CN106729751B - Application of microRNA molecule in detection and treatment of breast cancer - Google Patents
Application of microRNA molecule in detection and treatment of breast cancer Download PDFInfo
- Publication number
- CN106729751B CN106729751B CN201510813090.0A CN201510813090A CN106729751B CN 106729751 B CN106729751 B CN 106729751B CN 201510813090 A CN201510813090 A CN 201510813090A CN 106729751 B CN106729751 B CN 106729751B
- Authority
- CN
- China
- Prior art keywords
- microrna
- breast cancer
- cells
- negative breast
- triple negative
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention relates to an application of a microRNA molecule in detecting and treating breast cancer. In particular, the invention relates to the use of a microRNA-4306 molecule for the preparation of a medicament for the treatment of a patient suffering from breast cancer. In another aspect, the invention relates to the use of one or more primers and/or probes for specifically detecting the expression level of the microRNA-4306 molecule in the preparation of a reagent for diagnosing breast cancer patients.
Description
Technical Field
The invention relates to an application of a microRNA molecule in detecting and treating breast cancer. Specifically, the invention relates to an application of a microRNA-4306 molecule as a diagnostic marker in diagnosing Triple Negative Breast Cancer (TNBC). The invention also relates to application of the microRNA-4306 molecule in preparation of a medicine for treating breast cancer.
Background
By utilizing the molecular biology technology, the detection of molecular level can be effectively carried out to judge different subtypes of malignant tumor patients, thereby providing convenience for individual treatment of the diseases. The breast cancer is a common malignant tumor of women worldwide, the incidence rate of the breast cancer in China is obviously increased in recent years, and the incidence rate and the mortality rate of the breast cancer are the first of female malignant tumors and are in an increasing trend. Breast cancer is a class of diseases with a high degree of heterogeneity at the molecular level. Even tumors with the same tissue morphology may have inconsistent molecular genetic changes, leading to differences in tumor treatment regimens. Triple negative breast cancer (estrogen receptor, progesterone receptor and human epidermal growth factor receptor 2 are all negative) accounts for 10-15% of breast cancer, and has unique morphological, substructure and immunohistochemical characteristics compared with non-triple negative breast cancer. It is prone to early relapse, distant metastasis, poor clinical prognosis and lacks the opportunity for endocrine therapy and anti-HER 2 targeted therapy, and there is currently no targeted standard treatment regimen. Chemotherapy is still the mainstay of medical treatment of triple negative breast cancer. The U.S. Food and Drug Administration (FDA) has not approved any drug specific for triple negative breast cancer. Treatment options for advanced triple negative breast cancer are limited. Most patients already receive anthracyclines, taxoids and cyclophosphamide treatment, and once metastasis recurs, there are few drug options and the prognosis of the patient is poor. Therefore, new therapeutic strategies are urgently needed to improve the prognosis of triple negative breast cancer.
Molecular targeted therapy has been a focus of research in recent years and has made breakthrough progress in the treatment of partial malignancies. Such as gefitinib (irresa), has better prognosis when used for treating non-small cell lung cancer, especially for female patients without smoking and adenocarcinoma; imatinib for the treatment of gastrointestinal stromal tumors, particularly better therapeutic efficacy in those with the Kit exon 11 mutation, see Nilsson B, S.K., Kindblom LG, et al (2007), "advanced imatinib molecular therapy-free Survival in tissues with high-rise structural tumors (GIST)," Br J Cancer 96:1656-1658,; C225. combination Radiotherapy treatment of locally advanced head and neck cancer, with a survival rate that is nearly 1-fold higher than that of simple Radiotherapy, see Fischer B, Marinov M, Archaro A Bonner JA, H.P., Giralt J, et al (2006), "radiotherapeutic plus cellular cancer for squamous-cell cancer of the head and neck," N Engl J Med 354: 567-. Therefore, further understanding of the molecular mechanisms of triple negative breast cancer greatly helps to improve prognosis. Stevens, K.N. (see Stevens, K.N., C.M.Vachon, et al (2013). "Genetic Susceptibility to triple-negative clearance Cancer." Cancer Res73(7): 2025-: triple negative breast cancer is often accompanied by inactivation of the BRCA1 pathway. BRCA1 plays an important role in the recombination of homologous DNA duplexes and DNA duplex repair. Platinum drugs, in turn, can crosslink with DNA duplexes, causing DNA duplexes to break, preventing DNA duplexes from replicating, transcribing, and ultimately causing cell death. Thus, it is theorized that platinum drugs may be more effective in treating triple negative breast cancer. Unfortunately, the desired therapeutic effect is not achieved clinically. In view of this, it is otherwise understood that the molecular mechanism of triple negative breast cancer may be the breakthrough point for treatment.
Small RNA molecules (MicroRNA) typically consist of 18-25 nucleotides, are non-coding RNA molecules, and can inhibit mRNA function by binding to mRNA, regulating the translation process. In recent years, a few documents about different subtypes and treatment relations of microRNA and malignant tumors are published, and the documents are respectively proved in lung cancer and kidney cancer: the microRNA can be used as a marker for distinguishing different subtypes of malignant tumors, and has obvious influence on treatment of the malignant tumors. However, no report is found on the research on the markers and molecular therapeutic targets of the breast cancer molecular subtype triple negative breast cancer.
MicroRNA-4306 (miR-4306 for short) is positioned on chromosome 13, contains 17 nucleotides, and the sequence is shown in SEQ ID NO.1: 5'-UGGAGAGAAAGGCAGUA-3', wherein the full length of the microRNA-4306 on the genome is shown in GenBank accession numbers: NR _036191.1, 99643059-99643149 bp sequence, 91bp, and the function thereof is not reported in the literature.
Disclosure of Invention
The invention relates to application of a microRNA molecule in preparation of a medicine for treating a patient suffering from breast cancer, wherein the microRNA molecule is MicroRNA-4306, and the sequence of the microRNA molecule is shown as SEQ ID NO: 1 (5'-UGGAGAGAAAGGCAGUA-3').
In particular, the invention relates to an application of a microRNA molecule in preparing a medicament for treating a patient suffering from triple negative breast cancer, wherein the microRNA molecule is microRNA-4306, and the sequence of the microRNA molecule is shown as SEQ ID NO: 1 (5'-UGGAGAGAAAGGCAGUA-3').
In yet another aspect, the present invention relates to a pharmaceutical composition for treating a patient suffering from breast cancer, wherein the pharmaceutical composition comprises the microRNA-4306 molecule of claim 1 or the vector of the present invention, and a pharmaceutically acceptable excipient.
