CN112143815B - Nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 gene - Google Patents

Abstract

The application discloses a method for detecting a personFGFR2A nucleic acid composition of gene fusion mutation, a kit and a detection method. The nucleic acid composition comprisesFGFR2Primers and probes designed for 18 fusion mutation types of genes. The kit comprises, in addition to the above-described nucleic acid composition, DNA polymerase, PCR buffer, dNTPs and cations. The present application further provides a method of detectingFGFR2The gene fusion mutation method comprises the steps of firstly extracting RNA of a detection sample and carrying out reverse transcription to form cDNA, then carrying out real-time fluorescence PCR reaction by using the kit by taking the cDNA as a template, and finally judging whether the detection sample is positive or negative according to a Ct value. The application can simultaneously detect the specificityFGFR2The 18 fusion mutations of the gene have wide mutation site coverage range, reduce detection times, and have the advantages of high sensitivity, good repeatability, simple operation, high detection speed, easy interpretation of results and the like.

Description

Nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 gene

Technical Field

The application relates to the technical field of in-vitro molecular diagnosis, in particular to a nucleic acid composition, a kit and a detection method for detecting fusion mutation of human FGFR2 gene.

Background

Cholangiocarcinoma (CCA) is a highly heterogeneous malignancy originating from biliary epithelial cells, accounting for approximately 3% of all gastrointestinal malignancies, and is the second most common hepatobiliary malignancy following liver cancer. In China, the incidence and mortality of cholangiocarcinoma are rising year by year. Bile duct cancer is high in malignancy degree and fast in progression, radical surgery is the only effective cure method at present, but most patients (65%) lose the chance of surgical resection in the late stage during diagnosis, relapse is easy to occur after surgery, and prognosis is very poor. Gemcitabine in combination with cisplatin or other chemotherapies for patients with non-surgically resectable or metastatic CCAMedication is the standard protocol for first-line systemic treatment. However, most chemotherapy has large toxic and side effects, the chemotherapy effect varies greatly among patients, and the total 5-year survival rate of cholangiocarcinoma is still very low (about 10%). With the development of tumor molecular biology, targeted therapies are receiving much attention, fibroblast growth factor receptor 2 (fibroblast growth factor receptor 2,FGFR2) The gene is an important target for treating patients with bile duct cancer.

FGFR2The gene maps to human chromosome 10q26.13, consists of 18 exons (ENST 00000358487.10), is about 120 kb in length, and encodes a single-stranded transmembrane glycoprotein containing 821 amino acids. The FGFR2 protein has two subtypes of FGFR 2-IIIb mainly expressed in epithelial cells and FGFR 2-IIIc mainly expressed in interstitial cells. After Fibroblast Growth Factor (FGF) is combined with an FGFR2 receptor, FGFR2 is induced to be dimerized, intracellular Tyrosine Kinase (TK) autophosphorylation and receptor conformation change, and a series of downstream cascade signal paths including RAS-RAF-MAPK path, PI3K-AKT path, JAK-STAT path and PLC gamma-PKC path are activated, so that cell proliferation, differentiation, apoptosis, migration and the like are regulated and controlled. Abnormal activation of FGFR2 can promote excessive increase and differentiation of tumor cells, promote angiogenesis of tumor, and inhibit apoptosis of tumor cells. Therefore, abnormalities in the FGFR2 signaling pathway play a crucial role in the development of various malignancies.

FGFR2Genes andBICC1、AHCYL1、KIAA1598andTACC3after the genes are fused, the genes are continuously activatedFGFR2Tyrosine kinase domain and downstream signaling pathways, which in turn cause tumorigenesis. Clinical research shows that small molecule targeted medicine (such as Pemigatinib/pemitinib, Erdafitinib/erda tinib, Infgatinib/Infogratinib, Derazantinib/Delatinib, Futibatinib/TAS-120, etc.) can specifically act onFGFR2Mutation of gene fusion by inhibitionFGFR2Tyrosine kinase region activity, blocking the downstream signal transduction pathway and inhibiting tumor cell proliferation, thereby achieving the treatment effect. Thus, detectingFGFR2FusionThe mutation state is a precondition for guiding the administration of targeted drugs, and has important significance for improving the survival rate, prolonging the life cycle and improving the survival quality of patients with bile duct cancer.

The current methods for detecting fusion genes mainly include: karyotyping, Fluorescence In Situ Hybridization (FISH), real-time fluorescence PCR (RT-PCR), and Next Generation Sequencing (NGS). Compared with the chromosome karyotype analysis and fluorescence in situ hybridization technology, the sensitivity of real-time fluorescence quantitative PCR detection reaches 1%, and fusion genes can be detected more quickly and accurately, which is also an effective method for detecting the fusion genes recommended in the American National Comprehensive Cancer Network (NCCN) guide and expert consensus. Although the sensitivity of the second generation sequencing technology can reach 1%, the application of the second generation sequencing technology in the detection of fusion genes is limited due to high cost and long detection period. The multiplex fluorescence PCR can amplify a plurality of target genes simultaneously, has the advantages of saving time, reducing cost and improving efficiency, and is particularly suitable for projects with small sample amount and more detection targets. Therefore, the multiple fluorescence PCR method has greater application value in screening bile duct cancer fusion genes. However, currently there is no detectionFGFR2Kit and method for fusion gene mutation, especially not for simultaneous detectionFGFR2The actual requirements of clinical rapid detection cannot be met by various fusion mutations of the gene.

Disclosure of Invention

Aiming at the problem that the prior art can not adopt the real-time fluorescent quantitative PCR method for rapid detectionFGFR2The present application provides a method for detecting humanFGFR2A nucleic acid composition of gene fusion mutation, a kit and a detection method.

In a first aspect, the present application provides a method for detecting a personFGFR2The nucleic acid composition of gene fusion mutation is realized by adopting the following technical scheme:

for detecting peopleFGFR2A nucleic acid composition of gene fusion mutations comprising the following primer and probe sequences:

FB-M1 forward primer sequence SEQ ID NO. 1;

FB-M1 reverse primer sequence SEQ ID NO. 2;

FB-M2 reverse primer sequence SEQ ID NO. 3;

FB-M3 reverse primer sequence SEQ ID NO. 4;

FB-M4 reverse primer sequence SEQ ID NO. 5;

FB-M5 reverse primer sequence SEQ ID NO. 6;

FB-M6 reverse primer sequence SEQ ID NO. 7;

FB-M7 reverse primer sequence SEQ ID NO. 8;

FB-M8 reverse primer sequence SEQ ID NO. 9;

FB-M9 reverse primer sequence SEQ ID NO. 10;

FB-M10 reverse primer sequence SEQ ID NO. 11;

FB-M11 reverse primer sequence SEQ ID NO. 12;

FB-M12 reverse primer sequence SEQ ID NO. 13;

FB-M13 reverse primer sequence SEQ ID NO. 14;

FB-M14 reverse primer sequence SEQ ID NO. 15;

FB-M15 reverse primer sequence SEQ ID NO. 16;

FB-M16 reverse primer sequence SEQ ID NO. 17;

FB-M17 reverse primer sequence SEQ ID NO. 18;

FB-M18 reverse primer sequence SEQ ID NO. 19;

the probe sequence is SEQ ID NO.20, the 5 'end of the probe sequence is modified by a fluorescence reporter group, and the 3' end of the probe sequence is modified by a fluorescence quenching group.

By adopting the technical scheme, the application discloses the human wild type according to NCBIFGFR2Gene sequences and fusion partner gene sequencesFGFR2Splicing the gene and the fusion partner gene to obtain a fusion sequence, designing a plurality of pairs of specific primers and probes across fusion sites by using Oligo 7.0 primer design software, and specifically amplifying and fusing mutant genes so as to specifically indicate the specificity in the detected sampleFGFR2Presence of gene fusion mutation. More importantly, the present application is directed toFGFR2The design of primers and probes is carried out on 18 fusion mutation types of genes, and the coverage range of the fusion mutation types is very wideWidely covers most fusion mutation types, thereby achieving the purpose of simultaneously detecting a plurality of fusion mutations by carrying out PCR reaction once and reducingFGFR2The number of times of detection of gene fusion mutations. In addition, a fluorescence reporter group and a fluorescence quenching group are introduced to a probe sequence, and when the PCR reaction is not carried out, the fluorescence quenching group can quench the fluorescence reporter group, so that no fluorescence signal is generated; after PCR reaction, the 5' exonuclease activity of DNA polymerase can perform enzyme digestion on the probe, so that the fluorescent reporter group is separated from the fluorescent quenching group, the fluorescent reporter group can report a fluorescent signal and is monitored and collected by a monitoring system, and the fluorescent signal is increased in equal proportion along with the PCR reaction, so that whether the amplification of the target gene exists in the sample can be judged according to the existence of the fluorescent signal, and whether the amplification of the target gene exists in the sample is rapidly detectedFGFR2Gene fusion mutation.

