CN106676194B

CN106676194B - Kit for detecting Pygo2 gene mutation site

Info

Publication number: CN106676194B
Application number: CN201710129373.2A
Authority: CN
Inventors: 秦文英; 唐景峰; 周策凡; 张毅; 李舜尧; 何文早; 陈兴珍; 胡婷
Original assignee: Hubei University of Technology
Current assignee: Hubei University of Technology
Priority date: 2017-03-06
Filing date: 2017-03-06
Publication date: 2020-04-10
Anticipated expiration: 2037-03-06
Also published as: CN106676194A

Abstract

The invention provides a kit for detecting R46S mutation of Pygo2 gene based on an ARMS-qPCR method, belonging to the field of biotechnology and medicine. The detection kit comprises R46S mutation detection reaction liquid, wherein the reaction liquid comprises a primer, a fluorescent probe, dNTP and PCR buffer solution, and the primer comprises a pair of outer primers and an inner primer for distinguishing mutation. The detection kit for the Pygo2 gene mutation ARMS-qPCR provided by the invention is based on RT-PCR technology and ARMS-PCR technology, has high specificity, rapid and simple operation and high sensitivity, and simultaneously, a pair of external primers in the kit can ensure the high efficiency and the reference of the reaction.

Description

Kit for detecting Pygo2 gene mutation site

Technical Field

The invention relates to the field of biotechnology and medicine, in particular to a kit for detecting a Pygo2 gene mutation site.

Background

The Wnt signal pathway comprises a classical Wnt signal pathway and a non-classical Wnt signal pathway, wherein in the classical pathway, namely the Wnt- β -catenin signal pathway, the Wnt factor inhibits the phosphorylation and degradation of free β -catenin protein in cells by activating a Frizzle/LRP5/6 synergistic receptor on cell membranes, the Wnt factor translocates nuclei of β -catenin protein after the protein level of β -catenin in cytoplasm is increased, so that β -catenin protein in nuclei is increased, and β -catenin protein in nuclei can jointly form a transcription target gene complex with Pygo2, Bcl-9 and LExM 1 protein and a TCF/1 protein together, and activate a target gene of a transcription factor family.

Pygo2 protein is one of the important downstream members of β -catenin in the Wnt signal pathway, and more researches have found that the Pygo2 protein is highly expressed in many tumors.

The current research on the core molecule control mechanism of the core signal channel and the expression level of some important members in cells has become a key means for treating tumors. In recent years, the research on the Wnt signaling pathway in cancer and the research on the expression level of Pygo2 protein as an important member of the Wnt signaling pathway have become important problems to be solved urgently in the research and development of tumor drugs. Meanwhile, various gene mutations existing in various tumor cells are increasingly discovered, and particularly, mutations occurring at the NHD terminal and the PHD terminal of the Pygo2 protein play a very important role in the function of the Pygo2 protein, for example, the NHD terminal R46S mutation is detected in bladder cancer cells.

The currently widely used gene mutation detection methods are restriction fragment length polymorphism analysis (RFLP method), direct DNA sequencing and the like. The RFLP method is a method in which PCR is combined with restriction enzyme cleavage. However, this method has the following disadvantages: RFLP experiment operation is tedious, detection cycle is long, cost is high, false positive caused by incomplete enzyme digestion in the first round exists, non-closed tube operation is easy to pollute, and clinical detection requirements are difficult to meet. The principle of direct sequencing of DNA is: the method has the following defects of long detection period, high cost, non-closed tube operation, difficult avoidance of cross contamination and low flux. The sensitivity of direct DNA sequencing is low, and the problems of heterozygosity mutation, gel compression, existence of a GC enrichment region and the like make it difficult to obtain accurate data through one-time sequencing, and false positive and the like can be avoided only by repeatedly sequencing for many times, so that the direct sequencing method is difficult to be applied to clinical detection.

And the clinical urgent need is to develop a kit for detecting Pygo2 gene mutation, which is rapid, accurate, simple and convenient to operate and avoids cross contamination, and meets the timeliness requirements in clinical medication and detection diagnosis.