The pharmaceutical composition according to the invention may already contain cisplatin.
In yet another aspect, the invention relates to one or more methods of specifically detecting a polypeptide as set forth in SEQ ID NO: 1 in the technical scheme, the application of the primer and/or the probe with the microRNA-4306 molecule expression level in preparing a reagent for diagnosing breast cancer patients is disclosed. In particular, the invention relates to the specific detection of a polypeptide as set forth in SEQ ID NO: 1 in the technical scheme, the application of the primer and/or the probe with the microRNA-4306 molecule expression level in preparing a reagent for diagnosing a triple negative breast cancer patient is disclosed.
In another aspect, the present invention provides a method of diagnosing a patient having breast cancer, comprising the steps of:
a) providing a sample of breast cancer tissue and paraneoplastic tissue from an individual; and
b) determining the expression level of the microRNA-4306 molecule in the sample;
c) and comparing the expression level of the microRNA-4306 molecule in the samples of the cancer tissue and the tissue beside the cancer.
In another aspect, the present invention provides a method of differentiating between triple negative breast cancer and non-triple negative breast cancer, comprising the steps of:
a) providing a sample of breast cancer tissue from an individual; and
b) determining the expression level of the microRNA-4306 molecule in the sample;
c) and comparing the expression level of the microRNA-4306 molecule in the sample of the cancer tissue.
In a specific embodiment, the primer for reverse transcription of microRNA is SEQ ID NO. 2: 5 'GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTG GATACGACTACTGC-3'; the universal sense primer of the microRNA is SEQ ID NO. 3:
5'-GTGCAGGGTCCGAGGT-3', respectively; specific antisense primer SEQ ID No.4:
5’-ACTCGTCTGGAGAGAAAGGCA-3’。
specifically, in one embodiment of the present invention, the step of detecting a sample to be tested comprises:
1) extracting microRNA in different molecular subtype breast cancer cell strains,
2) the gene chip detects different subtype breast cancer cells, screens genes related to triple negative breast cancer: the micro RNA-4306 has the advantages of high content of the micro RNA,
3) chip data processing: the statistically different microRNAs obtained by single factor analysis,
4) chip data verification: utilizing a primer qRT-PCR amplification designed according to a microRNA-4306 gene sequence,
5) PCR data collection and processing: normalization was performed using U6RNA as an internal standard. The molecular typing of breast cancer was evaluated using the chip-derived model.
Drawings
FIG. 1: shows the analysis results of the microRNA chip in non-triple negative breast cancer cell lines (ZR-75-1, MCF-7) and triple negative breast cancer cell lines (MDA-MB-231, CAL-51). From the chip results, the expression of the microRNA-4306 in the triple negative breast cancer cells is lower than that in the non-triple negative breast cancer cells.
FIG. 2: shows that according to the analysis result of the microRNA chip, cell lines, non-triple-negative breast cancer cell lines (ZR-75-1, SK-BR-3, MCF-7 and T47D) and triple-negative breast cancer cell lines (HCC1937, MDA-MB-468, MDA-MB-231 and CAL-51) are added, and qRT-PCR verifies that miR-4306 expression condition in the triple-negative breast cancer cell lines is relative to that in the non-triple-negative breast cancer cell lines.
From the qPCR result, the expression of the microRNA-4306 in the triple-negative breast cancer cells is lower than that in the non-triple-negative breast cancer cells.
FIG. 3: the expression of microRNA-4306 in the matched cancer and paracancer of the breast cancer patient is shown.
FIG. 4: the expression of microRNA-4306 in tissue specimens of different breast cancer patients is shown.
Fig. 5A to 5C: showing the relationship between microRNA-4306 and lymph node metastasis in tissue specimens of different breast cancer patients. FIG. 5A, Luminal type breast cancer; FIG. 5B, breast cancer type H; fig. 5C, triple negative breast cancer.
From the qPCR result, the microRNA-4306 is related to lymph node metastasis only in triple negative breast cancer, and is not related to lymph node metastasis in both luminal breast cancer and H-type breast cancer.
Fig. 6A to 6D: showing that the microRNA-4306 inhibits the in vitro invasion and migration capacity of the cells. FIG. 6A: the MDA-MB-231 cell line is respectively added with miR control, and after miR-4306, the in vitro invasion and migration capacity of the cells are inhibited, and the cell staining diagram is shown; FIG. 6B: the CAL-51 cell line is respectively added with miR control and miR-4306, and then the in vitro invasion and migration capacity cell staining diagram is shown; FIG. 6C is a bar chart showing the in vitro invasion and migration inhibition ability of MDA-MB-231 cell line after miR control and miR-4306 are added respectively; FIG. 6D is a bar chart of miR control and miR-4306 added to CAL-51 cell line to inhibit in vitro invasion and migration of cells.
Fig. 7A and 7B: showing the capability of the microRNA-4306 to inhibit the proliferation of cells in vitro. FIG. 7A: the MDA-MB-231 cell line is respectively added with miR control and miR-4306, and then the in vitro proliferation capacity of the cells is inhibited; FIG. 7B: and after the CAL-51 cell line is respectively added with the miR control and miR-4306, the in-vitro proliferation capacity of the cells is inhibited.
Fig. 8A to 8D: showing that the microRNA-4306 inhibits the growth of triple negative breast cancer cells and lung metastasis in a nude mouse. FIGS. 8A-8B: the microRNA-4306 for constructing the virus vector is used for infecting CAL-51 cells, and a stable cell line CAL-51-microRNA-4306 and CAL-51-control are respectively injected into bilateral fat pads of female nude mice, so that the schematic diagram of the tumor size is shown after 4 weeks of tumor formation. FIGS. 8C-8D show that CAL-51 cells are infected by microRNA-4306 for constructing a viral vector, and a stable cell line CAL-51-microRNA-4306 and CAL-51-control are respectively injected into the caudal vein of a female nude mouse, and after one month, the nude mouse has lung metastasis.
Fig. 9A and 9F: shows that the microRNA-4306 promotes platinum-based drug (cis-platinum) -induced triple-negative breast cancer cell apoptosis. FIGS. 9A-9B: flow schematic of cell apoptosis following cisplatin treatment of cells after addition of miR control, miR-4306, to MDA-MB-231 or CAL-51 cell lines. 9C-9F: and after the miR control, miR-4306 is added into the MDA-MB-231 or CAL-51 cell line, the cisplatin treats the cells, and the protein change of the apoptosis is shown schematically.
FIGS. 9G-9H show a graphical representation of the change in protein in apoptosis of cisplatin-treated cells following the addition of miR control, miR-4306, to either MDA-MB-231 or CAL-51 cell lines.
