CN113637763A

CN113637763A - Application of miRNA biomarker in early diagnosis and treatment of melanoma

Info

Publication number: CN113637763A
Application number: CN202111206823.6A
Authority: CN
Inventors: 崔明鹿; 杨志强; 孔云; 张仙
Original assignee: Beijing Baiaosike Biomedical Technology Co ltd
Current assignee: Beijing Baiaosike Biomedical Technology Co ltd
Priority date: 2021-10-15
Filing date: 2021-10-15
Publication date: 2021-11-12

Abstract

The invention discloses application of miRNA biomarkers in early diagnosis and treatment of melanoma, wherein the miRNA biomarkers comprise miR-431, miR-891b, miR-431 and miR-891b are obviously reduced in a sample of a melanoma patient, and the combination of the miRNA biomarkers miR-431 and miR-891b has good diagnosis efficiency on melanoma, and miR-431 and miR-891b have a synergistic effect when being combined for treating melanoma, so that the miRNA biomarkers can be used for auxiliary diagnosis and treatment of melanoma.

Description

Application of miRNA biomarker in early diagnosis and treatment of melanoma

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of miRNA biomarkers in early diagnosis and treatment of melanoma, more particularly to miRNA biomarkers comprising miR-431 and miR-891 b.

Background

MicroRNA (miRNA) is a non-coding small molecule RNA (18-25 nt), which is combined with a complementary sequence in a3 'untranslated region (3' UTR) of a target gene, and regulates the expression of the gene at the post-transcriptional level by degrading mRNA or inhibiting the process of protein translation, and is closely related to the processes of tumor occurrence, metastasis, prognosis and the like (Mueller DW, Bosserhoff AK. Role of miRNAs in the regression of malignant melanomema [ J ]. Cancer, 2009, 101: 551 and 556). miRNA controls 30% of human protein by 1%, and plays an important role in the generation and development of tumors. There is increasing evidence that mirnas are differentially expressed in early human tumors and can act as cancer suppressor or oncogenes to regulate tumor development, development and metastasis (Kong YW, Ferland-McCollough D, Jackson TJ, et al micro rnas in cancer management [ J ]. Lancet Oncol, 2012, 13(6): 249-258.).

Melanoma (melaoma) is a highly invasive malignant tumor, which occurs in the skin, the oral mucosa, etc., and occupies the third place (about 6.8% -20%) of malignant tumors of the skin, and is pathologically inferior to squamous cell carcinoma and basal cell carcinoma. Worldwide, Melanoma causes 75% of patient-related deaths, with mortality leading among cutaneous malignancies, with 5-year survival rates for invasive Melanoma patients of only 15% (Gray-Schopper V, Wellbrock C, Marais R. Melanoma biology and new targeted therapy [ J ]. Nature, 2007, 445 (7130): 851-) -857.). At present, the annual growth rate of melanoma is about 3%, which is one of the most rapidly growing malignant tumors (Garbe C, Peris K, Hauschild A, et al. Diagnosis and treatment of melanoma: European consensus-based internedification Guideline [ J ]. Cancer, 2010, 46(2): 270-.

In recent years, with the development of gene sequencing, transcriptomics and bioinformatics, more and more researches show that miRNA is a key regulatory factor for tumor occurrence and development, is also a useful marker for diagnosis and prognosis in human cancers, can guide cancer treatment (Ventura A, Jacks T. MicroRNAs and cancer: short RNAs go a long way [ J ] Cell, 2009, 136(1): 586-91), and similarly, miRNA is also proved to participate in the generation and development process of melanoma, so that new miRNA related to melanoma is discovered, the related molecular mechanism of miRNA influencing the generation and development of melanoma is deeply understood, and a new molecular target spot is provided for clinical treatment of melanoma.

Disclosure of Invention

The invention aims to provide application of miRNA biomarkers in early diagnosis and treatment of melanoma, wherein the miRNA biomarkers comprise miR-431 and miR-891 b.

In order to achieve the purpose, the invention adopts the following technical scheme:

in one aspect, the invention provides application of a reagent for detecting expression levels of biomarkers miR-431 and miR-891b in preparation of a product for diagnosing melanoma.

Further, the expression levels of the biomarkers miR-431 and miR-891b in a sample of a melanoma patient are significantly down-regulated;

preferably, the sample comprises blood, tissue, sputum, urine, pleural effusion;

more preferably, the sample is blood.

Further, the agent is selected from:

oligonucleotide probes specifically recognizing the biomarkers miR-431 and miR-891 b; or

Primers for specifically amplifying the biomarkers miR-431 and miR-891 b.

Further, the sequences of primers for specifically amplifying the biomarkers miR-431 and miR-891b are respectively shown as SEQ ID NO 7-SEQ ID NO 8 and SEQ ID NO 9-SEQ ID NO 10.

In another aspect, the invention provides a product for diagnosing melanoma.