The Taqman probe is a fluorescence detection technology developed on a Real-time PCR technology platform, the 5 'end of the probe contains a fluorescence reporter group, and the 3' end of the probe contains a fluorescence quenching group. When the probe is complete, the fluorescent signal emitted by the reporter group is absorbed by the quenching group, and when PCR amplification is carried out, the exonuclease activity from the 5 'end to the 3' end of Taq DNA polymerase enzyme cuts and degrades the probe, so that the reporter group and the quenching group are separated, and the fluorescent signal is emitted, thereby achieving the complete synchronization of the accumulation of the fluorescent signal and the formation of a PCR product.

ARMS (Amplification recovery Mutation System), a Chinese full-name Amplification hindered Mutation System, also called an Allele Specific Amplification method (ASA), was established in 1989 and is an application method of directional detection point Mutation based on PCR technology. ARMS is one of the detection methods for known mutant genes. The detection principle is that the characteristic that DNA polymerase-Taq enzyme commonly used in laboratories lacks exonuclease activity from 3' end to 5' end is utilized, a primer designed for a mutant base causes inhibition of amplification reaction due to mismatching, when the inhibition effect reaches a certain degree, extension of the 3' end is inhibited, the reaction cannot be continued, and therefore if a template does not contain a mutant target sequence, a target band cannot be detected in an amplification product.

The Taqman-ARMS technology is based on a Real-time PCR platform and combines two technologies of ARMS mutation enrichment and Taqman specific fluorescence detection. The ARMS primer is used for carrying out PCR amplification on the mutation target sequence, the Taqman probe carries out specific site detection on the amplification product, and the specific mutation is identified on the basis of Real-timePCR.

Disclosure of Invention

In view of the above, an object of the present invention is to provide a kit for detecting Pygo2 gene mutation site, which is fast, accurate, simple and convenient to operate and capable of preventing contamination, and solves the problems of complicated gene mutation detection procedure, high cost, time consuming, easy contamination, low sensitivity and the like in the prior art, and particularly provides non-invasive detection such as serum or plasma detection outside pathological tissues.

In order to achieve the purpose, the technical scheme of the invention is as follows:

a kit for detecting a Pygo2 gene mutation site, which comprises an ARMS primer pair for detecting the Pygo2 gene R46S mutation site and a Taqman probe for specifically recognizing R46S mutation; the ARMS primer pair consists of SEQ ID No: 1 and the upstream primer shown in SEQ ID No: 2 is shown in the specification; the nucleotide sequence of the Taqman probe is shown as SEQID No: 3, the fluorescent reporter group at the 5' end is: FAM, and BHQ is a quenching group at the 3' end.

The specific position of the Pygo2 gene R46S mutation site in the Pygo2 gene is codon 46, the base change is AGC > AGG, SEQ ID No: 1. 2 are called inner primer pairs.

Preferably, the kit further comprises a detection primer pair of the DNA quality control site and a Taqman probe for identifying the obtained amplicon, wherein the primer pair consists of SEQ ID No: 4 and the upstream primer shown in SEQ ID No: 5, and the nucleotide sequence of the Taqman probe is shown as SEQ ID No: 6, the fluorescent reporter group at the 5' end is as follows: and the quenching group at the 3' end of the HEX is BHQ.

SEQ ID No: 4. 5 is called an outer primer pair, the region amplified by the outer primer pair is a region fragment containing the R46S mutation site in the Pygo2 gene, and the sequence of the region fragment is shown as SEQ ID No: shown at 7.

More preferably, the kit comprises PCR buffer solution, dNTPs, primer pairs, Taqman probes and MgCl₂TaqDNA polymerase and template DNA, and the final concentration of each component in the reaction is as follows:

more preferably, the reaction conditions of the kit are: reverse transcription at 42 ℃ for 20 min; pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s; at 58 ℃ for 30 s; 40 cycles were performed.

