cancer cell.
PNAC-1 (human pancreas cancer PNAC-1 cell lines) cell line is purchased from U.S. ATCC in the present invention, and culture cell is used RPMI-1640 culture mediums and 10% hyclone be purchased from handsome company, other reagents are mainly (big purchased from precious bioengineering Even) Co., Ltd.
Detecting intracellular Wnt signal paths Pygo2 gene mutations using reagent of the present invention includes step in detail below：
First, primed probe designs
According to American National Biotechnology Information center (National Center for BiotechnologyInformation, NCBI) (http://www.ncbi.nlm.nih.gov) report hPygo2mRNA sequences Arrange (NCBI Reference Sequence:NM_138300.3), developed using Applied Biosystems companies Primer Express Software for Real-Time PCR Software for Design special Pygo2 primers and probe.
Pygo2R46S：
Pygo2-F:5'-CAGGGCAAGGCCGGTCT-3'；
Pygo2-R:5'-ACTCCGTCAGATGTGAGTATGCAG-3'；
Pygo2(PNA)-P:5'FAM-AGCGAAGCAAGTCAAATACTC-BHQ 3'；
Pygo2-PNA：AGCGAAGGAAGTCAAATACTC
Target sequence：
AAGCAGGGCAAGGCCGGTCTGCAAATGAAGAGTCCAGAAAAGAAGCGAAGGAAGTCAAATACTCAGGGC CCTGCATACTCACATCTGACGGAGTTT
More than：F：Forward, it is positive；HW-F represents the forward primer for detecting hookworm nucleic acid.
R：Reverse, reversely；HW-R represents the reverse primer for detecting hookworm nucleic acid.
P：Probe, fluorescence probe；HW-P represents the fluorescence probe for detecting hookworm nucleic acid, and the fluorescence probe is TaqMan fluorescence probes.
In embodiments of the present invention, modifying the fluorescent reporter group at the 5' ends of fluorescence probe can be：FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5；Modifying the quenching group at the 3' ends of fluorescence probe can be：TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL, the fluorescent reporter group do not influence the amplification of quantitative fluorescent PCR with quenching group, only need to be according to spy The model of instrument used in fluorescent reporter group and the quenching group selection of pin sets detectable fluorescence signal scope.The present invention The fluorescence probe fluorescent reporter group that embodiment provides：FAM, HEX, TET and FAM excitation wavelength are 470-650nm, received wave A length of 500-700nm；Quenching group：Eclipse、TAMRA、BHQ1.Primer synthesis after way of purification can be：HAP、PAGE With HPLC way of purification.
2nd, the culture of human pancreas cancer PNAC-1 cell lines and passage
1) cell culture
All cell lines use RPMI-1640 culture mediums (Invitrogen, Carlsbad, CA), 10% hyclone (Invitrogen, Carlsbad, CA), in 37 DEG C, 5%CO2Cultivated under environment.
2) passage
The nutrient solution in Tissue Culture Dish is suctioned out first by sterilized straw, PBS is added and cleans 2 times, toward carefully Appropriate trypsase is slowly added dropwise in born of the same parents, treats that cell rounding, adjustment angle cell add 3ml and contain 10% tire ox after can moving The DMEM culture mediums of serum, after gently blowing and beating repeatedly, micro- Microscopic observation cellular morphology simultaneously counts, according to cell in culture dish In the culture dish that content sterilizes appropriate passage to other, 5%CO is put into after adding 5ml DMEM culture mediums2Culture Case.
Cell count formula (individual/ml)：(4 big lattice TCS) × 104× extension rate/4
3rd, the extraction of total serum IgE
1) outwell culture medium, after PBS, 1ml Trizol are directly injected into blake bottle (wherein cell 5 × 106Individual/ Ml), suction is uniform repeatedly；
2) 0.2ml chloroform (for the 1/5 of Trizol cumulative volumes) is added in the centrifuge tube equipped with lysate, vibration is mixed 30 seconds, stand 5 minutes at room temperature；
3) 4 DEG C of 12000rpm is centrifuged 15 minutes, and split-phase is three layers.Upper strata：RNA (about the 60% of Trizol)；It is middle： DNA；Lower floor:Protein (phenol-chloroform)；
4) careful Aspirate supernatant, it is transferred in another EP pipes.Supernatant volume caused by 1ml lysates is about 0.4~ 0.6ml.DNA and protein are contained in organic phase and intermediate layer, avoid touching；
5) supernatant adds about 0.5ml isopropanol, and vibration is mixed 30 seconds.Stand 10 minutes at room temperature；
6) 4 DEG C of 12000rpm is centrifuged 10 minutes；
7) RNA precipitate will be formed in the side at centrifugation bottom.Careful inhale abandons supernatant, pays attention to avoiding suction from abandoning RNA precipitate；
8) centrifuge tube adds 75% ethanol (1ml Trizol at least 1ml ethanol cleaning DNA) of 1ml precoolings, and vibration is mixed 30 seconds, vibrate precipitation, room temperature 12000rpm is centrifuged 1~2 minute.Inhale as far as possible and abandon supernatant, prevent RNA precipitate from losing Lose.Repeat above cleaning step once.In 75% ethanol, RNA is at least preserved 1 week at 4 DEG C, and -20 DEG C at least preserve 1 year；