Therefore, the primer probe combination can be used for simultaneously detecting at one timeFGFR2The 18 fusion mutations generated by the gene have good specificity, the detection times of the fusion of the gene mutation are reduced, the detection cost is reduced, and the time for obtaining the detection result is shortened.

Optionally, the nucleic acid composition further comprises primer and probe sequences of an internal reference gene:

GAPDH forward primer sequence SEQ ID NO. 21;

GAPDH reverse primer sequence SEQ ID NO. 22;

the GAPDH probe sequence SEQ ID NO.23, wherein the 5 'end of the probe sequence is modified by a fluorescence reporter group, and the 3' end of the probe sequence is modified by a fluorescence quenching group.

By adopting the technical scheme, the application aims atFGFR2A group of internal reference primers and internal reference probes are designed while primers and probes are designed for 18 fusion mutation sites of the gene, and errors in the experimental process can be effectively corrected by designing the internal reference primers and the internal reference probes, so that the accuracy of the experimental result is ensured, and a truly reliable experimental result is obtained.

Optionally, the 5 'end of the probe sequence is labeled with FAM fluorophore, and the 3' end of the probe sequence is labeled with BHQ1 fluorophore.

By adopting the technical scheme, the fluorescence reporter group of the kit selects an FAM fluorescent group, the fluorescence quenching group selects a BHQ1 fluorescent group, and after the PCR reaction is carried out, the fluorescence emitted by the FAM fluorescent group can be monitored, so that whether the target gene exists in the sample can be rapidly judged.

In a second aspect, the present application provides a method for detecting a personFGFR2The gene fusion mutation kit adopts the following technical scheme:

for detecting peopleFGFR2A kit for gene fusion mutation, comprising the nucleic acid composition.

Optionally, the kit further comprises a DNA polymerase, a PCR buffer, dNTPs and a cation.

Optionally, the DNA polymerase is Taq enzyme, and the cation is Mg²⁺。

By adopting the technical scheme, the kit comprises the nucleic acid composition, and Taq enzyme, PCR buffer solution, dNTPs and Mg which are necessary for real-time fluorescent quantitative PCR reaction²⁺. Wherein, the primer in the nucleic acid composition is used for initiating the PCR reaction, and the probe is used for realizing the quantitative analysis of the PCR reaction. The hot start Taq enzyme selected by the application can inhibit or minimize nonspecific DNA amplification in PCR reaction, and has short activation time and long activity time, and 5 '-3' polymerase activity and 3 '-5' exonuclease activity can be recovered in a short time. The PCR buffer solution can adjust the pH value of a system in the reaction process, maintain the acid-base stability, provide a good environment for catalytic reaction of Taq enzyme, and ensure the smooth proceeding of PCR amplification reaction. dNTPs are raw materials for PCR reaction, and can realize gene amplification under the action of Taq enzyme and primers. Mg (magnesium)²⁺Not only an activator of Taq enzyme beta subunit, but also chelating Taq enzyme to make Taq enzyme active, Mg²⁺Or activators of dNTPs to attract electrons to the oxygen on the gamma phosphate group of dNTPs, making polymerization easier to occur.

The kit realizes high-sensitivity specific detection through design and optimization of primers and continuous optimization of a reaction system, the detection sensitivity of a sample to be detected can reach 10 copies/. mu.L, the repeatability is good, repeated experiments are carried out on each copy, the difference of Ct values is less than 0.5 cycle, and the experimental result is stable and reliable. In addition, the reagent used by the kit is low in price, easy to purchase and low in production cost.

Optionally, the kit further comprises a PCR enhancer. Preferably, 5% dimethyl sulfoxide is selected as the PCR enhancer.

By adopting the technical scheme, the PCR enhancer is added into the real-time fluorescent quantitative PCR system, the PCR enhancer optimizes the fluorescent PCR reaction system, improves the activity of DNA polymerase, and increases the sensitivity and specificity of PCR reaction, thereby improving the content of PCR amplification products, greatly improving the detection of low-copy nucleic acid and reducing the error rate of reaction.

In a third aspect, the present application provides a method for detecting a personFGFR2The gene fusion mutation method adopts the following technical scheme:

for detecting peopleFGFR2A method of gene fusion mutagenesis comprising the steps of:

s1, extracting RNA of a detection sample, and carrying out reverse transcription on the RNA to obtain cDNA;

s2, taking the cDNA obtained in the step S1 as a template, and carrying out real-time fluorescence PCR amplification reaction by adopting the kit;

and S3, taking the cycle number Ct value required when the fluorescence signal reaches the set threshold value as the positive and negative judgment standard.

By adopting the technical scheme, the RNA of the detection sample is firstly extracted and is reversely transcribed into cDNA, then the real-time fluorescence PCR reaction is carried out by taking the cDNA as a template, and finally the negative and positive of the detection sample are judged according to the Ct value. The whole detection method has simple and convenient operation steps, can finish detection in only 90 minutes, greatly shortens the detection time, is easy to interpret the result, and fully meets the actual requirement of clinical rapid detection.

Optionally, in step S1, the detecting the sample includes fresh pathological tissue, frozen pathological section, paraffin-embedded tissue or section.

By adopting the technical scheme, the method and the device can detect the fresh pathological tissuesFGFR2The gene fusion mutation condition can also be used for detecting a detection sample in paraffin-embedded tissuesFGFR2The gene fusion mutation condition and wide application range.

Optionally, in step S3, the Ct value is greater than or equal to 30, and the detection sample is negative; the Ct value is less than 30, and the detection sample is positive.

By adopting the technical scheme, the fluorescence intensity in the reaction system is detected after the substrate is reacted, so that the fluorescence intensity in the detection sample is interpretedFGFR2The negative and positive of the gene fusion mutation, with a Ct value of more than or equal to 30, shows that the detection sample does not existFGFR2Gene fusion mutation; ct value less than 30 indicates the presence of the test sampleFGFR2Gene fusion mutation. The 30 is set as the critical point and is obtained through numerous sample detections, if the critical point for judging whether the number of the negative and positive samples is less than 30, excessive false negatives may occur, and especially under the condition that the copy number ratio in the samples is smaller, the experimental result is inaccurate; if the critical point for determining negative and positive is greater than 30, too many false positives may occur, which may also cause deviation of the experimental result.

In summary, the present application has the following beneficial effects:

1. the application constructs a multiple fluorescence PCR reaction system, and can simultaneously detect specificityFGFR2The 18 fusion mutations of the gene have wide mutation site coverage range, and a plurality of sites of a detection sample can be simultaneously detected by one reaction, so that the detection times are reduced, and the requirement of clinical rapid detection is met;

2. the real-time fluorescent quantitative PCR system has high sensitivity, and the detection sensitivity of a sample to be detected can reach 10 copies/mu L;

3. the real-time fluorescent quantitative PCR system has good repeatability and stable and reliable detection result, and provides reliable reference value for clinical medication;

4. in the present applicationFGFR2The detection method of the gene fusion mutation has high detection speed, and the detection process only needs 90 minutes, so that the detection amount of a sample in a period of time is increased;

5. in the present applicationFGFR2The detection method of the gene fusion mutation has wide detection sample range, and the fresh pathological tissues, the frozen pathological sections, the paraffin embedded tissues or the sections can obtain accurate and reliable experimental results;

6. in the present applicationFGFR2The detection method of the gene fusion mutation is simple and convenient to operate, the result is easy to interpret, and the clinical application range is wide.

Drawings

FIG. 1 is a graph showing the results of the effectiveness test of the kit of the present application;

FIG. 2 is a graph showing the results of the sensitivity test of the kit of the present application;

FIG. 3 is a diagram showing the results of repetitive detection by the kit of the present application;

FIG. 4 is a graph showing the detection results of a clinically positive sample by the kit of the present application;

FIG. 5 is a graph showing the results of detection of clinical negative samples by the kit of the present application.

Detailed Description

The present application will be described in further detail with reference to the following drawings and examples.

The PCR enhancers of the present application were purchased from sigma.