Further, the product comprises a reagent for detecting biomarkers in a sample to be detected, wherein the biomarkers are miR-431 and miR-891 b;

the product comprises a kit and a chip;

the kit comprises primers, probes or chips which are specifically combined with miR-431 and miR-891 b;

the chip comprises a solid phase carrier and probes which are attached to the solid phase carrier and specifically recognize miR-431 and miR-891 b.

Further, the preparation of the chip can be carried out by a conventional preparation method of a biochip known in the art.

Further, as an alternative embodiment, the kit comprises one or more probes specifically binding to the miRNA biomarkers miR-431 and miR-891 b. As a further embodiment, the kit further comprises a washing solution, and as a further embodiment, the kit further comprises reagents for performing a hybridization experiment, means for isolating or purifying nucleic acids, detection means, and a positive control and a negative control, and as a further embodiment, the kit further comprises instructions for using the kit, wherein the instructions describe how to use the kit for detection, and how to use the detection results for determining the occurrence or progression of melanoma, and for selecting a treatment regimen. Such a kit may employ, for example, a test strip, membrane, chip, tray, test strip, filter, microsphere, slide, multiwell plate, or optical fiber. The solid support of the kit can be plastic, silicon, metal, resin, glass, membrane, particle, precipitate, gel, polymer, sheet, sphere, polysaccharide, capillary, film, plate, or slide.

Further, the product detects the expression levels of the biomarkers miR-431 and miR-891b through RT-PCR, real-time quantitative PCR, in-situ hybridization, a chip or a high-throughput sequencing platform.

The RT-PCR of the invention refers to reverse transcription polymerase chain reaction, the real-time quantitative PCR of the invention refers to real-time quantitative polymerase chain reaction, the PCR usually uses denaturation, primer pair and opposite strand annealing and primer extension multiple cycles, increase the copy number of the target nucleic acid sequence in an exponential manner; RT-PCR uses reverse transcriptase to make complementary DNA (cDNA) from mRNA, and the cDNA is amplified by PCR to produce multiple copies of the DNA.

The in situ hybridization is a process of hybridizing specific labeled known sequence nucleic acid serving as a probe with nucleic acid in a cell or tissue slice so as to accurately and quantitatively position a specific nucleic acid sequence, and the in situ hybridization can be performed on a cell specimen or a tissue specimen.

The chip detection of the present invention refers to gene chip detection, also called biochip detection, which refers to that a large number of probe molecules are fixed on a support, then hybridized with a labeled sample, and the sequence and the number of target molecules are analyzed by detecting the intensity and the distribution of hybridization signals.

Furthermore, the sample to be detected comprises blood, tissue, sputum, urine and pleural effusion;

preferably, the sample is blood.

Further, the sample to be tested according to the present invention is derived from a subject.

Further, the subject refers to any animal, also to human and non-human animals. The term "non-human animal" includes all vertebrates, e.g., mammals, such as non-human primates (particularly higher primates), sheep, dogs, rodents (such as mice or rats), guinea pigs, goats, pigs, cats, rabbits, cattle, and any domestic or pet animal; and non-mammals, such as chickens, amphibians, reptiles, and the like.

Further, in particular embodiments of the present invention, the subject is preferably a human.

The "expression level" or "expression amount" of the biomarker according to the present invention refers to the level of the biomarker detectable in a biological sample, which can be detected by any detection method known to those skilled in the art, and in a specific embodiment of the present invention, the biomarker includes miR-431 and miR-891b, and preferably, the biomarker is miR-431 and miR-891 b.

By "down-regulated" as used herein, is meant a gene in which the expression of a miRNA, relative to a control, exhibits a decrease in expression of the miRNA of at least 10% or more, e.g., 20%, 30%, 40% or 50%, 60%, 70%, 80%, 90% or less than 1.0-fold, 0.8-fold, 0.6-fold, 0.4-fold, 0.2-fold, 0.1-fold or less. For example, a down-regulated miRNA includes a miRNA that has a reduced level of expression of a corresponding miRNA in a sample isolated from an individual characterized as having melanoma, as compared to a sample isolated from a normal individual.

The promoter or the promoter for increasing the expression level of the biomarker in the invention refers to miRNA mimics, wherein the miRNA mimics is miRNA simulating endogenous in organisms, and is synthesized by a chemical synthesis method, so that the function of the endogenous miRNA can be enhanced. The miRNA mimics the high-level expression of endogenous mature miRNA in cells so as to enhance the regulation and control effect of the endogenous miRNA, and is a great advantage for miRNA function research. The miRNA mimics are a simple and efficient miRNA research tool, can be transfected into cells only by being wrapped by a transfection reagent, do not need complicated operation of constructing a vector, do not need worry about virus protection, and can observe the transfection efficiency by using a transfection contrast. The transfection effect of miRNA mimics can be detected from the aspects of RNA expression level, protein expression level, cell function and the like of target genes. The experiments can obtain biological function data of miRNA and be applied to target gene verification of miRNA. Typically these experiments involve transfection of miRNA mimics.