Fig. 10A and 10B: shows that the microRNA-4306 promotes platinum-based drug (cisplatin) -induced triple-negative breast cancer cell apoptosis in a nude mouse. FIG. 10A: after female nude mice are injected with CAL-51 fat pads to form tumors, miR controls, microRNA-4306 and platinum drugs (cisplatin) are injected into the abdominal cavities respectively, and the sizes of the tumors are schematically shown. FIG. 10B is a schematic diagram showing tumor growth curves of female nude mice injected with CAL-51 tumor after fat pads injection, miR control, microRNA-4306, intraperitoneal platinum drug (cisplatin) injection and tumor growth curves respectively.
FIG. 10C is a schematic diagram showing protein changes of tumor cell apoptosis caused by injecting miR control, microRNA-4306, platinum-based drug (cisplatin) into abdominal cavity, and into female nude mice injected with CAL-51 to form tumors.
Detailed Description
The inventor researches breast cancer, particularly triple negative breast cancer by using a microRNA gene chip and a qRT-PCR technology. The inventors surprisingly found that the expression level of microRNA-4306 in breast cancer cells is significantly lower than that of normal breast tissue (see FIG. 3), and the expression level is different in different subtypes of breast cancer cells. Similar results were obtained when the patient was examined again in a tissue specimen. In addition, in the tissue specimens of the triple negative breast cancer patients, the microRNA-4306 shows low expression in most of the triple negative breast cancer patients with lymph node metastasis. Therefore, the gene can be used as a good breast cancer molecular typing model, particularly as a model for distinguishing non-triple-negative breast cancer from triple-negative breast cancer, and can be used as a model for distinguishing whether triple-negative breast cancer has lymph node metastasis. Through the model, the breast cancer can be divided into two types of non-triple negative breast cancer and triple negative breast cancer, the triple negative breast cancer can be divided into two types of non-lymph node metastasis and lymph node metastasis, different types adopt different treatment schemes, the non-triple negative breast cancer can adopt endocrine treatment, HER 2-resistant targeted treatment and chemotherapy, the triple negative breast cancer can adopt specific sensitive medicines for chemotherapy, and the triple negative breast cancer can be treated by microRNA-4306 targeted treatment or by combining the microRNA-4306 with cisplatin. After the gene is applied to a corresponding gene chip or a kit, the non-triple negative breast cancer and the triple negative breast cancer of mammals including humans can be rapidly distinguished, whether a triple negative breast cancer patient has the risk of lymph node metastasis can be rapidly judged, and microRNA-4306 targeted therapy or therapy of microRNA-4306 combined cis-platinum can be performed on the triple negative breast cancer patient, so that epoch-making significance is provided for the change of the breast cancer, particularly the treatment mode of the triple negative breast cancer.
In one embodiment of the invention, by using the primer and/or the probe capable of specifically detecting the expression level of the microRNA-4306 molecule, the breast cancer of mammals including human can be rapidly diagnosed, and the breast cancer can be distinguished from non-triple-negative breast cancer, so that the epoch-making significance of the change of the treatment mode of the breast cancer, particularly the triple-negative breast cancer, can be realized.
In another embodiment of the invention, the detection method related to the invention is described, which mainly comprises the steps of microRNA extraction, gene chip manufacturing, hybridization, qRT-PCR verification and the like. The gene chip detection is mainly used for screening genes related to triple negative breast cancer, and the screened genes are subjected to result verification through qRT-PCR. In view of the fact that the inventor finds a gene related to triple negative breast cancer, only two technologies of microRNA extraction and qRT-PCR are used in future clinical application. Both methods are routine for those skilled in the art. Therefore, the model is easy to popularize in clinic.
Specifically, the method for detecting the microRNA-4306 molecule mainly comprises the steps of microRNA extraction, gene chip manufacturing, hybridization, qRT-PCR verification and the like. The gene chip detection is mainly used for screening genes related to triple negative breast cancer, and the screened genes are subjected to result verification through qRT-PCR. In view of the fact that the inventor finds a gene related to triple negative breast cancer, only two technologies of microRNA extraction and qRT-PCR are used in future clinical application. Both methods are routine for those skilled in the art. Therefore, the model is easy to popularize in clinic.
In another embodiment of the present invention, a method for detecting the expression of microRNA-4306 in a test sample is also described, which comprises the following steps:
1) extracting microRNA in different molecular subtype breast cancer cell strains,
2) the gene chip detects breast cancer cells, and screens genes related to triple negative breast cancer: the micro RNA-4306 has the advantages of high content of the micro RNA,
3) chip data processing: statistically different microRNAs obtained by single-factor analysis
4) Chip verification: PCR amplification is carried out by using a primer designed according to a microRNA-4306 gene sequence,
5) PCR data collection and processing: normalization was performed using U6RNA as an internal standard. The molecular typing of breast cancer was evaluated using the chip-derived model.
In another specific embodiment of the invention, the inventors investigated the effect of microRNA-4306 on the in vitro invasion migration and proliferation capacity of triple negative breast cancer cell lines. The result shows that the microRNA-4306 inhibits the in-vitro invasion, migration and growth capacity of the breast cancer cells, and particularly, the microRNA-4306 significantly weakens the in-vitro invasion, migration and growth of the triple negative breast cancer cells and inhibits the invasion, metastasis and proliferation of the triple negative breast cancer cells. Therefore, the microRNA-4306 disclosed by the invention can be used for treating a patient suffering from breast cancer, and particularly, the microRNA-4306 disclosed by the invention can be used for treating a patient suffering from triple negative breast cancer.
The present invention will be further described with reference to the following examples, but the present invention is not limited to these examples.
In the following examples, the reagents used are all analytical grade and are commercially available unless otherwise specified. Unless otherwise specified, the procedures of RT-PCR, PCR and the like in the examples of the present invention were performed according to "molecular cloning Experimental Manual (third edition)" (scientific Press, 2002[ American ] J. SammBucke D.W Lassel, Huangpetang et al) and manufacturer's instructions, and the procedures of cell culture, cell passaging, cell recovery and cryopreservation, cell transfection and immunofluorescence were performed according to "animal cell culture- -basic technical Manual (fourth edition)" (scientific Press, 2000, [ Freusch (R.I.) letters, Octope et al) and manufacturer's instructions.