Preparation example

ComprisesFGFR2Preparation of Positive control plasmid for Gene fusion mutation

(1) Respectively contain 18 ofFGFR2The gene of the gene fusion mutation site is connected with pcDNA3.1 (+) plasmid to construct 18 plasmids containing the mutation sitesFGFR2A plasmid with gene fusion mutation. The 18 pieces containFGFR2The gene sequences of the gene fusion mutation sites are as follows (in the following sequences, the underlined part represents one gene, and the underlined part represents the other gene):

FGFR2(17)_BICC1(3) SEQ ID NO.24

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGATCATGGAGGAAACAA ATACGCAGATTGCTTGGCCATCAAAACTGAAGATCGGAGCCAAATCCAAGAAAGATCCCCATATTAAGGTTTCTGGA AAGAAAGAAGATGTTAAAGAAGCCAAGGAAATGATCATGTCTGTCTTAGACACAAAAAGCAATCGAGTCACACTGAA GATGGATGTTTCACATACAGAACATTCACATGTAATCGGCAAAGGTGGCAACAATATTAAAAAAGTGATGGAAGAAA CCGGATGCCATATCCACTTTCCAGATTCCAACAGGAATAACCAAGCAGAAAAAAGCAACCAGGTATCTATAGCGGGA CAACCAGCAGGAGTAGAATCTGCCCGAGTTAGAATTCGG

FGFR2(17)_BICC1(18) SEQ ID NO.25

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGGGCTCATCCATGTCCC TTTCACGGTCCAACAGTCGTGAGCACTTGGGAGGTGGAAGCGAATCTGATAACTGGAGAGACCGAAATGGAATTGGA CCTGGAAGTCATAGTGAATTTGCAGCTTCTATTGGCAGCCCTAAGCGTAAACAAAACAAATCAACGGAACACTATCT CAGCAGTAGCAATTACATGGACTGCATTTCCTCGCTGACAGGAAGCAATGGCTGTAACTTAAATAGCTCTTTCAAAG GTTCTGACCTCCCTGAGCTCTTCAGCAAACTGGGCCTGGGCAAATACACAGATGTTTTCCAGCAACAAGAGATCGAT CTTCAGACATTCCTCACTCTCACAGATCAGGATCTGAAGGAGCTGGGAATAACTACTTTTGGTGCCAGGAGGAAAAT GCTGCTTGCAATTTCAG

FGFR2(17)_AFF3(7) SEQ ID NO.26

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGGAGATGACCTGGCTTC CACCACTTTCTGCTATTCAAGCACCTGGCAAAGTGGAACCAACCAAATTTCCATTTCCAAATAAGGACTCTCAGCTT GTATCCTCTGGACACAATAATCCAAAGAAAGGTGATGCAGAGCCAGAGAGTCCAGACAGTGGCACATCGAATACATC AATGCTGGAAGATGACCTTAAGCTAAGCAGTGATGAAGAGGAGAATGAACAGCAGGCAGCTCAGAGAACGGCTCTCC GCGCTCTCTCTGACAG

FGFR2(17)_ARHGAP24(3) SEQ ID NO.27

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGGGTACTATTTTTCTGC CTGGAAATAAAGTTTCTGAGCATCCCTGCAATGAAGAGAACCCAGGGAAGTTCCTTTTTGAAGTAGTTCCAGGAGGC GATCGAGATCGGATGACAGCAAATCATGAAAGCTACCTCCTCATGGCAAGCACCCAGAATGATATGGAAGACTGGGT GAAGTCAATCCGCCGAGTCATATGGGGACCTTTCGGAGGAGGCATTTTTGGACAGAAACTGGAGGATACTGTTCGTT ATGAGAAGAGATATGGGAACCGTCTGGCTCCGATGTTGGTGGAGCAGTGCGTGGACTTTATCCGACAAAGGGGGCTG AAAGAAGAGGGTCTCTTTCGACTGCCAGGCCAGGCTAATCTTGTTAAGGAGCTCCAAGATGCCTTTGACTGTGGGGA GAAGCCATCATTTGACAGCAACACAGATGTACACACGGTGGCATCACTTCTTAAGCTGTACCTCCGAGAACTTCCAG AACCAGTTATTCCTTATGCGAAGTATGAAGATTTTTTGTCATGTGCCAAACTGCTCAGCAAGGAAGAGGAAGCA

FGFR2(17)_CASP7(3) SEQ ID NO.28

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGATGGCAGATGATCAGG GCTGTATTGAAGAGCAGGGGGTTGAGGATTCAGCAAATGAAGATTCAGTGGATGCTAAGCCAGACCGGTCCTCGTTT GTACCGTCCCTCTTCAGTAAGAAGAAGAAAAATGTCACCATGCGATCCATCAAGACCACCCGGGACCGAGTGCCTAC ATATCAGTACAACATGAATTTTGAAAAGCTGGGCAAATGCATCATAATAAACAACAAGAACTTTGATAAAGTGACAG GTATGGGCGTTCGAAACGGAACAGACAAAGATGCCGAGGCGCTCTTCAAGTGCTTCCGAAGCCTGGGTTTTGACGTG ATTGTCTATAATGACTGCTCTTGTGCCAAGATGCAAGATCTGCTTAAAAAAG

FGFR2(17)_CCAR2(4) SEQ ID NO.29

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGGGTGGGGAGAAACAGC GGGTCTTCACTGGTATTGTTACCAGCTTGCATGACTACTTTGGGGTTGTGGATGAAGAGGTCTTTTTTCAGCTAAGT GTGGTGAAGGGCCGTCTGCCCCAGCTGGGTGAGAAGGTGCTGGTGAAGGCTGCATACAACCCAGGCCAGGCAGTGCC CTGGAATGCTGTCAAGGTGCAAACGCTCTCCAACCAGCCCCTACTGAAGTCCCCAGCACCTCCTCTTCTGCATGTAG CAGCCCTGGGCCAGAAGCAAGGGATCCTGGGAGCTCAGCCTCAGTTGATCTTCCAGCCTCACCGGATTCCCCCACTC TTTCCTCAGAAGCCTCTGAGTCTCTTCCAAACATCCCACACACTTCACCTGAGCCACCTGAACAGATTTCCTGCCCG GGGCCCTCATGGACGGTTGGATCAGGGCCGAAG

FGFR2(17)_CCDC6(2) SEQ ID NO.30

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGCAAGCCAGGGCTGAGC AGGAAGAAGAATTCATTAGTAACACTTTATTCAAGAAAATTCAGGCTTTGCAGAAGGAGAAAGAAACCCTTGCTGTA AATTATGAGAAAGAAGAAGAATTCCTCACTAATGAGCTCTCCAGAAAATTGATGCAGTTGCAGCATGAGAAAGCCGA ACTAGAACAGCATCTTGAACAAGAGCAGGAATTTCAGGTCAACAAACTGATGAAGAAAATTAAAAAACTGGAGAATG ACACCATTTCTAAGCAACTTACATTAGAACAGTTGAGACGGGAGAAGATTGACCTTGAAAATACATTGGAACAAGAA CAAGAAGCACTAGTTAATCGCCTCTGGAAAAGGATGGATAAGCTTGAAGCTGAAAAGCGAATCCTGCAGGAAAAATT AGACCAGCCCGTCTCTGCTCCACCATCGCCTAGAGATATCTCCATGGAGATTGATTCTCCAGAAAATATGATGCGTC ACATCAGGTTTTTAAAGAATGAAGTGGAACGGCTGAAGAAGCAACTGAGAGCTGCTCAGTTACAGC

FGFR2(17)_CGNL1(9) SEQ ID NO.31

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGAATGTCGAGGTCTTGG CGAGCAGGAGCAACACTTCAGAGCAAGACCAGGCGGGGACTGAAATGCGCGTGAAGCTTCTGCAGGAGGAGAATGAG AAGCTGCAGGGAAGAAGCGAAGAGCTGGAGCGGAGAGTTGCTCAGCTTCAAAGGCAGATCGAGGACCTGAAAGGCGA TGAAGCCAAGGCGAAGGAAACGCTGAAGAAGTACGAGGGAGAAATACGACAGTTAGAGGAGGCCCTTGTGCACGCCA GAAAGGAAGAAAAAGAAGCTGTGTCAGCCAGAAGGGCCCTGGAGAATGAACTGGAGGCTGCTCAGGGAAATCTGAGT CAGACTACCCAGGAGCAGAAGCAGTTGTCTGAGAAGCTCAAAGAGGAGAGTGAGCAGAAGGAGCAGCTAAGAAGGTT GAAGAACGAGATGGAGAATGAGCGGTGGCACCTGGGCAAAACCATTGAGAAACTGCAGAAGGAGATGGCAGACATTG TTGAGGCCTCCCGTACCTCAACCCTGGAGCTCCAGAACCAGCTGGATGAGTATAAGGAGAAAAACCGCAGGGAGCTC GCAGAAATGCAAAGACAGTTGAAGGAGAAAACGCTGGAGGCAGAAAAGTCCCGACTGACAGCCATGAAAATGCAGGA TGAG

FGFR2(17)_CTNNA3(14) SEQ ID NO.32

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGACCCCAGAGGAACTGG AGGATGTTTCTGACCTTGAAGAGGAACACGAGGTCCGCAGTCACACCAGCATTCAGACCGAAGGGAAAACTGATAGG GCTAAGATGACTCAACTGCCTGAGGCAGAAAAAGAAAAGATTGCTGAGCAAGTTGCTGATTTCAAGAAAGTAAAGAG TAAGCTGGATGCTGAGATTGAGATATGGGATGATACAAGCAACGACATCATTGTTCTGGCCAAGAACATGTGTATGA TCATGATGGAGATGACAGACTTCACTAGGGGCAAAGGACCACTAAAGCATACAACTGATGTGATCTATGCAGCGAAA ATGATATCAGAATCAGGATCAAGGATGGATGTCCTTGCTCGGCAGATTGCTAATCAGTGCCCAGATCCATCTTGTAA ACAGGACTTGTTGGCCTACCTGGAACAGATTAAGTTCTACTCCCACCAACTGAAAATCTGCAGTCAAGTTAAAGCTG AGATCCAGAACCTGGGAGGAGAGCTCATCATGTCAGCT