On the other hand, the invention provides application of biomarkers miR-431 and miR-891b in preparation of a pharmaceutical composition for treating melanoma.

Further, the pharmaceutical composition comprises a promoter for increasing the expression levels of miR-431 and miR-891 b;

the sequence of the accelerant for increasing the miR-431 expression level is shown as SEQ ID NO 1-SEQ ID NO 2;

the promoter for increasing the expression level of miR-891b has a sequence shown in SEQ ID NO. 3-SEQ ID NO. 4.

In another aspect, the present invention provides a pharmaceutical composition for treating melanoma.

Further, the promoting agent of the present invention may be administered to a subject by any means suitable for delivering a double stranded molecule to a cancer site. For example, the double-stranded molecule can be administered by gene gun, electroporation, or other suitable parenteral or enteral routes of administration.

Further, suitable enteral routes of administration include oral, rectal, or intranasal delivery.

Further, suitable routes of parenteral administration include intravascular administration (e.g., intravenous bolus, intravenous infusion, intra-arterial bolus, intra-arterial infusion, and catheter instillation to the vascular network), peri-and intra-tissue injection (e.g., peri-and intra-tumoral injection), subcutaneous injection or deposition, including subcutaneous infusion (e.g., using osmotic pressure pumps), direct application to the cancer site or an area near it, e.g., via a catheter or other placement device (e.g., a suppository or implant comprising a porous, non-porous, or gelatinous material), and inhalation. Preferably, the double-stranded molecule or vector is administered to or near the cancer site by injection or infusion.

Further, the double-stranded molecules of the invention may be administered in a single dose or in divided doses. When the administration of the double-stranded molecule of the invention is by infusion, the infusion may be a single continuous dose, or may be administered by multiple infusions. Preferably, the agent is injected directly into the tissue at or near the cancer site, more preferably, the agent is injected multiple times into the tissue at or near the cancer site.

Further, the pharmaceutical composition of the present invention may further comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include: stabilizing agent, antioxidant, osmotic pressure regulator, buffer and pH regulator. Suitable additives include: a physiologically biocompatible buffer (e.g., trometamol hydrochloride), supplemental chelator (e.g., DTPA or DTPA-bisamide, etc.), or a calcium chelator complex (e.g., calcium DTPA, CaNaDTPA-bisamide), or, optionally, supplemental calcium or sodium salt (e.g., calcium chloride, calcium ascorbate, calcium gluconate, or calcium lactate). The pharmaceutical compositions of the present invention may be packaged for use as a liquid or may be lyophilized.

Further, as one of the forms of the pharmaceutical composition of the present invention, a conventional non-toxic solid carrier may be used; for example, pharmaceutical grades of mannitol, lactic acid, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.

Further, any of the carriers and excipients listed above, as well as 10% to 95%, preferably 25% to 75% of the aforementioned double-stranded molecule of the invention (i.e., the double-stranded molecule comprised in the enhancer) may be comprised in a solid pharmaceutical composition for oral administration;

further, the pharmaceutical composition for aerosol (inhalation) administration may comprise 0.01-20 wt.%, preferably 1-10 wt.% of one or more of the aforementioned double-stranded molecules of the invention (i.e. the double-stranded molecules comprised in the enhancer) encapsulated in liposomes, and a propellant. Carriers such as lecithin for intranasal delivery and the like may also be included as desired.

In addition to the above, other pharmaceutically active ingredients may be included in the pharmaceutical composition of the present invention as long as they do not inhibit the in vivo function of the aforementioned double-stranded molecule of the present invention (i.e., the double-stranded molecule included in the enhancer). For example, the pharmaceutical composition of the present invention may further comprise conventional drugs for melanoma treatment or chemotherapy.

In another aspect, the invention provides application of the biomarkers miR-431 and miR-891b in screening candidate substances for preventing and/or treating melanoma.

In another aspect, the present invention provides a method of screening a candidate substance for preventing and/or treating melanoma.

Further, the method comprises the steps of:

(1) contacting a test agent with cells containing or expressing miR-431 and miR-891 b;

(2) detecting the expression level of miR-431 and miR-891b in the cell;

and comparing the expression levels of the miR-431 and miR-891b detected in the absence of the test substance, and selecting the test substance capable of increasing the expression levels of the miR-431 and miR-891b as a candidate substance.