Example 1: method for detecting microRNA-4306 gene expression condition
1. Trizol method for extracting total RNA of cells and tissues
(1) Sample source
The breast cancer sample is from tumor hospitals of Chinese medical academy of sciences and the Qiqianhal medical academy, and has enough formalin paraffin-embedded tissues or frozen fresh tissues so as to obtain enough miRNA and have complete medical writing records. And (3) selecting the breast cancer cell lines ZR-75-1, MCF-7, MDA-MB-231 and CAL-51, carrying out microRNA chip detection, and screening microRNA related to triple negative breast cancer. And selecting breast cancer cell lines ZR-75-1, SK-BR-3, MCF-7, T47D, HCC1937, MDA-MB-468, MDA-MB-231 and CAL-51, and verifying the chip result. 200 cases of formalin-fixed paraffin-embedded tissues and frozen fresh tissue specimens were selected and the chip results were verified.
(2) Sample processing (bacteria, cells without grinding)
A tissue specimen of about 1cm2 size was crushed in aluminum foil, transferred to an Eppendorf tube to which steel balls had been added, ground using a grinder (301/s, 8min),
note: the operation of the step is carried out in a low-temperature liquid nitrogen environment as far as possible, and bacteria and cell samples are not ground;
(3) adding 1ml of Trizol into the ground Eppendorf tube, and uniformly mixing the mixture by oscillation;
(4) transferring the uniformly mixed solution into a new Eppendorf tube, adding 200 mu l of chloroform, and uniformly mixing by oscillation;
(5) centrifuging: 4 ℃, 12000rpm, 15 min;
(6) transferring the centrifuged supernatant into a new Eppendorf tube, adding 500 mu l of isopropanol, gently mixing uniformly, and standing at room temperature for 15 min;
(7) centrifuging: 4 ℃, 12000rpm, 15 min;
(8) pouring out the supernatant, adding 1ml of 75% ethanol, and shaking and mixing uniformly;
(9) centrifuging: 4 ℃, 7500rpm, 5 min;
(10) pouring out the supernatant, and volatilizing the ethanol in a super clean bench;
(11) adding 40-60 mul DEPC H2O, and dissolving for 5min at 65 ℃;
(12) and (4) freezing and storing at-20 ℃.
2. Total RNA quality detection
(1) NanoDrop was used to determine total RNA concentration (2. mu.l total RNA load),
(2) 1.5% formaldehyde modified agarose gel electrophoresis for detecting RNA quality
Total RNA500ng
5×Loading Buffer 2μl
DEPC H2O to 8～9μl
Denaturation at 65 deg.C for 5min, ice bath for 5min
EB (500 fold dilution) 1. mu.l
The total volume is about 6-8 μ l.
Formaldehyde denaturing agarose gel: adding 0.45g of agarose into 30ml of 1 XTBE Buffer, heating and melting the agarose in a microwave oven, slightly shaking the agarose to fully mix the agarose (no granular suspended matters are observed by naked eyes), adding 600 mu l of formaldehyde when the agarose is cooled to about 60 ℃, mixing the mixture, pouring the mixture into a special RNA gel maker (7.5 multiplied by 5.5cm), and standing the mixture at room temperature for about 30min for use.
Electrophoresis conditions: 120-130V for 15-20 min.
3. Reverse transcription of microRNA:
(1) reverse transcription reaction system
Total RNA 100ng
MicroRNA reverse transcription primer SEQ ID NO. 21. mu.l (1. mu.M)
DEPC H2O to 12.3μl
Denaturation at 65 deg.C for 5min, ice bath for 5min
Total 20 μ l system.
(2) Reverse transcription procedure: refrigerating at 16 deg.C for 30min, 37 deg.C for 30min, 70 deg.C for 10min, and 4 deg.C for use.
4. MicroRNA real-time PCR reaction
(1) MicroRNA real-time PCR reaction system
The template (cDNA) is generally 1. mu.l of 20. mu.l of the reverse transcription reaction system
MgCl2 1.6μl
Primer microRNA universal sense primer 0.6. mu.l (10. mu.M)
For microRNA-4306: SEQ ID NO.3
Specific antisense primer 0.6. mu.l (10. mu.M)
For microRNA-4306: SEQ ID NO.4
DNA Master SYBR Green I MIX 2μl
Adding nuclease-free H2O to 20. mu.l
(2) MicroRNA real-time PCR program
The total number of the cycles is 40,
the melting curve is 75-95 ℃.
(3) MicroRNA real-time PCR product 1.5% non-denaturing (without formaldehyde) agarose gel electrophoresis detection
2-4 mul of microRNA real-time PCR product
2×Loading Buffer 4μl
The total volume is about 6-8 μ l.
Non-denaturing agarose gel: adding 1.2g agarose into 80ml 1 × TBE Buffer, heating and melting in a microwave oven, shaking gently to mix agarose thoroughly (no granular suspended matter observed by naked eye), cooling to about 60 deg.C, adding 2 μ l EB (stock solution), mixing, pouring into a gel-making device (15 × 15cm), and standing at room temperature for about 30 min.
Electrophoresis conditions: 100V, 25-30 min.
5. Data collection and processing:
normalization was performed using U6RNA as an internal standard.
Example 2: research on biological effect of MicroRNA-4306 in inhibiting invasion, migration and proliferation of triple negative breast cancer cells
1. Experimental procedure
(1) Cell culture
Human triple negative breast cancer cell lines: MDA-MB-231, DMEM medium, containing 10% fetal bovine serum, was cultured at 37 ℃ with 5% CO 2.
Human triple negative breast cancer cell lines: CAL-51, DMEM medium containing 10% fetal bovine serum, cultured at 37 ℃ in 5% CO 2.
(2) Transient transfection of miRNA
Preparing miRNA mother liquor: adding 250 mu L of 1 Xuniversal buffer solution into 5nmol of miRNA to obtain miRNA mother solution with the concentration of 20 mu mol/L,
b. cells with good growth state are taken, the cells are inoculated in a 6-well plate (without adding antibiotics) one day before transfection, transfection is carried out when the cell density reaches about 70 percent,
c. the following complex was prepared, liquid A: miRNA at the appropriate concentration was diluted in 250 μ L serum-free medium and gently mixed. And B, liquid B: mixing Lipofectamine 2000, diluting 6 μ L in 250 μ L serum-free culture medium, mixing, incubating at room temperature for 5min,
d. mixing the diluted liposome and the diluted miRNA, gently mixing, incubating at room temperature for 20 minutes,
e. and adding 500 mu L of the mixed compound into a 6-well plate, adding 2mL of serum-free culture medium, and gently mixing. The original medium was discarded for 6 hours and replaced with DMEM medium containing 10% serum.