FGFR2(17)_DZANK1(9) SEQ ID NO.33

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGATGGGCTTGTGTGCAG AATGCAGAAGCTTGGTACCCATGAACACTCCCATCTGTGTGGTGTGTGAGGCCCCTCTTGCTCTACAGCTGCAGCCA CAGGCAAGCCTCCACTTGAAGGAGAAGGTAATTTGCCGGGCCTGTGGTACAGGAAATCCTGCTCACCTGAGATACTG TGTCACCTGTGAGGGGGCCCTGCCTTCATCACAAGAGTCGATGTGCAGTGGGGATAAAGCCCCTCCTCCGCCCACTC AGAAAGGGGGGACCATTTCCTGCTACAGATGTGGTCGCTGGAATCTCTGGGAGGCGTCCTTCTGCGGCTGGTGTGGA GCCATGCTCGGCATTCCTGCTGGCTGTTCTGTTTGCCCTAAATGTGGGGCCAGCAATCACCTGTCTGCCCGATTCTG TGGCTCCTGTGGTATTTGTGTGAAGTCCCTAGTGAAACTTAGCTTGGACAGAAGCCTGGCTCTAGCTGCTGAGGAAC CTCGCCCTTTTTCTGAG

FGFR2(17)_INA(2) SEQ ID NO.34

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGGATAGCATTGGGCAGC TGGAGAATGATCTGAGGAACACCAAGAGTGAGATGGCACGCCACCTTCGGGAATACCAGGACTTGCTCAATGTCAAA ATGGCTCTTGACATTGAGATAGCAGCTTACAGGAAACTGCTGGAAGGCGAGGAGACACGTTTTAGCACCAGTGGGTT AAGCATTTCGGGGCTGAATCCACTTCCCAATCCAAGTTACCTGCTCCCACCTAGAATCCTCAGTGCTACAACCTCCA AAGTCTCATCCACTGGGCTATCACTTAAGAAAGAGGAGGAGGAGGAGGAGGCATCTAAGGTAGCCTCTAAGAAAACC TCCCAGATAGGGGAAAGTTTTGAAGAAATATTAGAGGAGACAGTAATATCTACTAAGAAAACCGAGAAATCAAATAT AGAAGAAACCACCATTTCAAGCCAAAAAATATAATTCCATTGCTTTGAAAAAGTTAATGCTTAAGAGGGAATGATAT GCATTTG

FGFR2(17)_KIAA1598(8) SEQ ID NO.35

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGGTAAATAAAGTTAAAC AAGAAAAGACTGTTTTAAATTCAGAAGTTCTTGAACAGAGAAAAGTCTTAGAAAAATGCAATAGAGTGTCCATGTTA GCTGTAGAAGAGTATGAGGAGATGCAAGTAAACCTGGAGCTGGAGAAGGACCTTCGAAAGAAAGCAGAGTCATTTGC ACAAGAGATGTTCATTGAGCAAAACAAGCTAAAGAGACAAAGCCACCTTCTGCTGCAGAGCTCCATCCCTGATCAGC AGCTTTTGAAAGCTTTAGACGAAAATGCAAAACTCACCCAGCAACTTGAAGAAGAGAGAATTCAGCATCAACAAAAG GTCAAAGAATTAGAAGAGCAACTAGAAAATGAAACACTCCACAAAGAAATACACAACCTCAAACAGCAACTGGAGCT TCTAGAGGAAGATAAAAAGGAATTGGAATTGAAATATCAGAATTCTGAAGAGAAAGCCAGAAATTTAAAGCACTCTG

FGFR2(17)_OFD1(3) SEQ ID NO.36

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGACACAACTTCGAAACC AGCTAATTCATGAGTTGATGCACCCTGTATTGAGTGGAGAACTGCAGCCTCGGTCCATTTCAGTAGAAGGGAGCTCC CTCTTAATAGGCGCCTCTAACTCTTTAGTGGCAGATCACTTACAAAGATGTGGCTATGAATATTCACTTTCTGTTTT CTTTCCAGAAAGTGGTTTGGCAAAAGAAAAGGTATTTACTATGCAGGATCTATTACAACTCATTAAAATCAACCCTA CTTCCAGTCTCTACAAATCACTGGTTTCAGGATCTGATAAAGAAAATCAAAAAGGTTTTCTTATGCATTTTTTAAAA GAATTGGCAGAATATCATCAAGCTAAAGAGAGTTGTAATATGGAAACTCAGACAAGTTCGACATTTAACAGAGATTC TCTGG

FGFR2(17)_PPHLN1(4) SEQ ID NO.37

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGGATGGCTACAATAGAC TAGTTAATATTGTGCCAAAGAAACCACCACTGCTAGACAGACCTGGTGAAGGAAGCTACAATAGATATTACAGTCAT GTTGATTACCGAGACTATGACGAGGGCCGCAGTTTTTCTCATGATCGAAGAAGTGGTCCACCTCACAGAGGAGATGA ATCTGGTTATAGATGGACAAGAGACGATCATTCTGCAAGCAGGCAACCTGAATACAGGGACATGAGAGATGGCTTTA GAAGAAAAAGTTTCTACTCTTCCCATTATGCGAGAGAGCGGTCTCCTTATAAAAGGGACAATACTTTTTTCAGAGAA TCACCTGTTGGCCGAAAGGATTCTCCACACAGCAGATCTGGTTCCAGTGTCAGTAGCAGAAGCTACTCTCCAGAAAG GAGCAAATCATACTCTTTCCATCAGTCTCAACATAGAAAGTCCGTGCGTCCTGGTGCCTCCTACAAACGGCAGAATG AAGGAAATCCTGAAAGAG

FGFR2(17)_SLMAP(3) SEQ ID NO.38

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGTTTTATCTTCAAGACA CTAAAAGTAGTAATGGTACTTTTATAAATAGCCAGAGATTGAGTCGAGGCTCTGAAGAAAGTCCACCATGTGAAATT CTTTCCGGTGACATTATCCAGTTTGGAGTAGACGTGACAGAGAATACACGGAAAGTTACCCATGGGTGTATTGTTTC CACAATAAAACTTTTTCTACCAGATGGTATGGAAGCCCGGCTCCGCTCAGATGTCATCCATGCACCATTACCAAGTC CTGTTGACAAAGTTGCTGCTAACACTCCAAGTATGTACTCTCAGGAACTATTCCAGCTTTCTCAGTATCTACAG

FGFR2(17)_UBP1(6) SEQ ID NO.39

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGGTACACTGCATCAGCA CAGAATTTACTCCACGGAAGCACGGAGGTGAAAAGGGAGTGCCCTTTAGGATCCAGGTTGACACCTTTAAGCAGAAT GAAAATGGAGAATACACAGATCATCTACACTCAGCTAGCTGCCAAATCAAAGTTTTTAAGCCTAAAGGTGCAGACAG GAAACAAAAAACTGACCGAGAGAAGATGGAGAAGAGAACAGCTCATGAAAAAGAAAAGTATCAGCCGTCCTATGATA CCACAATCCTCACAGAGATGAGGCTTGAGCCTATAATTGAAGATGCAGTTGAACATGAGCAGAAAAAGTCCAGCAAG CGGACTTTGCCAGCAGACTACGGTGATTCTCTGGCAAAGCGAGGCAGTTGTTCTCCGTGGCCCGATGCCCCCACAGC CTATGTGAATAACAGCCCTTCCCCAGCGCCCACTTTCACCTCCCCACAGCAGAGCACTTGCAGTGTCCCAGACAG

FGFR2(17)_MYPN(6) SEQ ID NO.40

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGTGTCAGAGCCCCACCA ATTACTTGCAGGGATTGGATGGAAAACCTATCATTGCAGCTCCTGTGTTTACAAAGATGCTACAAAATTTGTCAGCT TCTGAGGGTCAGCTGGTTGTCTTTGAATGCAGAGTAAAAGGAGCTCCATCTCCTAAGGTTGAGTGGTATAGAGAAGG GACTTTAATAGAAGATTCTCCAGATTTTAGGATTTTACAGAAAAAACCTCGATCCATGGCAGAGCCAGAGGAGATTT GCACCTTGGTCATTGCTGAGGTGTTTGCAGAAGATTCTGGGTGCTTCACATGTACTGCAAGCAACAAATACGGCACA GTGTCAAGCATTGCACAGCTGCACGTGAGAG

FGFR2(17)_AHCYL1(2) SEQ ID NO.41

TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGCAAATCCAGTTTGCTG ATGACATGCAGGAGTTCACCAAATTCCCCACCAAAACTGGCCGAAGATCTTTGTCTCGCTCGATCTCACAGTCCTCC ACTGACAGCTACAGTTCAGCTGCATCCTACACAGATAGCTCTGATGATGAGGTTTCTCCCCGAGAGAAGCAGCAAAC CAACTCCAAGGGCAGCAGCAATTTCTGTGTGAAGAACATCAAGCAGGCAGAATTTGGACGCCGGGAGATTGAGATTG CAGAGCAAGACATGTCTGCTCTGATTTCACTCAGGAAACGTGCTCAGGGGGAGAAGCCCTTGGCTGGTGCTAAAATA GTGGGCTGTACACACATCACAGCCCAGACAGCGGTGTTGATTGAGACACTCTGTGCCCTGGGGGCTCAGTGCCGCTG GTCTGCTTGTAACATCTACTCAACTCAGAATGAAGTAGCTGCAGCACTGGCTGAGGCTG

(2) the constructed Plasmid is extracted by adopting a Plasmid extraction Kit of TIANGEN (high Plasmid Kit, DP 116), and the specific extraction operation steps are operated according to the Kit instruction.