9) room temperature selecting liquidity is small, is inverted centrifuge tube on filter paper, dries RNA, but can not be completely dried (5~10 points Clock).Dissolved and precipitated with the μ L of DEPC water 15,55-60 DEG C is incubated 10~15 minutes.
10) RNA purity detectings
2 μ L RNA solutions are added dropwise in ultramicrospectrophotometer (model：P330-311), and OD260/ in instrument is read OD280 ratios.
4th, construction recombination plasmid
1) DNA fragmentation containing Pygo2 genic mutation types and wild type is entered into performing PCR amplification；
2) PCR primer is subjected to double digestion；
Carrier and PCR primer carry out double digestion with condition once respectively, and (reaction system is 30ul, and 37 DEG C, digestion 2 is small When)；
3) by rubber tapping recovery (being operated according to kit specification) after double digestion product electrophoresis；
4) digestion products and plasmid vector are attached；
Above-mentioned double digestion product is by purifying (wherein carrier digestion products rubber tapping recovery, purification step after PCR fragment digestion It is identical with above-mentioned PCR primer purification step), 16 DEG C connect overnight under T4DNA connection enzyme effects.Linked system is as follows：Carrier, 2ul；PCR fragment, 6ul；10xT4buffer, 1ul；T4DNA ligase, 1ul.
5) E. coli competent is converted；
The above-mentioned μ l of connection liquid 5 are taken to be transformed into previously prepared DH5 α Competent cells, ice bath 30 minutes, 42 DEG C of heat Swash 2min, put 5min on ice, add 1mlLB 37 DEG C of shaking table 45min of nutrient solution, centrifuge 5000rpm, 1-5min (not centrifuged too Long, it is in order to avoid too real), finally it is uniformly coated on (100-150ul) on the LB flat boards containing 100ng/ml antibiotic.By flat board 37 DEG C be inverted overnight incubation.Picking positive colony bacterium colony turns to draw onto another piece of LB flat board containing 100ng/ml antibiotic, and right Be numbered, 37 DEG C inversion overnight incubations.
6) QIAGEN kits extracting plasmid (carrying out to specifications), is made reference material.
5th, real-time fluorescence quantitative PCR
The total serum IgE 1-5 μ g of extraction are taken, add PCR reaction solutions, PCR reaction solutions include：Sterilized water, have 5' → 3' circumscribed Archaeal dna polymerase, dNTPs, 10 × PCR Buffer, RNASIN, M-MLV reverse transcriptase, oligo (dT) and the ion containing Mg of activity Solution.Wherein, the archaeal dna polymerase 0.3 μ L exo-acting with 5' → 3' that concentration is 5U/ μ L, concentration are 10mmol/L's The μ L of 2 μ L, 10 × PCR Buffer of dNTPs 5, concentration are the 40U/ μ L μ L of RNASIN 0.6, and concentration is 200U/ μ L M-MLV The μ L of reverse transcriptase 0.6, concentration are 25mmol/L MgCl2The μ L of solution 5, addition sterilized water to volume is 50 μ L.Wherein, there is 5' Archaeal dna polymerase exo-acting → 3' can be Taq enzyme.
PCR is expanded：Each reaction tube is put into the reactive tank of quantitative fluorescent PCR instrument, setting mark fluorescent radical species, Sample ID and type, (this product fluorescent reporter group is FAM, HEX, TAT to the Taqman fluorescence probe of selection, fluorescence Quenching group is Eclipse), sample well is defined, and the amplification program that according to the form below provides enters performing PCR amplification：
Table 1 is pcr amplification reaction amplification program
Fluorescent value is read in the end of a period of the 3rd step of amplification program.
R46S saltant types described in the embodiment of the present invention and reference wild-type product PCR amplification figures are shown in Fig. 2, upper, middle and lower in figure Three bars of lines respectively represent the amplification curve of the bit codon mutation type reference material of Pygo2 genes the 46th, sample and reference wild-type product.
Illustrate that the 98th bit codon is saltant type in cancer of pancreas PNAC-1 cell lines from figure, and the 46th, 334,356 password Son is wild type.
6th, data analysis judges：
Selected institute's sample sheet saltant type corresponding with the pattern detection site and reference wild-type sample wells simultaneously, contrast three holes PCR amplification curves (CTARepresent sample aperture CT values, CTWRepresent wild type CT values, CTMRepresent saltant type CT values)：
Work as CTW＜ CTA≤CTMWhen, show that the sample has mutation；
Work as CTW=CTAWhen, it is wild type to show the sample.
Sequence table
<110>Hubei University Of Technology
<120>The detection reagent that Pygo2 genes R46S is mutated in Wnt signal paths based on peptide nucleic acid probe
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
cagggcaagg ccggtct 17
<210> 2
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
actccgtcag atgtgagtat gcag 24
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
agcgaagcaa gtcaaatact c 21
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
agcgaaggaa gtcaaatact c 21