(3) MiRNA real-time RT-PCR
a. Extraction of total RNA from sample by Trizol method
(I) Taking cells in a good growth state, pouring out the culture solution in the bottle when the cell density reaches 80% -90%, and washing for 2 times by using PBS;
(II) adding 1mL of Trizol, gently shaking, and placing on ice for 15 minutes;
(III) transferring the uniformly mixed solution into an Eppendorf tube treated by DEPC, adding 200 mu l of chloroform, and uniformly mixing by oscillation;
(IV) centrifugation: 4 ℃, 12000rpm, 15 min;
(V) transferring the centrifuged supernatant into a new Eppendorf tube, adding 500 mu l of isopropanol, gently mixing uniformly, and standing at room temperature for 15 min;
(VI) centrifugation: 4 ℃, 12000rpm, 15 min;
(VII) pouring out the supernatant, adding 1ml of 75% ethanol, and shaking and mixing uniformly;
(VIII) centrifugation: 4 ℃, 7500rpm, 5 min;
(IX) pouring off the supernatant, and volatilizing the ethanol in a super clean bench;
(X) adding 40-60 mu l of DEPC H2O, and dissolving for 5min at 65 ℃;
(XI) -20 ℃ cryopreservation.
b. Total RNA quality detection
(I) NanoDrop was used to determine total RNA concentration (2. mu.l total RNA load),
(II) 1.5% Formaldehyde denaturing agarose gel electrophoresis for RNA quality detection, Total RNA500ng
5 XLoading buffer 2. mu.l
DEPC H2O to 8～9μl
Denaturation at 65 deg.C for 5min, ice bath for 5min
EB (500 fold dilution) 1. mu.l
The total volume is about 6-8 μ l
Formaldehyde denaturing agarose gel: adding 0.45g of agarose into 30ml of 1 XTBE Buffer, heating and melting the agarose in a microwave oven, slightly shaking the agarose to fully mix the agarose (no granular suspended matters are observed by naked eyes), adding 600 mu l of formaldehyde when the agarose is cooled to about 60 ℃, mixing the mixture, pouring the mixture into a special RNA gel maker (7.5 multiplied by 5.5cm), and standing the mixture at room temperature for about 30min for use.
Electrophoresis conditions: 120-130V for 15-20 min.
c, miRNA reverse transcription:
table 1: reverse transcription reaction system
| Total RNA | 100ng |
| miRNA reverse transcription primer | 1μl(1μM) |
| DEPC H2O to 12.3. mu.l | |
| Denaturation at 65 deg.C for 5min, ice bath for |
|
| 5×1stBuffer solution | 4μl |
| 0.1M DTT | 2μl |
| dNTPs | 0.5. mu.l (10 mM each) |
| RNase inhibitors | 0.2μl(40U/μl) |
| M-MLV | 1μl(200U/μl) |
| |
Reverse transcription procedure: 30min at 16 ℃, 30min at 37 ℃, 10min at 70 ℃ and 4 DEG C
Real-time PCR reaction of miRNA
Table 2: MiRNA real-time PCR reaction system
Table 3: MiRNA real-time PCR program
| Enzyme activation | 95℃，10min | |
| Amplification reaction | 95℃，15s | Denaturation of the material |
| 60℃，30s | Annealing and stretching | |
| 74℃，3s | | |
| Total | ||
| 40 | ||
| Dissolution curve | ||
| 75～95℃ |
And detecting miRNA real-time PCR products by 1.5% non-denaturing (without formaldehyde) agarose gel electrophoresis. 2-4 mul of miRNA real-time PCR product.
2×Loading Buffer 4μl
The total volume is about 6-8 μ l
Non-denaturing agarose gel: adding 1.2g agarose into 80ml 1 × TBE Buffer, heating and melting in a microwave oven, shaking gently to mix agarose thoroughly (no granular suspended matter observed by naked eye), cooling to about 60 deg.C, adding 2 μ lEB (stock solution), mixing, pouring into a gel-making device (15 × 15cm), and standing at room temperature for about 30 min.
Electrophoresis conditions: 100V, 25-30 min.
(4) Cell invasion Capacity analysis
The principle is based on the characteristics of motility and directionality when tumor cells invade. Tumor cells move in one direction after contacting the stromal surface through a series of mechanisms.
a. For MDA-MB-231 and CAL-51 cells, Matrigel was diluted to 500. mu.g/mL, 100. mu.L was placed in the upper chamber of a transwell chamber of 8 μm pore polycarbonate membrane, incubated at 37 ℃ for 1h in a 5% CO2 incubator, the aqueous phase was aspirated off for use,
b. tumor cells with good growth state are taken 48 hours after transfection, digested and resuspended at a certain density,
c. 200. mu.L of MDA-MB-231 or CAL-51 cell suspension containing 5X 104 or 10X 104 cells, respectively, were seeded into the upper chamber of each transwell chamber, 800. mu.L of culture medium containing 10% serum was added to the lower chamber, and cultured in a 5% CO2 incubator at 37 ℃ for 8 hours,
d. taking out the chamber, scraping the cells on the upper layer without migration,
e. cells on the membrane were fixed with 70% methanol for 15 minutes,
f. staining with 0.5% crystal violet (prepared with methanol) for 20min, washing with distilled water,
g. the number of cells on the lower surface of the chamber was counted under a microscope, and statistical analysis was performed while photographing.
(5) Tumor cell migration assay
The principle is based on the characteristics of mobility and directionality of tumor cells during migration. Tumor cells move in one direction through a series of mechanisms.
a. Tumor cells with good growth state are taken 48 hours after transfection, digested and resuspended at a certain density,
b. 200. mu.L of MDA-MB-231 or CAL-51 cell suspension containing 5X 104 or 10X 104 cells, respectively, were seeded into the upper chamber of each transwell chamber, 800. mu.L of a culture medium containing 10% serum was added to the lower chamber, and cultured in a 5% CO2 incubator at 37 ℃ for 12 hours,
c. taking out the chamber, scraping the cells on the upper layer without migration,
d. cells on the membrane were fixed with 70% methanol for 15 minutes,
e. staining with 0.5% crystal violet (prepared with methanol) for 20min, washing with distilled water,
f. the number of cells on the lower surface of the chamber was counted under a microscope, and statistical analysis was performed while photographing.