(3) The quality-improved plasmid DNA is dissolved in Tris-HCl (10 mmol/L, pH 8.0), the quality of extraction is detected by an ultraviolet spectrophotometer and the concentration is determined, then 18 plasmid solutions are mixed in equal concentration, and the concentration of the plasmid DNA is adjusted to 2 ng/muL by using Tris-HCl (10 mmol/L, pH 8.0) solution.

Example 1

Design of synthetic primers and probes for mutation sites

People published according to NCBIFGFR2Gene sequences and fusion partner gene sequences (wild-type sequences) againstFGFR2The gene 18 fusion mutations are used to design specific primers and probes. And realizes high sensitivity and specific detection through the optimization of a specific primer and a probe system,FGFR2the 18 fusion mutation sites of the gene are shown in Table 1.

TABLE 1FGFR2Gene fusion detection site

Aiming at the selected 18 fusion mutation sites, Oligo 7.0 primer design software is used for designing a plurality of pairs of specific primers and probes, and the sequences of the primers and the probes are shown in Table 2.

The 5 'end of the probe sequence designed by the application is modified by a fluorescence reporter group, and the 3' end of the probe sequence is modified by a fluorescence quenching group. Preferably, the fluorescence reporter group of the target gene probe is FAM fluorescent group, and the fluorescence quenching group is BHQ1 fluorescent group; the fluorescent reporter group of the internal reference gene probe is a HEX fluorescent group, and the fluorescent quenching group is a BHQ1 fluorescent group.

TABLE 2FGFR2Gene fusion mutation primer and probe nucleotide sequence

The primers and probes of the present application were synthesized by general biosystems (Anhui) Inc.

In addition, the present application also provides with Table 2 primer probe sequence with the same nucleotide sequence, the "identical nucleotide sequence" refers to the strict conditions (maximum stringency conditions) and hybridization with the target oligonucleotide, and with appropriate nucleotide insertion or deletion under comparison, and with the table nucleotide fragments of at least about 60% of the same nucleotide sequence. More preferably, the nucleotide sequence has 80% identity, and most preferably, the nucleotide sequence has 90% identity.

Hybridization conditions are classified according to the degree of stringency of the conditions used in the hybridization, which is based on the melting temperature (Tm) of the nucleic acid binding complex or probe. For example, "maximum stringency" is Tm-5 ℃ (5 ℃ below the Tm of the probe); "higher stringency" occurs at about 5-10 ℃ below Tm; "moderate stringency" occurs at about 10-20 ℃ below Tm; low stringency occurs at about 20-25 ℃ below the Tm.

In this application, "identity" refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same when compared. The algorithms used to determine sequence identity and percent sequence similarity are according to the BLAST or BLAST2.0 algorithms, which are disclosed in the following references, respectively: altschul et al (1977) Nucl.acid.res.25: 3389-.

Example 2

For detecting peopleFGFR2The gene fusion mutation kit comprises the primer probe, Taq enzyme, 10 XPCR Buffer, dNTPs and MgCl in the embodiment 1₂And a PCR enhancer.

The final concentrations of the reagents in the above kit in the final reaction amplification system are shown in table 3:

TABLE 3 Final concentrations of the Components in the reaction amplification System

Specifically, taking a 25 μ L reaction system as an example, the specific addition amounts of the components in the above-mentioned kit are shown in table 4:

TABLE 4 real-time fluorescent quantitative PCR reaction System Components addition

The PCR reaction conditions using the above reaction system were as follows: pre-denaturation at 95 ℃ for 5min for 1 cycle; denaturation at 95 ℃ for 25 seconds, annealing at 64 ℃ for 20 seconds, extension at 72 ℃ for 20 seconds, 15 cycles; denaturation at 93 ℃ for 25 seconds, annealing at 60 ℃ for 35 seconds, extension at 72 ℃ for 20 seconds, 30 cycles. The final 30 cycles detected FAM and HEX fluorescence signals upon annealing.

Detection standard:

detecting the fluorescence intensity of FAM of the reaction system, and taking the cycle number Ct value required when the FAM reaches a set threshold value as a negative and positive judgment standard: ct value is greater than or equal to 30, the detection sample is negative, which indicates that the detection sample does not occurFGFR2Gene fusion mutation; ct value is less than 30, the detection sample is positive, which indicates the occurrence of the detection sampleFGFR2Gene fusion mutation.

Performance test

1. Example 2 detection of the effectiveness of the kit

The present application prepared in preparation example contains 18FGFR2The mixed solution of the gene fusion mutation plasmid is used as a positive control, and is added into the amplification system of the application example 2 to be used as a template for carrying out real-time fluorescent quantitative PCR reaction, and the specific method is as follows:

(1) adding 5 μ L of the mixed solution containing 18 plasmid DNAs obtained in the preparation example as a reaction template into a PCR reaction system, and performing real-time fluorescent quantitative PCR by using the amplification system and amplification conditions of example 2 by using 5 μ L of a water sample as a reaction template in a negative control group;

(2) detecting a fluorescence signal, and judging a standard according to a Ct value as a result:

adopting an ABI7500 real-time fluorescence PCR instrument for amplification, detecting fluorescence signals of FAM and HEX in the last 30 cycle annealing stages, and taking a cycle number Ct value required when the FAM reaches a set threshold value as a negative and positive judgment standard: the Ct value is more than or equal to 30, and the detection sample is negative; the Ct value is less than 30, and the detection sample is positive.

Referring to fig. 1, it can be seen from fig. 1 that, by using the amplification system and the reaction condition amplification positive control of example 2 of the present application, a fluorescence signal can be detected in the FAM channel, and the amplification curve shows a standard S-type, Ct value is less than 30, and Ct value of the negative control group is greater than or equal to 30. The experimental result shows that the kit can be used for detectingFGFR2The gene fusion is mutated, and the result is expected and effective.

2. Example 2 sensitive detection of the kit

The plasmid DNA with the concentration of 1000 copies/. mu.L after quantification is taken and diluted to obtain three concentrations of 100 copies/. mu.L, 10 copies/. mu.L and 5 copies/. mu.L, the plasmid DNA with the four concentrations is used as a PCR template, 5. mu.L is added in each reaction, and a negative control group carries out real-time fluorescence quantitative PCR by using a 5. mu.L water sample as a reaction template and adopting the amplification system and the amplification conditions of the embodiment 2.

Referring to fig. 2, it can be seen from fig. 2 that fluorescence signals can be detected in all the 4 concentrations in the FAM channel, the amplification curve shows a standard S-type, the Ct values are all less than 30, and the Ct values of the negative control group are all greater than or equal to 30. Experimental results show that the sensitivity of the kit can be stably maintained at 10 copies/mu L, the sensitivity is high, the incidence rate of false negative is effectively reduced, and a high reference value is provided for later-stage clinical medication. According to the method, 5 copies/. mu.L of positive reference substances are used as amplification templates, an amplification curve can be obtained, the Ct value is smaller than 30, the detection result is stable, but 5 copies/. mu.L of samples to be detected are used as amplification templates, and the detection result slightly floats, so that the amplification system of the embodiment 2 is used for detecting the samples to be detected, the concentration of the samples to be detected is as low as 10 copies/. mu.L, and the accurate detection result can be obtained.

3. Example 2 reproducible assay of the kit

The repeatability of the kit of example 2 was tested by performing real-time fluorescent quantitative PCR using 1000 copies/. mu.L, 100 copies/. mu.L and 10 copies/. mu.L of plasmid DNA as templates, and repeating each copy ten times using the amplification system and amplification conditions of example 2.

Referring to fig. 3, it can be seen from fig. 3 that, no matter the concentration of the DNA template is 1000 copies/μ L, 100 copies/μ L or 10 copies/μ L, the Ct values are all less than 0.5 cycle in 10 repeated experiments of each copy, and the experimental results show that the kit of the present application has good repeatability and stable and reliable experimental results.