More preferably, after the PCR reaction is completed by using the kit, if the amplification curves of the sample outer primer and the sample inner primer are S-shaped and have Ct values, and the delta Ct value is less than 7, the mutation can be judged; if the sample outer primer amplification curve is S-shaped, the inner primer amplification curve is straight and straight, and the sample can be judged to be negative; if the sample outer primer amplification curve is straight, the inner primer is S-shaped in the European increment, and the sample can be judged to be false positive.

More preferably, the kit also comprises two positive controls, wherein the positive controls are a plasmid containing an outer primer amplification region and a plasmid containing a region segment of the R46S mutation site of the Pygo2 gene.

More preferably, the kit further comprises a negative control, which is sterilized normal saline.

Compared with the prior art, the invention has the following advantages:

according to the kit disclosed by the invention, the ARMS specific mutation enrichment technology is combined with the Taqman probe specific detection technology, and the genotype of a sample can be judged without sequencing; the kit has high sensitivity which can reach 1% at most, good specificity and high precision, the detection success rate is 100%, and a plurality of samples can be detected to realize high-throughput detection; the detection sensitivity is high, and the detection range is wide; multiple uncovering is not needed, cross contamination is avoided, all detection reactions can be completed within 1 hour, and the detection result is easy to judge; the kit can detect DNA from peripheral blood; and providing guidance for personalized medicine application of the tumor according to the detection result of the kit.

Drawings

FIG. 1 is a graph showing the amplification curve of the R46S mutant ARMS-qPCR kit for Pygo2 gene of the invention in wild-type human DNA assay;

FIG. 2 is a graph showing the amplification of a human DNA assay containing a 1% Pygo2 mutation using the Pygo2 gene R46S mutant ARMS-qPCR kit of the present invention;

1 is the outer primer amplification curve, and 2 is the inner primer amplification curve.

FIG. 3 is a graph showing the amplification curve of the positive sample DNA test by the Pygo2 gene R46S mutant ARMS-qPCR kit of the present invention;

1. 3 is the curve amplified by the positive sample outer primer pair and the inner primer pair respectively, and 2 is the curve amplified by the positive plasmid;

Detailed Description

The features and advantages of the present invention will be further understood from the following detailed description taken in conjunction with the accompanying drawings. The examples provided are merely illustrative of the method of the present invention and do not limit the remainder of the disclosure in any way.

PCR buffer solution, dNTPs, TaqDNA polymerase and MgCl used by the invention₂Are purchased from Shanghai Ling Lang Biotech, Inc., cat # T1102, wherein the probes and primers were synthesized by Shanghai Kangkang Biotech, Inc.

[ example 1 ] primer Probe design

According to the hPygo2mRNA Sequence (NCBIReference Sequence: NM-138300.3) reported by the National Center for Biotechnology information, NCBI (http:// www.ncbi.nlm.nih.gov), the specific Pygo2 primers and probes were designed using PrimerExpress Software for Real-Time PCR Software developed by Applied Biosystems, and the present invention introduced a second mismatched base at the 3 rd to the 3 rd position from the 3' end of the upstream primer to increase the specificity of mutation detection.

Detection of mutant sequence fluorescent probes: 5'FAM-AGCGAAGGAAGTCAAATACTC-BHQ3'

Detection of the upstream primer of the mutated sequence: 5'-GTCCAGAAAGAAGCGATGC-3'

Detecting a downstream primer of a mutation sequence: 5'-CTCCACCTCCAGTGCTGAG-3'

Sequence fluorescent probe 5' HEX-AGCGAAGGAAGTCAAATACTC-BHQ3' is amplified by outer primer '

Outer primer upstream primer: 5'-GCAAGGCCGGTCTGCAAATG-3'

Outer primer downstream primer: 5'-CCATTGGATTGGGAGGGAAG-3'