The sequences of the biomarkers miR-431 and miR-891b disclosed by the invention can be inquired in a miRBase database (http:// microrna. sanger. ac. uk /), wherein the sequence of miR-431 is shown as SEQ ID NO:13, and the sequence of miR-891b is shown as SEQ ID NO: 14;

sequence of miR-431:

UCCUGCUUGUCCUGCGAGGUGUCUUGCAGGCCGUCAUGCAGGCCACACUGACGGUAACGUUGCAGGUCGUCUUGCAGGGCUUCUCGCAAGACGACAUCCUCAUCACCAACGACG（SEQ ID NO:13）

sequence of miR-891 b:

CCUUAAUCCUUGCAACUUACCUGAGUCAUUGAUUCAGUAAAACAUUCAAUGGCACAUGUUUGUUGUUAGGGUCAAAAGA（SEQ ID NO:14）

further, the miR-431 and miR-891b are selected from the following components: miR-431 and miR-891b initial miRNAs, miR-431 and miR-891b precursor miRNAs, and miR-431 and miR-891b mature miRNAs.

Further, it will be appreciated by those skilled in the art that miR-431 and miR-891b in the present embodiments include functional equivalents of constitutive nucleic acid molecules, i.e., variants, which exhibit the same function as the intact miR-431 and miR-891b nucleic acid molecules, although they are mutated by deletion, substitution or insertion of nucleotide residues.

Further, it is well known in the art that in order to ensure the stability of miRNA, protective bases such as TT may be added to one or both ends of miRNA, and miRNA bases may also be modified, but the function of miRNA is not affected. Therefore, the sequences obtained by base modification of miR-431 and miR-891b or base addition at two ends under the condition of not influencing the functions of miR-431 and miR-891b are well known to those skilled in the art and are also included in the protection scope of the invention.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 shows graphs showing the results of miR-431 and miR-891b differentially expressed between the control group and the melanoma group, wherein, A is a graph: miR-431, Panel B: miR-891 b;

FIG. 2 shows the results of ROC curves for verifying the diagnostic efficacy of miR-431 and miR-891b on melanoma, wherein, A is shown as follows: miR-431, Panel B: miR-891 b;

FIG. 3 shows a ROC curve result chart of the validation of the diagnostic efficacy of the combination of miR-431+ miR-891b on melanoma;

FIG. 4 is a graph showing the results of the relative expression amounts of miR-431 and miR-891b, wherein A is a graph: miR-431, Panel B: miR-891 b;

FIG. 5 is a graph showing the results of the effect of miR-431, miR-891b, miR-431+ miR-891b combination on melanoma cell apoptosis rate, wherein, A is: blank control, panel B: negative control group, panel C: miR-431 mimics group, panel D: miR-891b mimics group, panel E: miR-431 mimics + miR-891b mimics group.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The following examples are examples of experimental methods not indicating specific conditions, and the detection is usually carried out according to conventional conditions or according to the conditions recommended by the manufacturers.

Example 1 screening of genes differentially expressed in melanoma

1. Data sourcing and processing

Public Gene Expression data and complete clinical annotations were searched in a Gene Expression integration database (Gene Expression Omnibus, GEO), and a Melanoma (Melanoma) Gene Expression dataset GSE20994 was downloaded from the GEO database (http:// www.ncbi.nlm.nih.gov/GEO /), including blood sample data of healthy controls and Melanoma patients, at a sample size of Case: normal = 35: and 22, annotating the gene expression matrix by using an annotation file, taking an average value of a plurality of probes corresponding to the same gene as the expression quantity of the gene expression matrix, and then obtaining the gene expression matrix file.

2. Differential expression analysis

Differential expression analysis was performed on the data using the "limma" package in the R software, where the screening criteria for differentially expressed genes were: | log₂FC|>0.5，adj.P value<0.05。

3. Results of the experiment

The experimental result shows that 397 differentially expressed genes are obtained in total by screening, 190 up-regulated differentially expressed genes are obtained, 207 down-regulated differentially expressed genes are obtained, and the expressions of the biomarkers miR-431 and miR-891B related to the invention in blood samples of melanoma patients are remarkably reduced, and the results are shown in Table 1, figure 1A and figure 1B.

TABLE 1 results of differential expression of miR-431 and miR-891b

Example 2 verification of miR-431 and miR-891b diagnostic efficacy

1. Experimental methods

Receiver Operating Characteristic (ROC) analysis is performed by using the R package 'pROC', an ROC curve is drawn, AUC values, sensitivities and specificities of the differentially expressed genes miR-431, miR-891b and miR-431+ miR-891b which are obtained by screening in the example 1 and are used as detection variables are respectively analyzed, the diagnosis efficiency of the indexes miR-431, miR-891b and miR-431+ miR-891b on melanoma is judged, and the expression quantity of miRNA is directly used for analysis when the diagnosis efficiency of single miRNA is judged. Calling a pROC package, reading in an expression quantity matrix constructed by target miRNA, and running a command for drawing an ROC curve, wherein the command adopts for circulation and simultaneously relates to a command for adding AUC, Thres (threshold value) and Smooth (fitted curve). When the diagnosis efficiency of miRNA combination is judged, firstly, Logistic regression analysis is carried out on miRNA by using glmnet, the influence of certain prediction variable on result probability at each level is observed by using a prediction function by using an established Logistic regression model, the prediction probability is calculated, an ROC curve of the prediction result is drawn, and the diagnosis efficiency of miR-431, miR-891b and miR-431+ miR-891b is analyzed.