Claims (2)

1. the detection reagent that Pygo2 genes R46S is mutated in the Wnt signal paths based on peptide nucleic acid probe, including primer and spy Pin, the primer include forward primer and reverse primer, and the probe is peptide nucleic acid probe, it is characterised in that：
SEQ ID NO.1 in the detection Pygo2 gene R46S mutant forward primers such as sequence table；
SEQ ID NO.2 in the detection Pygo2 genes R46S mutation reverse primers such as sequence table；
SEQ ID NO.9 in the detection Pygo2 genes R46S mutation PNA fluorescence probes such as sequence table；
The 5' ends and 3' ends of the peptide nucleic acid fluorescence probe are modified with fluorescent reporter group and quenching group respectively, modify the 5' The fluorescent reporter group at end is：FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5, the quenching group for modifying the 3' ends are： TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.
2. the detection that Pygo2 genes R46S is mutated in the Wnt signal paths according to claim 1 based on peptide nucleic acid probe Reagent, it is characterised in that：Detection reagent also contains contrast agent, and contrast agent is the peptide core complementary with Pygo2 genes wild type Acid sequence, the specific binding include SEQ ID in the codon wild type PNA sequences of Pygo2 genes 46 such as sequence table NO.13。
CN201711188137.4A 2015-06-24 2015-06-24 The detection reagent that Pygo2 genes R46S is mutated in Wnt signal paths based on peptide nucleic acid probe Pending CN107739753A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711188137.4A CN107739753A (en) 2015-06-24 2015-06-24 The detection reagent that Pygo2 genes R46S is mutated in Wnt signal paths based on peptide nucleic acid probe

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201510355314.8A CN104911268B (en) 2015-06-24 2015-06-24 Detection reagent, PCR detection method and the application of Pygo2 gene mutation in Wnt signal path based on peptide nucleic acid probe
CN201711188137.4A CN107739753A (en) 2015-06-24 2015-06-24 The detection reagent that Pygo2 genes R46S is mutated in Wnt signal paths based on peptide nucleic acid probe

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201510355314.8A Division CN104911268B (en) 2015-06-24 2015-06-24 Detection reagent, PCR detection method and the application of Pygo2 gene mutation in Wnt signal path based on peptide nucleic acid probe

Publications (1)

Publication Number Publication Date
CN107739753A true CN107739753A (en) 2018-02-27

Family

ID=54080708

Family Applications (3)

Application Number Title Priority Date Filing Date
CN201711188137.4A Pending CN107739753A (en) 2015-06-24 2015-06-24 The detection reagent that Pygo2 genes R46S is mutated in Wnt signal paths based on peptide nucleic acid probe
CN201711188148.2A Active CN107746883B (en) 2015-06-24 2015-06-24 Peptide nucleic acid probe-based detection reagent for R356P mutation of Pygo2 gene in Wnt signal pathway
CN201510355314.8A Active CN104911268B (en) 2015-06-24 2015-06-24 Detection reagent, PCR detection method and the application of Pygo2 gene mutation in Wnt signal path based on peptide nucleic acid probe

Family Applications After (2)

Application Number Title Priority Date Filing Date
CN201711188148.2A Active CN107746883B (en) 2015-06-24 2015-06-24 Peptide nucleic acid probe-based detection reagent for R356P mutation of Pygo2 gene in Wnt signal pathway
CN201510355314.8A Active CN104911268B (en) 2015-06-24 2015-06-24 Detection reagent, PCR detection method and the application of Pygo2 gene mutation in Wnt signal path based on peptide nucleic acid probe

Country Status (1)