The sequence of the outer primer is amplified:

gcaaggccggtctgcaaatgaagagtccagaaaagaagcgaaggaagtcaaatactcagggccctgcatactcacatctgacggagtttgcaccacccccaactcccatggtggatcacctggttgcatccaacccttttgaagatgacttcggagcccccaaagtgggggttgcagcccctccattccttggcagtcctgtgcccttcggaggcttccgtgtgcaggggggcatggcgggccaggtacccccaggctacagcactggaggtggagggggcccccagccactccgtcgacagccaccccccttccctcccaatcctatgg

in the embodiment of the invention, the fluorescent reporter group at the 5' end of the modified fluorescent probe is as follows: FAM, HEX; the quenching group for modifying the 3' end of the fluorescent probe is as follows: BHQ, the fluorescent reporter group and the quenching group do not influence the amplification of the fluorescent quantitative PCR, and the detectable fluorescent signal range is set only by selecting the type of the used instrument according to the fluorescent reporter group and the quenching group of the probe. Wherein the excitation wavelengths of FAM and HEX are 470-650 nm. The receiving wavelength is 500-700 nm; the purification mode after primer synthesis is as follows: HAP, PAGE and HPLC purification formats.

Example 2 specific detection with Pygo2 Gene R46S mutation detection kit

Constructing a positive quality control product in a Pygo2 gene R46S mutation detection kit, in particular to a positive control product of R46S mutation in the kit, which is used as a reference product in the detection of the kit.

The positive control is obtained by the following steps:

screening corresponding R46S mutant DNA or artificially synthesizing corresponding R46S mutant DNA, cloning into pGM-T vector to construct recombinant plasmid, then respectively transforming the recombinant plasmid into Escherichia coli DH5 α, determining the recombinant plasmid through sequencing, extracting the recombinant plasmid, purifying and diluting to obtain a positive control product for later use.

And (3) mixing the diluted positive control with wild type genome DNA in different proportions to obtain a wild type sample (not containing the positive control) and a 1% mutant sample (the proportion of the template of the positive control to the template of the wild sample is 1:100, the content of the wild type DNA is 45 ng/reaction), mixing to enable the OD260/OD280 of the sample to be between 1.8 and 2.0, and preparing the positive mutant sample for later use.

The results are shown in the figure 1-2, and due to the adoption of the probe and the upstream and downstream primers, 100% detection of 1% mutant Pygo2 gene can be realized in the background of 45 ng/wild type DNA of reaction, and zero detection of the wild type Pygo2 gene can be realized, so that the kit disclosed by the invention has good specificity and extremely strong anti-interference capability, and the false positive is greatly reduced.

Example 3 extraction of DNA from blood sample Gene

1) To each well of the 96-well plate, 20. mu.L of proteinase K and 200. mu.L of anticoagulated whole blood were added to the 96-well plate.

2) Add 200. mu.L Buffer BL, take care not to wet the edge of each well, seal each well with a 96-well silica gel pad, and mix vigorously for 30 s.

3) The solution on the silica gel sheet of the 96 round hole was centrifuged briefly at 3000rpm into the 96 round hole plate. Starting the centrifuge, stopping when the speed reaches 3000rpm, and carrying out warm bath in an incubator or an oven at 70 ℃ for at least 10 min.

The solution on the silica gel sheet of the 96 round hole was centrifuged briefly at 3000rpm into the 96 round hole plate. Starting the centrifuge, stopping when the speed reaches 3000rpm, taking off a 96-round silica gel sheet, and adding 200 μ L ethanol (96-100%) into each hole.

Sealing each hole with 96 round hole silica gel sheet, mixing uniformly for 15 s. The solution on the 96 round hole silica gel sheet was centrifuged briefly at 3000rpm into a round well plate. The centrifuge was started and stopped when the speed reached 3000 rpm.

The 96-well DNA plate was placed in a clean 96-well 1.6ml deep well plate. The 96 round hole silica gel sheet on the round hole plate is taken down, the solution in each hole is transferred to the 96-hole DNA plate, and the solution is centrifuged at 6000rpm for 4 min.

The filtrate from the 96-well 1.6ml deep-well plate was discarded, the 96-well DNA plate was returned to the 96-well 1.6ml deep-well plate, 500. mu.L of Buffer W1B was added to each well, the 96-well DNA plate was sealed with a new BF-400 membrane, and centrifuged at 6000rpm for 4 min.