4. EXAMPLE 2 clinical testing of the kit

30 clinical bile duct cancer paraffin embedded tissue samples are detected by using specific primers and probes of the kit and a fluorescent PCR reaction system in the embodiment 2 of the application, wherein the specific primers and probes comprise those determined by direct sequencing detectionFGFR2Fusion positive 7 cases andFGFR223 wild type samples, the specific detection steps are as follows:

(1) sample processing

1g of each bile duct cancer sample is taken, 1mL of dimethylbenzene is added into each bile duct cancer sample, vortex and shake are carried out for 10s, 16000g of the mixture is centrifuged for 2min at room temperature, supernate is discarded, 300 mu L of absolute ethyl alcohol is added into the mixture, and then the mixture is centrifuged, so that tissue sedimentation is facilitated. The supernatant was removed by suction, 1ml of absolute ethanol was added, vortexed for 10 seconds, and 16000g was centrifuged at room temperature for 2 min. The supernatant was aspirated, the sample cap opened and placed in a vacuum centrifuge concentrator, and the sample was dried in AQ mode for 10min at 30 ℃. After drying, the sample was carefully removed and the vial cap was closed.

(2) RNA extraction

The treated sample was subjected to RNA extraction using an RNA extraction Kit (QIAGEN RNeasy FFPE Kit (Cat number 73504)), and the specific steps were as follows:

adding 150 mu L of PKD buffer solution and 10 mu L of proteinase K into a centrifuge tube, shaking and uniformly mixing, incubating for 15min at 56 ℃, incubating for 15min at 80 ℃, centrifuging for a short time by using a palm centrifuge, and observing the digestion condition of a sample. Incubate on ice for 3min and centrifuge at room temperature 20000g for 15 min. After the temperature is reduced to room temperature, 16ul DNase Booster Buffer solution and 10 mu L DNaseI stock solution are added, the mixture is incubated for 15min at room temperature, 320 mu L Buffer RBC is added, and the mixture is uniformly mixed;

transfer all supernatants to a new 2ml centrifuge tube and add DNase Booster Buffer at 10% of the total sample volume. Then, 10 μ l of DNase I stock solution was added, the mixture was inverted and mixed, centrifuged for a short time, and incubated at room temperature for 15 min. Adding 320 mul of RBC buffer solution, fully and uniformly mixing, adding 1mL of absolute ethyl alcohol, sucking, uniformly mixing, and quickly entering the next step. Transferring 650 mul samples, including precipitates, to an adsorption column, centrifuging at 8000g at room temperature for 30s, and discarding the filtrate. Adding 500 mul of RPE buffer solution, centrifuging at 8000g at room temperature for 30s, and discarding the filtrate. The column was transferred to a new 2mL collection tube, uncapped, and centrifuged at 16000g for 5 min. The adsorption column was transferred to a new labeled 1.5ml centrifuge tube. Adding 20 mul of nuclease-free water, standing for 5min, centrifuging for 1min at 16000g, and collecting RNA.

If the detected sample is fresh pathological tissue, about 1g of sample is taken and RNA is extracted by using an RNA extraction kit of QIAGEN.

(3) Reverse transcription of RNA into cDNA

Dissolving the extracted RNA in 0.1% DEPC water, detecting the extraction quality by an ultraviolet spectrophotometer, and determining the concentration OD_260/OD₂₈₀1.9-2.1, and determining the content. Taking 0.1-5 mu g of RNA as a template for cDNA synthesis, and adopting a kit of Jiangsu Shenji Biotechnology limited company to synthesize cDNA, wherein the cDNA synthesis system is shown in a table 5:

TABLE 5 cDNA Synthesis System

The cDNA synthesis system is subjected to reverse transcription according to the following steps:

a) preparing a reaction system according to the adding amount of each component in the table 5, and fully and uniformly mixing;

b) keeping the temperature at 42 ℃ for 1 hour;

c) and keeping the temperature at 95 ℃ for 5 minutes, and cooling on ice to obtain a cDNA template.

(4) Using the prepared cDNA as a template, the amplification system and reaction conditions of example 2 were used to perform a real-time fluorescent PCR reaction for detectionFGFR2When the wild type sample is used, the sample containingFGFR2Plasmid with gene fusion mutationAs a positive control;

(5) detecting a fluorescence signal, and judging a standard according to a Ct value as a result:

adopting an ABI7500 real-time fluorescence PCR instrument for amplification, detecting fluorescence signals of FAM and HEX in the last 30 cycle annealing stages, and taking a cycle number Ct value required when the FAM reaches a set threshold value as a negative and positive judgment standard: the Ct value is more than or equal to 30, and the detection sample is negative; the Ct value is less than 30, and the detection sample is positive.

The results of the experiments are shown in FIGS. 4, 5 and Table 6, and 7 examples are shown in FIGS. 4 and 5FGFR2Fluorescence signals can be detected in the fusion positive sample in the FAM channel, and Ct values are all less than 30; 23 example(s)FGFR2The Ct values of the wild samples are all more than or equal to 30, and the positive control group can amplify a curve with the Ct value less than 30, which indicates that the experimental results are effective. The above test results showed that 7 of 30 bile duct cancer samples were detectedFGFR2The gene fusion mutation shows that the coincidence rate of the real-time fluorescent PCR method and the direct sequencing method is 100 percent, and further proves that the system detection is carried outFGFR2The effectiveness, accuracy and reliability of gene fusion mutations. In addition, as can be seen from table 6, the detection time of the kit in example 2 of the present application is 90min, while the detection time of the conventional sequencing method is 2-3 days, which indicates that the fluorescence quantitative PCR method of the present application can greatly shorten the detection time and better meet the clinical rapid detection standard.

TABLE 6 comparison of the test results of the present application with direct sequencing

The embodiments of the present invention are preferred embodiments of the present application, and the scope of protection of the present application is not limited by the embodiments, so: all equivalent changes made according to the structure, shape and principle of the present application shall be covered by the protection scope of the present application.

Sequence listing

<110> Jiangsu Shenji Biotech Co., Ltd

<120> nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 gene

<160> 41

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 1

tgatgaggga ctgttggcat g 21

<210> 2

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 2

atggccaagc aatctgcgta t 21

<210> 3

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 3

cccaagtgct cacgactgtt 20

<210> 4

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 4

tgccaggtgc ttgaatagca g 21

<210> 5

<211> 22

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 5

gttctcttca ttgcagggat gc 22

<210> 6

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 6

ctcaaccccc tgctcttcaa t 21

<210> 7

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 7

ataccagtga agacccgctg 20

<210> 8

<211> 22

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 8

ctccttctgc aaagcctgaa tt 22

<210> 9

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 9

ctgaagtgtt gctcctgctc 20

<210> 10

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 10

ggtctgaatg ctggtgtgac t 21

<210> 11

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 11

agcttctgca ttctgcacac 20

<210> 12

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 12

gtgccatctc actcttggtg t 21

<210> 13

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 13

gctccaggtt tacttgcatc t 21

<210> 14

<211> 22

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 14

ctccactcaa tacagggtgc at 22

<210> 15

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 15

cagtggtggt ttctttggca c 21

<210> 16

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 16

tcagagcctc gactcaatct c 21

<210> 17

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 17

ccgtgcttcc gtggagtaaa 20

<210> 18

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 18

tccatccaat ccctgcaagt 20

<210> 19

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 19

tggtggggaa tttggtgaac t 21

<210> 20

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 20

agttggtaga agacttggat c 21

<210> 21

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 21

atgggtgtga accatgagaa 20

<210> 22

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 22

agtgatggca tggactgtgg 20

<210> 23

<211> 25

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 23

cctcaagatc atcagcaatg cctcc 25

<210> 24

<211> 801

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 24

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagat catggaggaa acaaatacgc agattgcttg gccatcaaaa 480

ctgaagatcg gagccaaatc caagaaagat ccccatatta aggtttctgg aaagaaagaa 540

gatgttaaag aagccaagga aatgatcatg tctgtcttag acacaaaaag caatcgagtc 600

acactgaaga tggatgtttc acatacagaa cattcacatg taatcggcaa aggtggcaac 660

aatattaaaa aagtgatgga agaaaccgga tgccatatcc actttccaga ttccaacagg 720

aataaccaag cagaaaaaag caaccaggta tctatagcgg gacaaccagc aggagtagaa 780

tctgcccgag ttagaattcg g 801

<210> 25

<211> 856

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 25

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgaggg ctcatccatg tccctttcac ggtccaacag tcgtgagcac 480

ttgggaggtg gaagcgaatc tgataactgg agagaccgaa atggaattgg acctggaagt 540

catagtgaat ttgcagcttc tattggcagc cctaagcgta aacaaaacaa atcaacggaa 600

cactatctca gcagtagcaa ttacatggac tgcatttcct cgctgacagg aagcaatggc 660

tgtaacttaa atagctcttt caaaggttct gacctccctg agctcttcag caaactgggc 720

ctgggcaaat acacagatgt tttccagcaa caagagatcg atcttcagac attcctcact 780

ctcacagatc aggatctgaa ggagctggga ataactactt ttggtgccag gaggaaaatg 840

ctgcttgcaa tttcag 856

<210> 26

<211> 701

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 26

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagga gatgacctgg cttccaccac tttctgctat tcaagcacct 480