Country Link
CN (3) CN107739753A (en)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105821127A (en) * 2016-04-22 2016-08-03 湖北工业大学 Adenomatous polyposis coli protein APC gene mutation detection reagent and application thereof
CN105713986A (en) * 2016-04-25 2016-06-29 湖北工业大学 Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application
CN105838796A (en) * 2016-04-28 2016-08-10 湖北工业大学 AXIN2 gene mutation detection reagent and application
CN106319068A (en) * 2016-09-28 2017-01-11 湖北工业大学 Reagent for Chibby homologue 1 gene mutation detection and application
CN106244715A (en) * 2016-09-28 2016-12-21 湖北工业大学 The reagent of a kind of β catenin interaction protein 1 gene abrupt climatic change and application
CN106367517A (en) * 2016-09-28 2017-02-01 湖北工业大学 Low-density lipoprotein receptor-related protein 5 (LRP5) gene mutation detection reagents and application thereof
CN106367518A (en) * 2016-09-28 2017-02-01 湖北工业大学 Reagent for detecting gene mutation of Ras related C3 butulinum toxins 1 and application
KR101737313B1 (en) * 2016-10-12 2017-05-18 대한민국 Genetic Marker for Detecting Infectious Myonecrosis Virus, and Method for Detecting Infectious Myonecrosis Virus Using the Same
CN106676194B (en) * 2017-03-06 2020-04-10 湖北工业大学 Kit for detecting Pygo2 gene mutation site

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015068957A1 (en) * 2013-11-11 2015-05-14 Panagene Inc. Method for the detection of multiple target nucleic acids using clamping probes and detection probes

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPR142500A0 (en) * 2000-11-13 2000-12-07 Human Genetic Signatures Pty Ltd A peptide nucleic acid-based assay for the detection of specific nucleic acid sequences
CN101423866A (en) * 2007-10-31 2009-05-06 上海长海医院 PNA, probe, primer and method for detecting K-ras gene mutation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015068957A1 (en) * 2013-11-11 2015-05-14 Panagene Inc. Method for the detection of multiple target nucleic acids using clamping probes and detection probes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ENSEMBL: "COSM1295153", 《ENSEMBL》 *
葛少钦等: "特发性少精子症和无精子症与Pygo2基因蛋白编码区SNPs的相关性", 《遗传》 *

Also Published As

Publication number Publication date
CN104911268B (en) 2019-04-02
CN107746883B (en) 2021-03-23
CN107746883A (en) 2018-03-02
CN104911268A (en) 2015-09-16

Similar Documents

Publication Publication Date Title
CN104911268B (en) Detection reagent, PCR detection method and the application of Pygo2 gene mutation in Wnt signal path based on peptide nucleic acid probe
CN106995858A (en) A kind of lncRNA related to liver cancer diagnosis and treatment
CN107881241A (en) Application of the gene marker in breast cancer diagnosis and treatment
CN105838796A (en) AXIN2 gene mutation detection reagent and application
CN105821127A (en) Adenomatous polyposis coli protein APC gene mutation detection reagent and application thereof
US20090258928A1 (en) Methods and compositions for diagnosing and modulating human papillomavirus (hpv)
CN101070538A (en) Human epiterm growth-factor receptor mutation gene and use thereof
CN107828871A (en) The detection reagent that FoxM1 genes P271Q is mutated in Wnt signal paths based on peptide nucleic acid probe
CN107893106A (en) The detection reagent that the gene T365I of Bcl 9 are mutated in Wnt signal paths based on peptide nucleic acid probe
CN104911271A (en) Detection reagent based on Pygo2 and FoxM1 gene expression in Wnt signal pathways of peptide nucleic acid probes, PCR detection method and application of detection reagent
CN105950720A (en) Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent
CN106244715A (en) The reagent of a kind of β catenin interaction protein 1 gene abrupt climatic change and application
CN105713986A (en) Reagent used for detecting glycogen synthase kinase 3beta (GSK3beta) gene mutation and application
CN107267616A (en) A kind of application of Noncoding gene biomarker in liver cancer
JP2010068797A (en) Method for distinguishing biotype in bemisia tabaci
CN104774966B (en) Adenocarcinoma of lung miRNA labels
CN105713985B (en) A kind of reagent and application for plug transcription factor O1 detection in Gene Mutation
CN108192977A (en) A kind of and relevant molecular marker of gastric cancer occurrence and development
CN114517204B (en) CircPOLK for tumor treatment target and diagnosis biomarker and application thereof
CN105695619A (en) Casein kinase-1 gene mutation detection reagent based on peptide nucleic acid probes and application
CN105441405A (en) A BMX spliceosome and applications thereof in lung cancer drug resistance
US8664191B2 (en) Use of two microRNA moleculars in lung cancer prognosis and medicine preparation
CN110241224B (en) Use of lncRNA-T065925, kit for diagnosing colorectal cancer and medicament for treating colorectal cancer
CN106282378A (en) A kind of reagent for cyclin-depended kinase 8 detection in Gene Mutation and application
CN106222296A (en) The reagent of a kind of LDH receptor related protein 6 detection in Gene Mutation and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180227