(6) Cell proliferation potency assay
The Real-Time unlabelled dynamic cell Analysis (RTCA) technology is based on the principle that a microelectrode array is integrated at the bottom of each cell growth well of a cell culture plate, when the interface impedance of an adherent electrode is changed by cells growing on the surface of the microelectrode in an adherent manner, the change is related to the Real-Time functional state change of the cells, and biological information related to the physiological functions of the cells, including cell growth, extension, morphological change, death, adherence and the like, can be obtained through Real-Time dynamic electrode impedance detection.
a. 24 hours after transfection, well-grown tumor cells were digested and resuspended at a certain density
b. 1000 cells per well are inoculated in an xCELLigence RTCA MP E-plate 96 well plate, 4h is taken as cell adherence time, and cell index standardization analysis is carried out on the obtained growth curve by using RTCA Software 1.2.1 to analyze the proliferation condition of the cells.
(7) Statistical analysis
Experimental data a two-sided Student's t test was performed using the SPSS10.0 software package (SPSS, Chicago, IL) with significance for differences of p < 0.05.
Example 3: MicroRNA-4306 inhibits triple negative breast cancer cell growth and lung metastasis in vivo
(1) Nude mouse tumorigenesis experiment
The principle is that human triple negative breast cancer cells are planted in fat pads of female nude mice, and the tumorigenic capacity of different cells is observed. Constructing microRNA-4306 of a virus vector in Gyka, infecting a cell CAL-51 to obtain a stable cell line CAL-51-microRNA-4306 and CAL-51-contrast; two sides of a female nude mouse fat pad are respectively injected with a stable cell line CAL-51-microRNA-4306 and CAL-51-control cell for 200 ten thousand, and the growth condition of the tumor is observed and measured every three days.
(2) Experiment of tail vein of nude mouse
The principle is that the tumor cells are injected into the tail vein of a nude mouse, enter blood circulation and judge the transfer capacity of the tumor cells according to the condition of lung transfer of the nude mouse. Constructing microRNA-4306 of a virus vector in Gyka, infecting a cell CAL-51 to obtain a stable cell line CAL-51-microRNA-4306 and CAL-51-contrast; the tail vein of the female nude mouse is injected with stable cell lines CAL-51-microRNA-4306 and CAL-51-control cell 100 ten thousand respectively, the nude mouse is sacrificed after two months, and whether the lung of the nude mouse has metastasis is observed.
Example 4: MicroRNA-4306 promotes cisplatin-induced triple-negative breast cancer cell apoptosis
(1) Apoptosis assay
The principle is that in normal cells, phosphatidylserine is only distributed on the inner side of a lipid bilayer of a cell membrane, the cell undergoes the earliest apoptosis, and the membrane Phosphatidylserine (PS) turns from the inner side of the lipid membrane to the outer side, which is earlier than the apoptosis phenomena of cell shrinkage, chromatin condensation, DNA fragmentation, increased permeability of the cell membrane and the like. Annexin v is a phospholipid-binding protein with high affinity for phosphatidylserine, and thus can bind to the cell membrane of early apoptotic cells through phosphatidylserine exposed outside the cell. Therefore, annexin V is taken as one of sensitive indicators for detecting early apoptosis of cells. Propidium Iodide (PI) is a nucleic acid dye that cannot penetrate the intact cell membrane, but in cells in the middle and late stages of apoptosis, PI can penetrate the cell membrane to red the nucleus due to increased permeability of the cell membrane. Therefore, when Annexin V is combined with PI, PI is excluded from living cells (Annexin V-/PI-) and early apoptotic cells (Annexin V +/PI-), and late apoptotic cells and necrotic cells are stained by FITC and PI at the same time to be double positive (Annexin V +/PI +), and cells in different apoptosis stages can be distinguished by flow cytometry detection.
a. 24 hours after transfection, the tumor cells with good growth state are digested, resuspended at a certain density, then inoculated in a six-well plate, and treated with platinum drug (cisplatin) for 24 hours after cell adherence.
After 24h, adherent cells were digested with 0.25% pancreatin. And (4) collecting the cells. And (3) suspension cell collection: centrifuging for 5 minutes; and (3) washing cells: resuspending the cells once with precooled 1 XPBS (4 ℃), centrifuging at 2000rpm for 5-10 minutes, and washing the cells;
c. adding 300 mu L of 1 × Binding Buffer suspension cells;
annexin V-FITC labeling: adding 5 mu L Annexin V-FITC, mixing uniformly, keeping out of the sun, and incubating for 15 minutes at room temperature;
PI labeling: 5 μ L of PI was added for staining 5 minutes before loading.
f. Before loading, 200. mu.L of 1 XBinding Buffer is added.
g. And detecting the apoptosis condition by using a flow cytometer.
(2) Apoptosis-related protein change assay
The principle is that during apoptosis, Caspase3, Caspase8, Caspase9 and cleavage substrate PARP of Caspase are activated to degrade intracellular protein and make cell irreversibly die.
a. 24 hours after transfection, the tumor cells with good growth state are digested, resuspended at a certain density, then inoculated in a six-well plate, and treated with platinum drug (cisplatin) for 24 hours after cell adherence.
After 24h, cells were collected, centrifuged at 3000rpm for 5 min. Cell lysis: lysis solution (1% NP40+ proteasome inhibitor) was added to the collected cells to extract total cellular protein.
c. Western blotting detected Caspase3, Caspase8, Caspase9 and the cleavage substrate PARP. A10% polyacrylamide gel was prepared, and total protein of the cells was loaded at 40. mu.g per well, 120V, and electrophoresed. And after electrophoresis is finished, transferring the membrane by a wet method, and transferring the protein to the PVDF membrane. After 5% skim milk blocking, primary antibody was incubated. After overnight incubation of the primary antibody, the secondary antibody was incubated. Exposure was performed using Image Reader LAS-4000.
(3) Nude mouse treatment experiment
The principle is that after in vivo tumor formation of a nude mouse, microRNA-4306 is injected intratumorally, and cisplatin is injected intraperitoneally, so that the in vivo environment can be simulated, and the effect of the microRNA-4306 in combination with platinum drugs (cisplatin) on treatment of triple negative breast cancer is detected.
Balb/c nude mice, female, five weeks old, subcutaneous fat pad injected with triple negative breast cancer cell CAL-51,200 ten thousand. After 21 days, the tumor formation is about 5mm × 5mm × 5mm, and intratumoral injection of microRNA-4306 is started, and at the same time, intraperitoneal injection of platinum (cisplatin) is started.
MicroRNA-4306 is injected intratumorally, and a platinum drug (cisplatin) is injected intraperitoneally every three days, and the tumor size is measured weekly. After six weeks, the nude mice are sacrificed, tumor tissues are taken, tumor tissue proteins are extracted, protein immunoblotting is carried out to detect apoptosis-related proteins Caspase3, Caspase8, Caspase9 and PARP, and the apoptosis condition in the tumor tissues is observed.