ggcaaagtgg aaccaaccaa atttccattt ccaaataagg actctcagct tgtatcctct 540

ggacacaata atccaaagaa aggtgatgca gagccagaga gtccagacag tggcacatcg 600

aatacatcaa tgctggaaga tgaccttaag ctaagcagtg atgaagagga gaatgaacag 660

caggcagctc agagaacggc tctccgcgct ctctctgaca g 701

<210> 27

<211> 990

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 27

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgaggg tactattttt ctgcctggaa ataaagtttc tgagcatccc 480

tgcaatgaag agaacccagg gaagttcctt tttgaagtag ttccaggagg cgatcgagat 540

cggatgacag caaatcatga aagctacctc ctcatggcaa gcacccagaa tgatatggaa 600

gactgggtga agtcaatccg ccgagtcata tggggacctt tcggaggagg catttttgga 660

cagaaactgg aggatactgt tcgttatgag aagagatatg ggaaccgtct ggctccgatg 720

ttggtggagc agtgcgtgga ctttatccga caaagggggc tgaaagaaga gggtctcttt 780

cgactgccag gccaggctaa tcttgttaag gagctccaag atgcctttga ctgtggggag 840

aagccatcat ttgacagcaa cacagatgta cacacggtgg catcacttct taagctgtac 900

ctccgagaac ttccagaacc agttattcct tatgcgaagt atgaagattt tttgtcatgt 960

gccaaactgc tcagcaagga agaggaagca 990

<210> 28

<211> 814

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 28

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagat ggcagatgat cagggctgta ttgaagagca gggggttgag 480

gattcagcaa atgaagattc agtggatgct aagccagacc ggtcctcgtt tgtaccgtcc 540

ctcttcagta agaagaagaa aaatgtcacc atgcgatcca tcaagaccac ccgggaccga 600

gtgcctacat atcagtacaa catgaatttt gaaaagctgg gcaaatgcat cataataaac 660

aacaagaact ttgataaagt gacaggtatg ggcgttcgaa acggaacaga caaagatgcc 720

gaggcgctct tcaagtgctt ccgaagcctg ggttttgacg tgattgtcta taatgactgc 780

tcttgtgcca agatgcaaga tctgcttaaa aaag 814

<210> 29

<211> 872

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 29

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgaggg tggggagaaa cagcgggtct tcactggtat tgttaccagc 480

ttgcatgact actttggggt tgtggatgaa gaggtctttt ttcagctaag tgtggtgaag 540

ggccgtctgc cccagctggg tgagaaggtg ctggtgaagg ctgcatacaa cccaggccag 600

gcagtgccct ggaatgctgt caaggtgcaa acgctctcca accagcccct actgaagtcc 660

ccagcacctc ctcttctgca tgtagcagcc ctgggccaga agcaagggat cctgggagct 720

cagcctcagt tgatcttcca gcctcaccgg attcccccac tctttcctca gaagcctctg 780

agtctcttcc aaacatccca cacacttcac ctgagccacc tgaacagatt tcctgcccgg 840

ggccctcatg gacggttgga tcagggccga ag 872

<210> 30

<211> 982

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 30

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagca agccagggct gagcaggaag aagaattcat tagtaacact 480

ttattcaaga aaattcaggc tttgcagaag gagaaagaaa cccttgctgt aaattatgag 540

aaagaagaag aattcctcac taatgagctc tccagaaaat tgatgcagtt gcagcatgag 600

aaagccgaac tagaacagca tcttgaacaa gagcaggaat ttcaggtcaa caaactgatg 660

aagaaaatta aaaaactgga gaatgacacc atttctaagc aacttacatt agaacagttg 720

agacgggaga agattgacct tgaaaataca ttggaacaag aacaagaagc actagttaat 780

cgcctctgga aaaggatgga taagcttgaa gctgaaaagc gaatcctgca ggaaaaatta 840

gaccagcccg tctctgctcc accatcgcct agagatatct ccatggagat tgattctcca 900

gaaaatatga tgcgtcacat caggttttta aagaatgaag tggaacggct gaagaagcaa 960

ctgagagctg ctcagttaca gc 982

<210> 31

<211> 1074

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 31

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagaa tgtcgaggtc ttggcgagca ggagcaacac ttcagagcaa 480

gaccaggcgg ggactgaaat gcgcgtgaag cttctgcagg aggagaatga gaagctgcag 540

ggaagaagcg aagagctgga gcggagagtt gctcagcttc aaaggcagat cgaggacctg 600

aaaggcgatg aagccaaggc gaaggaaacg ctgaagaagt acgagggaga aatacgacag 660

ttagaggagg cccttgtgca cgccagaaag gaagaaaaag aagctgtgtc agccagaagg 720

gccctggaga atgaactgga ggctgctcag ggaaatctga gtcagactac ccaggagcag 780

aagcagttgt ctgagaagct caaagaggag agtgagcaga aggagcagct aagaaggttg 840

aagaacgaga tggagaatga gcggtggcac ctgggcaaaa ccattgagaa actgcagaag 900

gagatggcag acattgttga ggcctcccgt acctcaaccc tggagctcca gaaccagctg 960

gatgagtata aggagaaaaa ccgcagggag ctcgcagaaa tgcaaagaca gttgaaggag1020

aaaacgctgg aggcagaaaa gtcccgactg acagccatga aaatgcagga tgag 1074

<210> 32

<211> 954

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 32

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagac cccagaggaa ctggaggatg tttctgacct tgaagaggaa 480

cacgaggtcc gcagtcacac cagcattcag accgaaggga aaactgatag ggctaagatg 540

actcaactgc ctgaggcaga aaaagaaaag attgctgagc aagttgctga tttcaagaaa 600

gtaaagagta agctggatgc tgagattgag atatgggatg atacaagcaa cgacatcatt 660

gttctggcca agaacatgtg tatgatcatg atggagatga cagacttcac taggggcaaa 720

ggaccactaa agcatacaac tgatgtgatc tatgcagcga aaatgatatc agaatcagga 780

tcaaggatgg atgtccttgc tcggcagatt gctaatcagt gcccagatcc atcttgtaaa 840

caggacttgt tggcctacct ggaacagatt aagttctact cccaccaact gaaaatctgc 900

agtcaagtta aagctgagat ccagaacctg ggaggagagc tcatcatgtc agct 954

<210> 33

<211> 933

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 33

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagat gggcttgtgt gcagaatgca gaagcttggt acccatgaac 480

actcccatct gtgtggtgtg tgaggcccct cttgctctac agctgcagcc acaggcaagc 540

ctccacttga aggagaaggt aatttgccgg gcctgtggta caggaaatcc tgctcacctg 600

agatactgtg tcacctgtga gggggccctg ccttcatcac aagagtcgat gtgcagtggg 660

gataaagccc ctcctccgcc cactcagaaa ggggggacca tttcctgcta cagatgtggt 720

cgctggaatc tctgggaggc gtccttctgc ggctggtgtg gagccatgct cggcattcct 780

gctggctgtt ctgtttgccc taaatgtggg gccagcaatc acctgtctgc ccgattctgt 840

ggctcctgtg gtatttgtgt gaagtcccta gtgaaactta gcttggacag aagcctggct 900

ctagctgctg aggaacctcg ccctttttct gag 933

<210> 34

<211> 923

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 34

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagga tagcattggg cagctggaga atgatctgag gaacaccaag 480

agtgagatgg cacgccacct tcgggaatac caggacttgc tcaatgtcaa aatggctctt 540

gacattgaga tagcagctta caggaaactg ctggaaggcg aggagacacg ttttagcacc 600

agtgggttaa gcatttcggg gctgaatcca cttcccaatc caagttacct gctcccacct 660

agaatcctca gtgctacaac ctccaaagtc tcatccactg ggctatcact taagaaagag 720

gaggaggagg aggaggcatc taaggtagcc tctaagaaaa cctcccagat aggggaaagt 780

tttgaagaaa tattagagga gacagtaata tctactaaga aaaccgagaa atcaaatata 840

gaagaaacca ccatttcaag ccaaaaaata taattccatt gctttgaaaa agttaatgct 900

taagagggaa tgatatgcat ttg 923

<210> 35

<211> 916

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 35

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgaggt aaataaagtt aaacaagaaa agactgtttt aaattcagaa 480