2. Results of the experiment

The results are shown in the table 2 and fig. 2A, fig. 2B and fig. 3, and it can be seen from the results that the combined application of the miR-431 and the miR-891B to the diagnosis of melanoma has higher accuracy, sensitivity and specificity, the AUC value is 0.913, and is significantly superior to the diagnostic efficacy of the single genes miR-431 and miR-891B, which indicates that the combination of the miR-431 and the miR-891B has better diagnostic efficacy.

TABLE 2 diagnostic potency results for miR-431, miR-891b, miR-431+ miR-891b

Example 3 study on the relationship between the expression of miR-431 and miR-891b and the apoptosis of melanoma cells

1. Experimental Material

The main experimental equipment, experimental reagents and consumables involved in the experiment are shown in tables 3 and 4.

TABLE 3 Main Equipment involved in the experiment

TABLE 4 major reagents involved in the experiment

2. Cell source

Melanoma cells A375 were purchased from Shanghai institute of cell biology, Chinese academy of sciences and were introduced for long term culture in the laboratory. A375 culture medium is DMEM +10% FBS +1% P/S solution at 37 deg.C and 5% CO₂Culturing under the conditions of 95% air and saturated humidity.

3. Cell culture

(1) A375 melanoma cell resuscitation

The cell recovery method adopts a method of rapid melting in a water bath. Before the experiment, the protection is carried out, and the glove is wornAnd a protective mask, taking out an A375 melanoma cell cryopreservation tube from liquid nitrogen, paying attention to observing information such as label name, cryopreservation date and the like, determining that the cell is the required cell, quickly putting the tube into a prepared water bath kettle at 37 ℃, quickly completing the whole process, completely melting the cryopreservation liquid within 1 min, paying attention to aseptic operation to prevent infection, particularly paying attention to bottle cap protection, transferring the frozen cell into a centrifuge tube by using a suction tube after melting, adding PBS buffer solution for uniformly blowing, ensuring that the frozen cell is completely melted into the PBS buffer solution, putting the centrifuge tube into a centrifuge, adjusting the rotation speed to 1000 rpm/min, maintaining the time for about 5 min, taking out supernatant, retaining substances at the bottom layer of the centrifuge tube, adding a proper amount of DMEM (dimethyl ether) to completely culture medium for re-suspension, planting the cell into a T25 culture bottle according to the ratio of 1:2, adding 5 mL of DMEMF (complete EMF) culture medium into each culture bottle, round cells in suspension were visualized under the mirror, indicating that the cells had been successfully transferred, and then placed in a chamber containing 5% CO₂Culturing in a cell incubator at constant temperature of 37 ℃;

(2) a375 melanoma cell exchange solution

The time for A375 melanoma cells to begin to adhere to the wall is about 4-6 hours generally, the cells can be adhered to the wall completely within one day generally, the cells after adhering to the wall are polygonal, the cells can be changed according to the color of the observed culture solution and the observation condition under a mirror, the DMEM complete culture medium is required to be preheated in a constant-temperature water bath kettle at 37 ℃, a Pasteur tube can be used for sucking the old culture solution on the cells, the cells do not contact the lower part of the culture dish as far as possible, scratches caused by bottom-layer cells are prevented, and the cells are not uniformly grown. Washing with 37 deg.C water bath preheated PBS buffer solution slowly along the side wall to remove some necrotic cells, washing with 37 deg.C water bath preheated PBS three times, adding 37 deg.C water bath preheated 5 mL DMEM complete culture medium into the culture dish, and adding 5% CO₂And culturing in a constant-temperature incubator at 37 ℃. The whole process is carried out aseptically, the pasteur tube is discarded in time after contacting the outside, the process is clean and convenient, and the long time is not suitable;

(3) passage of A375 melanoma cells

About 2-3 days, the A375 melanoma cells can reach 80% -100% cell fusion,at this point, cell passaging was performed. Before the experiment, personal protection is carried out, a Pasteur tube is used in an ultra-clean workbench which is disinfected for 30 min in advance, old culture solution is sucked away, PBS preheated by 37 ℃ water bath is used for washing three times, 1 mL of trypsin with the concentration of 0.25% is added, the mixture is put into a37 ℃ constant-temperature incubator and is timed for about 1 min, whether cells are completely digested can be determined by observing under an inverted microscope, if most of round cells are suspended, the digestion of the trypsin can be stopped, 1-2 mL of DMEM/F-12 complete culture medium preheated by 37 ℃ water bath is added, 5-10 mL of DMEM/F-12 complete culture medium preheated by 1-2 mL of 37 ℃ water bath is added, the cells are blown in time to enable the cells to be completely suspended in solution, then the cells are transferred into a centrifuge tube, a centrifuge is balanced, the rotating speed is adjusted to be 1000 rpm/min, the centrifugation time is about 5 min, passage is carried out according to the proportion of 1:3-1:5, placing 5-10 mL DMEM/F-12 complete culture medium into the culture dish, placing at 37 deg.C and 5% CO₂The cell incubator of (1) for culturing.