The filtrate from the 96-well 1.6ml deep-well plate was discarded, the 96-well DNA plate was returned to the 96-well 1.6ml deep-well plate, 850. mu.L Buffer W2 was added to each well, the 96-well DNA plate was sealed with another new BF-400 membrane, and centrifuged at 6000rpm for 4 min.

The filtrate was discarded, and the 96-well DNA plate was returned to a 1.6ml deep well 96-well plate, 400. mu.L of Buffer W2 was added to each well, and the 96-well DNA plate was sealed with another new BF-400 membrane and centrifuged at 6000rpm for 4 min.

The 96-well DNA plate was placed on a clean 96-well 1.6ml deep-well plate, the 96-well DNA plate was sealed with a BF-400 membrane, and centrifuged at 6000rpm for 15 min.

The 96-well DNA plate is placed on another clean 96-well 1.6ml deep-well plate, 100. mu.L of Eluent B or deionized water is added into each well, the mixture is kept stand at room temperature for 2min, the 96-well DNA plate is sealed by another new BF-400 membrane, and the DNA is obtained by centrifugation at 6000rpm for 4 min.

After DNA extraction, 2. mu.l of the sample was sampled, and the quality of the genomic DNA was checked by 1% agarose gel electrophoresis, and the purity and concentration were checked by an ultraviolet spectrophotometer, and the final concentration was adjusted to 30 ng/. mu.L with sterilized purified water.

Example 4 detection of blood samples by Pygo2 Gene R46S mutation detection kit

1. Reagent configuration

Taking 5 mu L of extracted blood sample DNA, negative control and positive control, and adding PCR reaction liquid, wherein the PCR reaction liquid comprises: sterile water, DNA polymerase with 5'→ 3' exo-activity, dNTPs, 10 XPCR Buffer, and a Mg ion-containing solution. Wherein, the DNA polymerase with 5'→ 3' exo activity with the concentration of 5U/muL 1 muL, the dNTPs with the concentration of 0.4 mmol/L0.8 muL, 10 XPCR Buffer 5 muL, MgCl with the concentration of 4mmol/L₂mu.L of primers with a final concentration of 200nM, 1. mu.L of probes, 0.5. mu.L of probes, and 27.7. mu.L of sterilized purified water.

2. And (3) PCR amplification:

putting each reaction into a reaction tank of a fluorescent quantitative PCR instrument, and setting and marking the type, sample and type of the fluorescent gene

Fluorescence detection channel selection: selecting a FAM channel (Reporter: FAM, Quencher: None); HEX (Reporter: HEX, Quencher: None) was selected for the outer primer amplification. Reference fluorescence (Passive Reference) was set as ROX

And (3) amplification procedure: reverse transcription at 42 ℃ for 20 min; pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s; at 58 ℃ for 30 s; 40 cycles were performed.

3. Data analysis

After the reaction is finished, the instrument automatically stores the result, the software carried by the instrument is used for automatic analysis, and the Ct value and the result of the sample are recorded. Where the Ct value is the number of cycles corresponding to the inflection point from baseline to exponential increase. The instrument software can judge the detection result according to the Ct value of each sample. If the sample outer primer and inner primer amplification curves are S-shaped and have Ct values, the delta Ct is Ct (outer primer pair) -Ct (inner primer pair), and the delta Ct value is less than 7, the mutation can be judged; if the sample outer primer amplification curve is S-shaped, the inner primer amplification curve is straight and straight, and the sample can be judged to be negative; if the sample outer primer amplification curve is straight, the inner primer amplification is S-shaped, and the sample can be judged to be false positive.

37 blood samples of patients with brain glioma are extracted, DNA in blood is extracted as a template, the kit is used for detection according to the embodiment, 10 blood samples of normal persons are extracted, and DNA in blood is extracted as a template. The detection results show that 36 glioma samples detected by the kit have positive results in 37 glioma patients, and the results of normal human samples are negative. Therefore, the detection of the R46S mutation of the Pygo2 gene can assist in diagnosing brain glioma, and the consistency rate is 97.30%. The amplification profile of the positive samples is shown in FIG. 3.