gttcttgaac agagaaaagt cttagaaaaa tgcaatagag tgtccatgtt agctgtagaa 540

gagtatgagg agatgcaagt aaacctggag ctggagaagg accttcgaaa gaaagcagag 600

tcatttgcac aagagatgtt cattgagcaa aacaagctaa agagacaaag ccaccttctg 660

ctgcagagct ccatccctga tcagcagctt ttgaaagctt tagacgaaaa tgcaaaactc 720

acccagcaac ttgaagaaga gagaattcag catcaacaaa aggtcaaaga attagaagag 780

caactagaaa atgaaacact ccacaaagaa atacacaacc tcaaacagca actggagctt 840

ctagaggaag ataaaaagga attggaattg aaatatcaga attctgaaga gaaagccaga 900

aatttaaagc actctg 916

<210> 36

<211> 844

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 36

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagac acaacttcga aaccagctaa ttcatgagtt gatgcaccct 480

gtattgagtg gagaactgca gcctcggtcc atttcagtag aagggagctc cctcttaata 540

ggcgcctcta actctttagt ggcagatcac ttacaaagat gtggctatga atattcactt 600

tctgttttct ttccagaaag tggtttggca aaagaaaagg tatttactat gcaggatcta 660

ttacaactca ttaaaatcaa ccctacttcc agtctctaca aatcactggt ttcaggatct 720

gataaagaaa atcaaaaagg ttttcttatg cattttttaa aagaattggc agaatatcat 780

caagctaaag agagttgtaa tatggaaact cagacaagtt cgacatttaa cagagattct 840

ctgg 844

<210> 37

<211> 934

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 37

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagga tggctacaat agactagtta atattgtgcc aaagaaacca 480

ccactgctag acagacctgg tgaaggaagc tacaatagat attacagtca tgttgattac 540

cgagactatg acgagggccg cagtttttct catgatcgaa gaagtggtcc acctcacaga 600

ggagatgaat ctggttatag atggacaaga gacgatcatt ctgcaagcag gcaacctgaa 660

tacagggaca tgagagatgg ctttagaaga aaaagtttct actcttccca ttatgcgaga 720

gagcggtctc cttataaaag ggacaatact tttttcagag aatcacctgt tggccgaaag 780

gattctccac acagcagatc tggttccagt gtcagtagca gaagctactc tccagaaagg 840

agcaaatcat actctttcca tcagtctcaa catagaaagt ccgtgcgtcc tggtgcctcc 900

tacaaacggc agaatgaagg aaatcctgaa agag 934

<210> 38

<211> 759

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 38

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagtt ttatcttcaa gacactaaaa gtagtaatgg tacttttata 480

aatagccaga gattgagtcg aggctctgaa gaaagtccac catgtgaaat tctttccggt 540

gacattatcc agtttggagt agacgtgaca gagaatacac ggaaagttac ccatgggtgt 600

attgtttcca caataaaact ttttctacca gatggtatgg aagcccggct ccgctcagat 660

gtcatccatg caccattacc aagtcctgtt gacaaagttg ctgctaacac tccaagtatg 720

tactctcagg aactattcca gctttctcag tatctacag 759

<210> 39

<211> 914

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 39

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgaggt acactgcatc agcacagaat ttactccacg gaagcacgga 480

ggtgaaaagg gagtgccctt taggatccag gttgacacct ttaagcagaa tgaaaatgga 540

gaatacacag atcatctaca ctcagctagc tgccaaatca aagtttttaa gcctaaaggt 600

gcagacagga aacaaaaaac tgaccgagag aagatggaga agagaacagc tcatgaaaaa 660

gaaaagtatc agccgtccta tgataccaca atcctcacag agatgaggct tgagcctata 720

attgaagatg cagttgaaca tgagcagaaa aagtccagca agcggacttt gccagcagac 780

tacggtgatt ctctggcaaa gcgaggcagt tgttctccgt ggcccgatgc ccccacagcc 840

tatgtgaata acagcccttc cccagcgccc actttcacct ccccacagca gagcacttgc 900

agtgtcccag acag 914

<210> 40

<211> 793

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 40

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagtg tcagagcccc accaattact tgcagggatt ggatggaaaa 480

cctatcattg cagctcctgt gtttacaaag atgctacaaa atttgtcagc ttctgagggt 540

cagctggttg tctttgaatg cagagtaaaa ggagctccat ctcctaaggt tgagtggtat 600

agagaaggga ctttaataga agattctcca gattttagga ttttacagaa aaaacctcga 660

tccatggcag agccagagga gatttgcacc ttggtcattg ctgaggtgtt tgcagaagat 720

tctgggtgct tcacatgtac tgcaagcaac aaatacggca cagtgtcaag cattgcacag 780

ctgcacgtga gag 793

<210> 41

<211> 898

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 41

tgtattcatc gagatttagc agccagaaat gttttggtaa cagaaaacaa tgtgatgaaa 60

atagcagact ttggactcgc cagagatatc aacaatatag actattacaa aaagaccacc 120

aatgggcggc ttccagtcaa gtggatggct ccagaagccc tgtttgatag agtatacact 180

catcagagtg atgtctggtc cttcggggtg ttaatgtggg agatcttcac tttagggggc 240

tcgccctacc cagggattcc cgtggaggaa ctttttaagc tgctgaagga aggacacaga 300

atggataagc cagccaactg caccaacgaa ctgtacatga tgatgaggga ctgttggcat 360

gcagtgccct cccagagacc aacgttcaag cagttggtag aagacttgga tcgaattctc 420

actctcacaa ccaatgagca aatccagttt gctgatgaca tgcaggagtt caccaaattc 480

cccaccaaaa ctggccgaag atctttgtct cgctcgatct cacagtcctc cactgacagc 540

tacagttcag ctgcatccta cacagatagc tctgatgatg aggtttctcc ccgagagaag 600

cagcaaacca actccaaggg cagcagcaat ttctgtgtga agaacatcaa gcaggcagaa 660

tttggacgcc gggagattga gattgcagag caagacatgt ctgctctgat ttcactcagg 720

aaacgtgctc agggggagaa gcccttggct ggtgctaaaa tagtgggctg tacacacatc 780

acagcccaga cagcggtgtt gattgagaca ctctgtgccc tgggggctca gtgccgctgg 840

tctgcttgta acatctactc aactcagaat gaagtagctg cagcactggc tgaggctg 898

Claims (7)

1. For detecting peopleFGFR2A nucleic acid composition of genetic fusion mutations characterized by: the primer and probe sequences comprise the following sequences:

FB-M1 forward primer sequence SEQ ID NO. 1;

FB-M1 reverse primer sequence SEQ ID NO. 2;

FB-M2 reverse primer sequence SEQ ID NO. 3;

FB-M3 reverse primer sequence SEQ ID NO. 4;

FB-M4 reverse primer sequence SEQ ID NO. 5;

FB-M5 reverse primer sequence SEQ ID NO. 6;

FB-M6 reverse primer sequence SEQ ID NO. 7;

FB-M7 reverse primer sequence SEQ ID NO. 8;

FB-M8 reverse primer sequence SEQ ID NO. 9;

FB-M9 reverse primer sequence SEQ ID NO. 10;

FB-M10 reverse primer sequence SEQ ID NO. 11;

FB-M11 reverse primer sequence SEQ ID NO. 12;

FB-M12 reverse primer sequence SEQ ID NO. 13;

FB-M13 reverse primer sequence SEQ ID NO. 14;

FB-M14 reverse primer sequence SEQ ID NO. 15;

FB-M15 reverse primer sequence SEQ ID NO. 16;

FB-M16 reverse primer sequence SEQ ID NO. 17;

FB-M17 reverse primer sequence SEQ ID NO. 18;

FB-M18 reverse primer sequence SEQ ID NO. 19;

the probe sequence is SEQ ID NO.20, the 5 'end of the probe sequence is modified by a fluorescence reporter group, and the 3' end of the probe sequence is modified by a fluorescence quenching group.

2. A method for detecting a person according to claim 1FGFR2A nucleic acid composition of genetic fusion mutations characterized by: the nucleic acid composition also comprises primer and probe sequences of the reference gene:

GAPDH forward primer sequence SEQ ID NO. 21;

GAPDH reverse primer sequence SEQ ID NO. 22;

the GAPDH probe sequence SEQ ID NO.23, wherein the 5 'end of the probe sequence is modified by a fluorescence reporter group, and the 3' end of the probe sequence is modified by a fluorescence quenching group.

3. A method for detecting a person according to claim 1FGFR2A nucleic acid composition of genetic fusion mutations characterized by: the 5 'end of the probe sequence is marked by FAM fluorescent group, and the 3' end of the probe sequence is marked by BHQ1 fluorescent group.

4. For detecting peopleFGFR2The gene fusion mutation kit is characterized in that: comprising the nucleic acid composition of any one of claims 1-3.

5. A method for detecting a person according to claim 4FGFR2The gene fusion mutation kit is characterized in that: the kit also comprises DNA polymerase, PCR buffer solution, dNTPs and cations.

6. A method for detecting a person according to claim 5FGFR2The gene fusion mutation kit is characterized in that: the DNA polymerase is Taq enzyme, and the cation is Mg²⁺。

7. A method for detecting a person according to claim 5FGFR2The gene fusion mutation kit is characterized in that: the kit also includes a PCR enhancer.

Images