4. Cell transfection

(1) Taking A375 cells in logarithmic growth phase, and adjusting cell density to 1 × 10 with culture medium⁵The cells are inoculated into 6-hole plates, 2 mL of cell suspension is added into each hole, each group comprises two holes, and the cells are cultured overnight at 37 ℃;

(2) 2 hours before transfection, the medium is changed into a serum-free medium;

(3) the transfection procedure, for each transfection sample, was prepared as follows:

1) counting cells one day before transfection, adding 1 mL into 6-well plate to make cell density of the plate not less than 2 × 10⁵A plurality of;

2) for each well of cells, 10. mu.L of 100 nM mix was diluted in 250. mu.L of serum free medium and incubated for 5 min at room temperature;

3) for each well of cells, 5 μ L Lipo2000 was diluted with 250 μ L serum free medium and incubated for 5 min at room temperature;

4) mixing the liquids in the step 2) and the step 3), and incubating for 20 min at room temperature;

5) replacing pre-divided adherent cells with serum-free medium, adding the above complex, and culturing at 37 deg.C with 5% CO₂Culturing for 6 hr, and culturing in growth medium containing serumContinued at 37 ℃ with 5% CO₂And culturing for 48 hours. Collecting a cell sample, washing twice with PBS, discarding liquid, and extracting RNA subsequently;

the experiments were set up as 3 groups: blank control group (A375 melanoma cells), negative control group (mimics-NC group) and experimental group (mimics group).

Wherein the sequence information of the mimics aiming at miR-431 is as follows:

sense strand 5'-UGUCUUGCAGGCCGUCAUGCA-3' (SEQ ID NO: 1)

The antisense strand is 5'-UGCAUGACGGCCUGCAAGACA-3' (SEQ ID NO: 2)

The sequence information of the mimics for miR-891b is as follows:

the sense strand is 5'-UGCAACUUACCUGAGUCAUUGA-3' (SEQ ID NO: 3)

The antisense strand is 5'-UCAAUGACUCAGGUAAGUUGCA-3' (SEQ ID NO: 4)

The sequence information of the mimics-NC is as follows:

the sense strand is 5'-UUUGUACUACACAAAAGUACUG-3' (SEQ ID NO: 5)

The antisense strand is 5'-CAGUACUUUUGUGUAGUACAAA-3' (SEQ ID NO: 6)

5. QPCR (quantitative polymerase chain reaction) detection of expression levels of miR-431 and miR-891b in cells

(1) Extraction of sample Total RNA (Trizol method)

1) Taking a proper amount of a sample to be detected, adding liquid nitrogen, grinding and crushing;

2) the ground samples were transferred to 1.5 mL EP tubes with 1 mL Trizol;

3) adding 500 mu L of phenol chloride into a 1.5 mL EP tube, shaking and mixing uniformly, and standing for 5 minutes;

4) centrifuge at 12000 rpm for 10 minutes at 4 ℃ and carefully pipette the supernatant into a new 1.5 mL EP tube;

5) adding 700 μ L isopropanol into the separated supernatant, and mixing well;

6) centrifuging at 12000 rpm at 4 deg.C for 10 min, and carefully discarding the supernatant;

7) washing the precipitate with 75% ethanol once, and air drying at room temperature;

8) dissolving the RNA precipitate by 50 mu L DEPC water;

9) and (5) detecting by agarose gel electrophoresis.

(2) Total RNA quality detection

1) The concentration and purity of RNA were determined using a nucleic acid concentration meter, which was previously zeroed with DEPC water for RNA lysis, and the procedure was as follows: lifting the sample arm to apply the sample to the test base; the sample arm was lowered and absorbance detection was initiated using software on the computer. A sample column can be automatically pulled out between the upper optical fiber and the lower optical fiber, and then detection is carried out; after the detection is finished, lifting the sample arm, and wiping the samples on the upper base and the lower base clean by clean dust-free paper;

2) and (3) concentration determination: a reading at 260 nm of 1 indicates 40 ng RNA/μ L. The formula for calculating the RNA concentration of the sample is as follows: A260X 40 ng/muL;

3) and (3) purity detection: the ratio of A260/A280 of the RNA solution is a method for detecting RNA purity, and the ratio ranges from 1.8 to 2.1.