SEQUENCE LISTING

<110> Hubei university of industry

<120> kit for detecting Pygo2 gene mutation site

<160>7

<170>PatentIn version 3.3

<210>1

<211>19

<212>DNA

<213> Artificial sequence

<400>1

gtccagaaag aagcgatgc 19

<210>2

<211>19

<212>DNA

<213> Artificial sequence

<400>2

ctccacctcc agtgctgag 19

<210>3

<211>21

<212>DNA

<213> Artificial sequence

<400>3

agcgaaggaa gtcaaatact c 21

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

gcaaggccgg tctgcaaatg 20

<210>5

<211>20

<212>DNA

<213> Artificial sequence

<400>5

ccattggatt gggagggaag 20

<210>6

<211>21

<212>DNA

<213> Artificial sequence

<400>6

agcgaaggaa gtcaaatact c 21

<210>7

<211>330

<212>DNA

<213> fragment of R46S mutation of human Pygo2 gene

<400>7

gcaaggccgg tctgcaaatg aagagtccag aaaagaagcg aaggaagtca aatactcagg 60

gccctgcata ctcacatctg acggagtttg caccaccccc aactcccatg gtggatcacc 120

tggttgcatc caaccctttt gaagatgact tcggagcccc caaagtgggg gttgcagccc 180

ctccattcct tggcagtcct gtgcccttcg gaggcttccg tgtgcagggg ggcatggcgg 240

gccaggtacc cccaggctac agcactggag gtggaggggg cccccagcca ctccgtcgac 300

agccaccccc cttccctccc aatcctatgg 330

Claims

1. A kit for detecting a Pygo2 gene mutation site is characterized by comprising an ARMS primer pair for detecting the Pygo2 gene R46S mutation site and a Taqman probe for specifically recognizing the R46S mutation; the ARMS primer pair consists of SEQ ID No: 1 and the upstream primer shown in SEQ ID No: 2, wherein a second mismatched base is introduced at the last 3 site of the 3' end of the upstream primer, and the sequence shown in SEQ ID No: 1. 2 is called an inner primer pair; the nucleotide sequence of the Taqman probe is shown as SEQ ID No: 3, the fluorescent reporter group at the 5' end is: FAM, wherein the quenching group at the 3' end is BHQ; the kit also comprises a detection primer pair of the DNA quality control site and a Taqman probe for identifying the obtained amplicon, wherein the primer pair consists of SEQ ID No: 4 and the upstream primer shown in SEQ ID No: 5, SEQ ID No: 4. 5 is called an outer primer pair; the nucleotide sequence of the Taqman probe is shown as SEQ ID No: 6, the fluorescent reporter group at the 5' end is as follows: and the quenching group at the 3' end of the HEX is BHQ.

2. The kit for detecting a Pygo2 gene mutation site according to claim 1, wherein the kit further comprises PCR buffer, dNTPs, MgCl₂TaqDNA polymerase, and the final concentration of each component in the reaction is as follows:

3. the kit for detecting a Pygo2 gene mutation site according to claim 1 or 2, wherein after the reaction is completed, if the sample outer primer and inner primer amplification curve is S-shaped, the kit has a Ct value, and the kit can be determined as a mutation if the Ct value is less than 7; if the sample outer primer amplification curve is S-shaped, the inner primer amplification curve is straight and straight, and the sample can be judged to be negative; if the sample outer primer amplification curve is straight, the inner primer amplification is S-shaped, and the sample can be judged to be false positive.

4. The kit for detecting the mutation site of Pygo2 gene according to claim 1 or 2, wherein the kit further comprises two positive controls, the positive controls are a plasmid containing the amplification region of the outer primer pair and a plasmid containing a fragment of the region where the mutation site of Pygo2 gene R46S is amplified by the inner primer pair.

5. The kit for detecting a mutation site in Pygo2 gene according to claim 4, wherein the kit further comprises a negative control, and the negative control is sterilized normal saline.