Results
(1) High-expression target miRNA for transfecting triple-negative breast cancer cell line by chemically synthesized mature miRNA
Using lipofectamine 2000 to perform transient transfection on MDA-MB-231 or CAL-51 cells by using microRNA-4306 or miR-NC with the final concentration of 50nM during single transfection; cells were harvested 48 hours after transfection. And detecting the expression level of the microRNA-4306 by real-time PCR. After transfection, the expression of microRNA-4306 is respectively increased by 152.5 times and 146.01 times in MDA-MB-231 cell line compared with the control, and is respectively increased by 6222.7 times and 7033.3 times in CAL-51 cell line. The result shows that the expression level of the microRNA-4306 in the MDA-MB-231 and CAL-51 cell lines after transfection is obviously improved, and the transfection program and the system are suitable for corresponding research of miRNA high expression.
(2) Effect of high expression of microRNA-4306 on in vitro invasion capacity of MDA-MB-231 and CAL-51 cell lines
The research on the in vitro invasion capacity of the tumor cells is carried out by adopting a Transwell invasion experiment. 24 hours after transfection, MDA-MB-231 or CAL-51 cells were digested, resuspended in serum-free DMEM and 1X 10 cells, respectively4And 5X 104The amount of (2) was seeded in the upper chamber of a Transwell chamber, and 800. mu.l of DMEM containing 10% serum was added to the lower chamber of the chamber, and cultured at 37 ℃ for 12 hours, so that the cells entered the lower layer of a 8 μm-well polycarbonate membrane. 0.5% of crystal violet is stained, cells stained to be purple on a membrane can be seen under a microscope (fig. 6A and fig. 6B), the number of the cells on the lower surface of the polycarbonate membrane is counted, the number of the cells penetrating through the membrane of MDA-MB-231 cells transfected by microRNA-4306 is respectively 50.0% + -2.5% of the control, and the number of the cells penetrating through the membrane of CAL-51 cells is respectively 56.2% + -0.1% of the control, the result shows that compared with the control cells, the in vitro invasion capacity of the MDA-MB-231 and CAL-51 cells highly expressed by the microRNA-4306 is obviously weakened (fig. 6A and 6B), and the difference is obvious through statistical analysis.
(3) Influence of high expression of microRNA-4306 on migration capacity of MDA-MB-231 and CAL-51 cell lines
The research on the in vitro invasion capacity of the tumor cells is carried out by adopting a Transwell invasion experiment. 24 hours after transfection, theMDA-MB-231 or CAL-51 cells were digested, resuspended in serum-free DMEM and 1X 10 cells4And 5X 104The amount of (2) was seeded in the upper chamber of a Transwell chamber, and 800. mu.l of DMEM containing 10% serum was added to the lower chamber of the chamber, and cultured at 37 ℃ for 8 hours, so that the cells entered the lower layer of a 8 μm-well polycarbonate membrane. 0.5% of crystal violet staining, and cells stained purple on the membrane under a microscope (FIG. 6C, FIG. 6D), the number of cells on the lower surface of the polycarbonate membrane is counted, and the number of the MDA-MB-231 cells passing through the membrane after the transfection of the microRNA-4306 is calculated to be 46.2 +/-0.1% of the control respectively, and the number of the CAL-51 cells passing through the membrane is calculated to be 55.6% +/-0.2% of the control respectively. The results show that the MDA-MB-231 and CAL-51 cells with high expression of microRNA-4306 have obviously weakened in-vitro migration capability compared with the control cells (FIG. 6C and FIG. 6D), and the difference is significant through statistical analysis.
(4) Influence of high expression of microRNA-4306 on proliferation capacity of MDA-MB-231 and CAL-51 cell lines
The xCELLigence RTCA MP system is adopted to research the proliferation capacity of the tumor cells. 24 hours after transfection, MDA-MB-231 or CAL-51 cells were digested, resuspended in 10% serum DMEM, 1000 cells per well were seeded in xCELLigence RTCA MP E-plate 96 well plates, cell index normalization was performed on the resulting growth curve using RTCASoftware 1.2.1 for cell adhesion time, and cell proliferation was analyzed. The result shows that the MDA-MB-231 and CAL-51 cells with high expression of microRNA-4306 have obviously weakened in-vitro proliferation capacity compared with the control cells (figure 7), and the difference is significant through statistical analysis.
(5) MicroRNA-4306 inhibits triple negative breast cancer cell growth and lung metastasis in vivo
The influence of microRNA-4306 on the growth of triple negative breast cancer cells in vivo is observed by adopting a nude mouse fat pad tumor formation method. Constructing microRNA-4306 of a virus vector, infecting a cell CAL-51, and respectively injecting 200 million CAL-51-microRNA-4306 and CAL-51-control cells into a female nude mouse fat pad. The result shows that the microRNA-4306 inhibits the growth of the triple negative breast cancer cells in vivo.
The influence of microRNA-4306 on the transfer of triple negative breast cancer cells in vivo is observed by adopting a nude mouse tail vein injection method. Constructing microRNA-4306 of a virus vector, infecting a cell CAL-51, and respectively injecting 100 million CAL-51-microRNA-4306 and CAL-51-control cells into the tail vein of a female nude mouse. The result shows that the microRNA-4306 inhibits the metastasis of the triple negative breast cancer in vivo.
(6) Effect of microRNA-4306 on platinum drug (cisplatin) -induced apoptosis of MDA-MB-231 and CAL-51 cells
And detecting the apoptosis condition by adopting an Anexin V/PI kit and a flow cytometer. And (3) transfecting for 24h, digesting MDA-MB-231 or CAL-51 cells, inoculating the cells into a six-well plate at a certain concentration, treating the cells for 24h by using cisplatin after the cells are attached to the wall, collecting the cells, performing Anexin V/PI staining, and analyzing the apoptosis condition by using a flow cytometer. The result shows that the microRNA-4306 promotes platinum-based drug (cis-platinum) -induced MDA-MB-231 and CAL-51 cell apoptosis compared with the control cell.
And detecting the change of the apoptosis-related protein by adopting Western blotting. And (3) transfecting for 24h, digesting MDA-MB-231 or CAL-51 cells, inoculating the cells into a six-well plate at a certain concentration, treating the cells for 24h by using cis-platinum after the cells are attached to the wall, collecting the cells, and performing Western blotting. The result shows that compared with the control cell, the microRNA-4306 promotes the apoptosis of MDA-MB-231 and CAL-51 cells induced by the cisplatin, and the expression of apoptosis-related proteins is increased.