(3) Reverse transcription to synthesize cDNA

Reverse transcription was performed using the Invitrogen reverse transcription kit superscript III;

the reaction system 1 was established as shown in Table 5, mixed, centrifuged at 65 ℃ for 5 minutes, and then placed on ice;

TABLE 5 composition of reaction System 1

The reaction system 2 was set up as shown in Table 6;

TABLE 6 composition of reaction System 2

Mixing, centrifuging, and placing at 42 deg.C in water bath for 60 min; taking out, reacting at 85 deg.C for 10 min, inactivating reverse transcriptase, and standing at-20 deg.C.

(4) Real-time fluorescent quantitative detection

Firstly, designing amplification primers of QPCR, wherein specific primer sequences are as follows:

miR-431：

the forward primer was 5'-TGTCTTGCAGGCCGTCATG-3' (SEQ ID NO: 7);

the reverse primer is 5'-CTCAACTGGTGTCGTG-3' (SEQ ID NO: 8);

miR-891b：

the forward primer was 5'-TGCAACTTACCTGAGTCAT-3' (SEQ ID NO: 9);

the reverse primer is 5'-CTCAACTGGTGTCGTG-3' (SEQ ID NO: 10);

u6 internal reference primer:

the forward primer was 5'-GCTTCGGCAGCACATATACTAAAAT-3' (SEQ ID NO: 11);

the reverse primer is 5'-CGCTTCACGAATTTGCGTGTCAT-3' (SEQ ID NO: 12);

the Real time PCR reaction system is set up as shown in Table 7;

TABLE 7 Real time PCR reaction System

After the system is mixed uniformly, the mixture is instantaneously separated and placed on a fluorescence quantitative PCR instrument for detection, and the reaction is carried out according to the conditions shown in the table 8;

TABLE 8 Realtime PCR reaction conditions

And analyzing relative quantitative results of each group of samples, wherein the calculation formulas of the relative expression amounts of miR-431 and miR-891b are as follows:

6. apoptosis assay

In the embodiment, flow cytometry is adopted to detect the influence of miR-431, miR-891b and miR-431+ miR-891b expression on A375 melanoma cell apoptosis, firstly collecting A375 melanoma cells which are not transfected, are transfected with miR-431 mimics, are transfected with miR-891b mimics, and are simultaneously transfected with miR-431 mimics and miR-891b mimics, washing the cells, then fixing the cells with ethanol, carrying out cell resuspension and cell filtration, dyeing by adopting PI dye solution, and then detecting by adopting a flow cytometer;

in the apoptosis detection, different quadrants in a flow cytometry detection result chart represent different meanings, Q1-1 (annexin V-FITC) -/PI + represents necrotic cells, Q1-2 (annexin V + FITC) +/PI + represents middle and late apoptotic cells, Q1-4 (annexin V-FITC) +/PI-represents early apoptotic cells, Q1-3 (annexin V-FITC) -/PI-represents normal living cells, the percentage of each quadrant represents the proportion of corresponding cells, and the total apoptosis rate = middle and late apoptosis rate + early apoptosis rate.

7. Results of the experiment

The transfection result shows that, with the expression level of the blank control group miR-431 as a reference set as 1, compared with the expression level of the blank control group miR-431 (the relative expression level is 1) and the expression level of the negative control group miR-431 transfected with the mimics-NC (the NC group), the expression level of the miR-431 of the experimental group transfected with the miR-431 mimics is obviously up-regulated, and the difference has statistical significance (P < 0.05), while the blank control group and the negative control group have no obvious difference (see FIG. 4A);

the transfection result shows that the expression level of the blank control group miR-891B is set as 1 as a reference, compared with the expression level (relative expression amount is 1) of the blank control group miR-891B and the expression level of the negative control group (NC group) miR-891B of the transfection mimics-NC, the expression level of miR-891B of the experimental group of the transfection miR-891B mimics is obviously up-regulated, and the difference has statistical significance (P < 0.05), while the blank control group and the negative control group have no obvious difference (see figure 4B);

the results of apoptosis experiments show that the total apoptosis rate (10.28%) of cells of an experimental group transfected with miR-431 mimics is significantly higher than that of a blank control group (3.11%) and a negative control group (3.01%) (see Table 9 and FIG. 5A, FIG. 5B and FIG. 5C), which indicates that miR-431 can influence the apoptosis capacity of melanoma cells, and the increase of the expression level of miR-431 can promote the apoptosis of the melanoma cells;

the results of apoptosis experiments show that the total apoptosis rate (10.00%) of cells of an experimental group transfected with miR-891B mimics is significantly higher than that of a blank control group (3.11%) and a negative control group (3.01%) (see Table 9 and FIG. 5A, FIG. 5B and FIG. 5D), which indicates that miR-891B can influence the apoptosis capacity of melanoma cells, and the increase of the expression level of miR-891B can promote the apoptosis of the melanoma cells;

the results of apoptosis experiments show that the total apoptosis rate (25.28%) of cells of the experimental group co-transfected with miR-431 mimics and miR-891b mimics is significantly higher than that of the experimental group transfected with miR-431 mimics alone (10.28%) and that of the experimental group transfected with miR-891b mimics alone (10.00%) (see Table 9 and FIG. 5C, FIG. 5D, FIG. 5E);

in addition, the cell inhibition ratios of the respective groups were calculated, and the results obtained by the calculation are shown in table 10, using the formula q = E_A+B/(E_A+E_B-E_A×E_B) Judging whether the effect of the two combined use is better than that of the single use, wherein E_A+BIs the inhibition rate of miR-431 mimics and miR-891b mimics on melanoma cells, E_AIs the inhibition rate of miR-431 mimics on melanoma cells, E_BThe inhibition rate of miR-891b mimics to melanoma cells is shown; if q =0.85-1.15 is simply superposed, q is more than 1.15 and less than 20 is synergistic, q is more than 20 is significant synergistic, q is less than 0.85 is antagonistic, namely q is more than 1.15, the apoptosis promoting effect of miR-431 mimics and miR-891b mimics on melanoma cells can be judged to be synergistic effect instead of simple superposition;

according to the results of the cell inhibition ratios calculated in table 10, the synergy q value was calculated using the formula of kinje, and whether the combined effect of miR-431 mimics and miR-891b mimics is stronger than the single effect was evaluated, and the results of the cell inhibition ratios calculated by substituting q = E are known_A+B/(E_A+E_B-E_A×E_B) The =0.2217/(0.0717+0.0689-0.0717 × 0.0689) =1.630, namely q =1.630, and q > 1.15, shows that the apoptosis promoting effect of the miR-431 mimics and the miR-891b mimics on melanoma cells is a synergistic effect, and further proves that the miR-431 mimics and the miR-891b mimics are combined to be synergistic treatment instead of simple additive effect.

TABLE 9 statistics of results of apoptosis experiments

TABLE 10 calculation results of cytostatic rates of the respective groups

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> Beijing Baiao Cisco biomedical technology Co., Ltd

Application of <120> miRNA biomarker in early diagnosis and treatment of melanoma

<141> 2021-10-11

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ugucuugcag gccgucaugc a 21

<210> 2

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ugcaugacgg ccugcaagac a 21

<210> 3

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ugcaacuuac cugagucauu ga 22

<210> 4

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ucaaugacuc agguaaguug ca 22

<210> 5

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

uuuguacuac acaaaaguac ug 22

<210> 6

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caguacuuuu guguaguaca aa 22

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgtcttgcag gccgtcatg 19

<210> 8

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctcaactggt gtcgtg 16

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgcaacttac ctgagtcat 19

<210> 10

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctcaactggt gtcgtg 16

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcttcggcag cacatatact aaaat 25

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgcttcacga atttgcgtgt cat 23

<210> 13

<211> 114

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

uccugcuugu ccugcgaggu gucuugcagg ccgucaugca ggccacacug acgguaacgu 60

ugcaggucgu cuugcagggc uucucgcaag acgacauccu caucaccaac gacg 114

<210> 14

<211> 79

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ccuuaauccu ugcaacuuac cugagucauu gauucaguaa aacauucaau ggcacauguu 60

uguuguuagg gucaaaaga 79

Claims

1. Application of a reagent for detecting expression levels of biomarkers miR-431 and miR-891b in preparation of a product for diagnosing melanoma.

2. The use according to claim 1, wherein the expression levels of the biomarkers miR-431 and miR-891b in the sample of melanoma patients are significantly down-regulated.

3. The use according to claim 1, wherein the agent is selected from the group consisting of:

Primers for specifically amplifying the biomarkers miR-431 and miR-891 b.

4. The use of claim 3, wherein the primers for specific amplification of the biomarkers miR-431 and miR-891b have the sequences shown in SEQ ID NO 7-SEQ ID NO 8 and SEQ ID NO 9-SEQ ID NO 10, respectively.

5. A product for diagnosing melanoma is characterized by comprising reagents for detecting biomarkers in a sample to be detected, wherein the biomarkers are miR-431 and miR-891 b;

the product comprises a kit and a chip;

6. Application of biomarkers miR-431 and miR-891b in preparation of pharmaceutical compositions for treating melanoma.

7. The use according to claim 6, wherein the pharmaceutical composition comprises a promoter that increases the expression levels of miR-431 and miR-891 b;

8. A pharmaceutical composition for treating melanoma, which is characterized by comprising a promoter for increasing the expression level of miR-431 and miR-891 b;

9. Application of biomarkers miR-431 and miR-891b in screening of candidate substances for preventing and/or treating melanoma.

10. A method for screening a candidate substance for preventing and/or treating melanoma, characterized in that the method comprises the steps of:

(2) detecting the expression level of miR-431 and miR-891b in the cell;