The treatment effect of the microRNA-4306 on triple negative breast cancer in vivo is detected by adopting a nude mouse treatment experiment. CAL-51 cells are inoculated on a fat pad of a female nude mouse, and after tumor formation, microRNA-4306 is injected intratumorally, and a platinum drug (cisplatin) is injected in an abdominal cavity. The result shows that compared with a control group, the tumor of the treatment group of the microRNA-4306 combined with the platinum drug (cisplatin) is smaller, the treatment effect is better, the apoptosis-related protein expression in the tumor tissue is higher, and the microRNA-4306 promotes the apoptosis of the platinum drug (cisplatin) -induced cell in vivo.
Claims (6)
1. Use of a microRNA molecule for the preparation of a medicament for the treatment of a patient suffering from triple negative breast cancer, wherein the microRNA molecule is microRNA-4306, the sequence of which is as set forth in SEQ ID NO: 1 is shown.
2. Use of a pharmaceutical composition for the manufacture of a medicament for treating a patient having triple negative breast cancer, wherein the pharmaceutical composition comprises the microRNA-4306 molecule of claim 1, and a pharmaceutically acceptable excipient.
3. The use of claim 2, wherein the pharmaceutical composition further comprises cisplatin.
4. One or more specific probes specifically detecting a polypeptide as set forth in SEQ ID NO: 1 in the technical scheme, the application of the primer and/or the probe with the microRNA-4306 molecule expression level in preparing a reagent for diagnosing a triple negative breast cancer patient, wherein the reagent is used for distinguishing triple negative breast cancer from non-triple negative breast cancer.
5. One or more specific probes specifically detecting a polypeptide as set forth in SEQ ID NO: 1 in the technical scheme, the application of the primer and/or the probe with the microRNA-4306 molecule expression level in the preparation of a reagent for diagnosing lymph node metastasis of a triple negative breast cancer patient is disclosed.
6. The use of claim 4 or 5, wherein the primer is as set forth in SEQ ID NO: 2-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510813090.0A CN106729751B (en) | 2015-11-20 | 2015-11-20 | Application of microRNA molecule in detection and treatment of breast cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510813090.0A CN106729751B (en) | 2015-11-20 | 2015-11-20 | Application of microRNA molecule in detection and treatment of breast cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106729751A CN106729751A (en) | 2017-05-31 |
| CN106729751B true CN106729751B (en) | 2020-03-06 |
Family
ID=58885120
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510813090.0A Active CN106729751B (en) | 2015-11-20 | 2015-11-20 | Application of microRNA molecule in detection and treatment of breast cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106729751B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020001473A1 (en) * | 2018-06-28 | 2020-01-02 | 复旦大学 | Use of small nucleolar ribonucleic acid snord33 as biomarker for preparation of detection kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107429295A (en) * | 2015-03-09 | 2017-12-01 | 新加坡科技研究局 | The method of risk to suffer from breast cancer is determined by detecting the expression of Microrna (miRNA) |
-
2015
- 2015-11-20 CN CN201510813090.0A patent/CN106729751B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107429295A (en) * | 2015-03-09 | 2017-12-01 | 新加坡科技研究局 | The method of risk to suffer from breast cancer is determined by detecting the expression of Microrna (miRNA) |
Non-Patent Citations (4)
| Title |
|---|
| Deep Sequencing the microRNA profile in rhabdomyosarcoma reveals down-regulation of miR-378 family members;Francesca Megiorni，et al;《BMC Cancer》;20141231;1-17页 * |
| Differential Distribution of microRNAs in Breast Cancer Grouped by Clinicopathological Subtypes;Jian-Yi Li,et al;《Asian Pacific Journal of Cancer Prevention》;20131231;第14卷;3197-3203页 * |
| miRNA expression patterns in normal breast tissue and invasive breast cancers of BRCA1 and BRCA2 germ-line mutation carriers;Shoko Vos，et al;《Oncotarget》;20150911;第6卷(第31期);32115-32137页 * |
| Transcriptional Downregulation of miR-4306 serves as a New Therapeutic Target for Triple Negative Breast Cancer;Zitong Zhao，et al;《Theranostics》;20190220;第9卷(第5期);1401-1416页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106729751A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107881241B (en) | Application of gene marker in diagnosis and treatment of breast cancer | |
| CN106191067B (en) | Circular rna circ-NFATC3 and application thereof | |
| CN107586781B (en) | Liver cancer marker lncRNA ENST00000620463.1 and application thereof | |
| CN106995858A (en) | A kind of lncRNA related to liver cancer diagnosis and treatment | |
| CN108753969A (en) | Application of the long-chain non-coding RNA in hepatocellular carcinoma diagnosis and treatment | |
| CN107586850B (en) | Application of non-coding gene in diagnosis and treatment of liver cancer | |
| CN106929577B (en) | lncRNA biomarker related to lung adenocarcinoma | |
| CN108034725A (en) | Applications of the LINC02185 in breast cancer diagnosis and treatment | |
| CN108085389B (en) | LncRNA related to breast cancer and application thereof | |
| CN111172290B (en) | MiRNA for diagnosis and treatment of hepatocellular carcinoma | |
| CN107267616B (en) | Application of non-coding gene biomarker in liver cancer | |
| CN106729751B (en) | Application of microRNA molecule in detection and treatment of breast cancer | |
| CN112575080A (en) | Application of long-chain non-coding RNA molecule in diagnosis and/or treatment of esophageal squamous cell carcinoma | |
| CN106995857B (en) | Application of biomarker ENSG00000267416 in cancer | |
| JP5546064B2 (en) | Use of two microRNAs in lung cancer prognosis and drug preparation | |
| CN108660211A (en) | A kind of and the relevant biomarker LINC01549 of hepatocellular carcinoma and its application | |
| CN105441405A (en) | A BMX spliceosome and applications thereof in lung cancer drug resistance | |
| CN108707672A (en) | Applications of the DUXAP8 in diagnosis of hepatoma and treatment | |
| CN106868183A (en) | Applications of the WFDC21P in liver cancer diagnosis and treatment | |
| CN107184983B (en) | Diagnosis and treatment target for lung adenocarcinoma | |
| CN111733247A (en) | Application of long-chain non-coding RNA in cancer diagnosis and treatment | |
| CN107058534B (en) | Biomarker ENSG00000248884 for liver cancer and application thereof | |
| CN105861736B (en) | Application of miRNA in endometrial cancer diagnosis and treatment | |
| CN112575081B (en) | Application of long-chain non-coding RNA molecule in diagnosis and/or treatment of triple negative breast cancer | |
| CN108624689A (en) | The application of biomarker LINC01451 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |