CN102643814A - Antisense oligonucleotide for human miR-431 and application thereof - Google Patents

Abstract

The invention discloses an antisense oligonucleotide for inhibiting the expression of human micro RNA-431, and the application of the antisense oligonucleotide. The antisense oligonucleotide is combined with the human miR-431 in a way of specific binding, and comprises 13-21 continuous nucleotide complementary sequences in the following nucleotide sequence of 5'-UGUCUUGCAGGCCGUCAUGCA-3', and especially comprises the sequence of 5'-UGCAUGACGGCCUGCAAGACA-3'. The antisense oligonucleotide can be ribonucleotide, deoxyribonucleotide or chimera between the ribonucleotide and the deoxyribonucleotide, and can be used for modifying any nucleotide in the chain. The antisense oligonucleotide can effectively inhibit the expression, growth and multiplication of miR-431 in human brain glioma cells, thus effectively treating brain glioma and other tumours with high miR-431 expression.

Description

The antisense oligonucleotide of people miR-431 and application thereof

Technical field

The invention belongs to technical field of biomedical materials and pharmaceutical field.Particularly, the present invention relates to a kind of microRNAs (miRNA) antisense oligonucleotide, especially relate to people microRNA-431 (people miR-431) antisense oligonucleotide and application thereof.This antisense oligonucleotide can be complementary with people miR-431, thereby suppress the expression of people miR-431 and play antineoplastic action.The invention still further relates to the pharmaceutical composition that comprises this miRNA antisense oligonucleotide.

Background technology

MiRNAs (being called microRNA or Microrna again) is little non-coding RNA; Length is 20-25bp; Normally transcribe by rna plymerase ii (Pol II); General initial product is the big pri-miRNA with cap sequence (7MGpppG) and polyadenylic acid tail (AAAAA) (primary miRNA, elementary miRNA).These pri-miRNA under the effect of RNase III Drosha and its cofactor Pasha, be processed into the precursor miRNA that 70 Nucleotide form (precursormiRNA, pre-miRNA).RAN-GTP and exportin 5 (output albumen 5) are transported to this precursor molecule in the tenuigenin.Subsequently, another RNase III Dicer (endoribonuclease) shears it and produces the two strands that is about 22 length of nucleotides.This two strands is directed into miRISC (miRNA-induced silencing complex very soon; The reticent mixture of miRNA inductive) in the complex body; Wherein contain Argonaute albumen (AGO albumen), and sophisticated strand miRNA is retained in this mixture.Sophisticated miRNA is attached to the site of its complementary mRNA and through two kinds of machine-processed negative regulator genes that depend on the sequence complementarity and expresses, and on the protein translation level, suppresses its expression with the incomplete complementary miRNA of said target mrna.Yet, evidence suggests also that recently these miRNA also might influence the stability of mRNA.Use the miRNA binding site of this mechanism to hold non-translational region at 3 ' of mRNA usually.If miRNA and target site complementary fully (perhaps almost completely complementary), the combination of these miRNA often causes the degraded of target molecule mRNA so.MiRNAs is quite conservative in spore, and animal, the miRNAs that finds in plant and the fungi etc. expresses all has strict tissue specificity and sequential property.At present, have only the biological function of very little a part of miRNAs to be illustrated.These miRNAs regulate cell growth and tissue differentiation, and are relevant with biological growth and development.A series of research shows: miRNAs plays a significant role in processes such as cell growth and apoptosis, hemocyte differentiation, homeobox generegulation, neuronic polarity, insulin secretion, the formation of brain form, heart generation and late embryogenesis growth.For example, miR-273 participates in the nervous system development process of nematode; MiR-430 participates in the brain development of zebra fish; MiR-181 control Mammals hematopoietic cell is divided into the B cell; MiR-375 regulates mammalian islet cell and grows and insulin secretion; MiR-143 works in the adipocyte differentiation; MiR-196 has participated in the Mammals four limbs and has formed, and miR-1 is relevant with heart development.Other has the researchist to find that many neural miRNAs receive sequential and regulate in pallium is cultivated, and shows its mRNA that possibly control compartmentation translation.

MiRNA expresses relevant with multiple cancer, and these genes possibly play tumor suppressor gene or oncogene effect.In B cell chronic lymphatic leukemia (CLL), find to have the change of miRNA expression level at first, in various human tumors, all detect the miRNA changes of expression level subsequently successively.Discover that it is relevant that miRNAs and tumour form, and can bring into play the effect (like miR-15a and miR-16-1) of tumor suppressor gene, can play the effect (like miR-155 and miR-17-92 bunch) of oncogene again.Think at present, in tumour cell, ripe body of some miRNA or precursor expression horizontal abnormality, and the miRNA of abnormal expression plays a role through influencing the said target mrna translation, participates in neoplastic process, and plays an important role.Receive the regulation and control of let-7 family like the Ras proto-oncogene, the BCL2 anti-apoptotic genes expression receives miR-15a-miR-16-1 bunch of regulation and control, and the E2F1 transcription factor receives miR-17-92 bunch of regulation and control, and the BCL6 anti-apoptotic genes expression receives the regulation and control of miR-127 etc.The down-regulated expression of miRNAs also has substantial connection with tumour, and this is indicating that miRNA has the function of oncogene.For example, miR-143 and miR-145 obviously downward modulation in colorectal carcinoma.What is interesting is that the precursor molecule of its hairpin structure content in tumour and healthy tissues is similar, this shows that the down-regulated expression of miRNAs possibly be because its course of processing is damaged.But the tumor suppressor gene function of miR-143 and miR-145 possibly not only be confined to colorectal carcinoma, also obviously downward modulation of its expression amount in clones such as mammary cancer, prostate cancer, uterus carcinoma, lymphatic cancer.Another report shows that miR-21 expresses increase in glioblastoma multiforme.The expression amount of this gene in tumor tissues than high 5-100 in healthy tissues doubly.

MiRNAs is natural antisense acting factor, can regulate and control the several genes relevant with propagation with eukaryote existence.Aspect oncotherapy, the application prospect of miRNA is bright.Utilizing miRNA as aspect the treatment target spot, existing experimental data support:, the variation of miRNA express spectra occurs as in the process of gemcitabine (gemcitabine) treatment; The expression level (as making miR-21 cross expression) of regulation and control part miRNA can be promoted the susceptibility of cholangiocarcinoma cell to chemotherapeutics.MiRNAs through in the possible effectively deactivation tumour of introducing and the miRNA complementary synthetic antisense oligonucleotide---anti-miRNA oligonucleotide (AMOs)---with oncogene characteristic delays its growth.Clinically, can methylate or lock nucleic acid modified antisense oligonucleotide administrations such as (LNA) through 2 '-O-frequent or that continue and make the miRNA inactivation.These modifications make oligonucleotide more stable, and are lower than other treatment means toxicity.Use antagomirs (with SUV link coupled AMOs), can effectively suppress the miRNA activity in Different Organs behind the injection mouse, thereby possibly become a kind of medicine likely.Opposite, cross and express the miRNAs that those have the tumor suppressor gene effect, like let-7 family, also can be used to treat some specific tumour.

Antisense oligonucleotide (Flanagan WM.Antisense comes of age.Cancer&Metastasis Reviews 1998; 17 (2): 169-76) be meant one section can with the Nucleotide of the base complementrity of its target gene.Antisense oligonucleotide can be answered expression of gene by inhibitory phase.

People microRNA-431 (hsa-miR-431) is positioned at karyomit(e) No. 14, and precursor sequence is UCCUGCUUGUCCUGCGAGGUGUCUUGCAGGCCGUCAUGCAGGCCACACUGACGGUA ACGUUGCAGGUCGUCUUGCAGGGCUUCUCGCAAGACGACAUCCUCAUCACCAACGA CG (SEQ ID No.1).2 ripe microRNA:hsa-miR-431 (MIMAT0001625, sequence is UGUCUUGCAGGCCGUCAUGCA (SEQ ID No.2)) and hsa-miR-431 are arranged ^*(MIMAT0004757, sequence is CAGGUCGUCUUGCAGGGCUUCU (SEQ ID No.3)).The middle miRNA of lung fibroblast (WI-38) changed after Wang etc. utilized the ionizing rays of miRNA chip detection, found the microRNA-431 up-regulated.But in glioma, also do not report about the function of miR-431 and the research of expression level.

Nearly 30 years; Although the complex therapy of tumour is very general clinically, with the operation be main, chemicotherapy to be the complex therapy of assisting improve and not obvious the survival rate of tumour patient, overall survival rate was still lower in 5 years; Pace up and down about 30%～55%; Do not significantly improve, 5 years survival rates of middle and advanced stage patient are lower, are about 20%.And all there are limitation separately in these methods, particularly to middle and advanced stage and recurrence patient unsatisfactory curative effect, to poorer with metastasis person's curative effect.Therefore, seeking safer and more effective treatment approach is the difficult problem that raising tumour patient survival rate and life quality are needed to be resolved hurrily.

Summary of the invention

To deficiency of the prior art; The present invention has designed a series of antisense oligonucleotide molecules that can be incorporated into the miR-431 different positions; In culturing cell U87/MG; The antisense nucleic acid cell growth ability that checking suppresses the miR-431 expression specificity, the influence of multiplication capacity, antisense oligonucleotide molecular length of the present invention can comprise 13～21 nucleotide residues, and growth of human tumor cells ability, multiplication capacity are all had inhibition in various degree; Wherein the shortest antisense oligonucleotide length is 13 bases, and the antisense oligonucleotide of different lengths all has good growth of tumour cell and proliferation inhibition activity.Therefore, above-mentioned antisense nucleic acid all can be used to prepare the preparation that suppresses growth of tumour cell ability, multiplication capacity, the wherein tumour cell of preferred miR-431 high expression level.Accomplished the present invention on this basis.

Therefore; An object of the present invention is to provide the antisense oligonucleotide (suppressor factor) of one group of new people miR-431, be used for efficient, low toxicity or suppress the expression of miR-431 innocuously, and then the disease that causes by the miR-431 over-expresses of treatment; Comprising tumour, especially is cerebral glioma.

Another object of the present invention just provides the purposes of above-mentioned antisense oligonucleotide in the medicine of the relative disease of preparation treatment mir-431 over-expresses.

A further object of the present invention provides a kind of pharmaceutical composition that comprises above-mentioned antisense oligonucleotide.

The inventor has designed and synthesized the length different antisense nucleic acid (antisense oligonucleotide) of a series of specificitys to the miR-431 different zones through extensive and deep research, and checking has the antisense nucleic acid that suppresses effect in culturing cell.Research shows that these antisense nucleic acides can suppress the growth and the malignant proliferation ability of tumour cell.

First aspect of the present invention provides the antisense oligonucleotide of a kind of miR-431, and said antisense oligonucleotide suppresses the expression of miR-431 in people's cell.Usually, continuous 13～21 nucleotide sequence complementations among said antisense oligonucleotide and the 5 '-UGUCUUGCAGGCCGUCAUGCA-3 '.Usually the length of antisense oligonucleotide is 13～35bp, and for the ripe body of miRNA, preferable antisense oligonucleotide length is 18～22bp.The not special restriction of the length of antisense oligonucleotide of the present invention, in general, in order to reach the specificity of hybridization, the Nucleotide that antisense oligonucleotide needs at least 13 monomers to form.In a preferred embodiment of the invention, the length of said antisense oligonucleotide is 18～21 Nucleotide.More preferably, the sequence of said antisense oligonucleotide is: 5 '-UGCAUGACGGCCUGCAAGACA-3 ' (SEQ ID No.4).

In another preferred embodiment of the present invention, the Nucleotide in the antisense oligonucleotide of the present invention can be the mosaic of ribonucleotide, deoxyribonucleotide or ribonucleotide and deoxyribonucleotide.At present, RNA is higher than the avidity of DNA and miRNA hybridization with the hybridization avidity of miRNA in the nucleic acid hybridization, has very high pharmaceutical use.But artificial-synthetic DNA's the cost cost than synthetic RNA far away is low, also has good market potential.And can adopt the chimeric antisense nucleic acid that forms that links to each other of ribose RNA monomer and ribodesose dna single body to develop as medicine.A series of antisense nucleic acid molecules of the present invention's design had both comprised dna molecular, also comprised the RNA molecule, and two kinds of molecules all have the activity that suppresses the miR-431 expression.

The antisense nucleic acid of the present invention's design, it is active that its sequence has specific biological, and its antisense nucleic acid institute complementary length for the site of a certain gene complementation has much relations; Long like complementary; Then BA can be higher, and suppressing effect also can be more better, increasing or reducing an antisense nucleic acid that is complementary to same gene locus to several bases; Equally also has BA in various degree; Also can reach in various degree inhibition growth of tumour cell and the effect of propagation, research of the present invention shows, weak point can reach 13 bases and still have the effect that miR-431 expresses that suppresses.In antisense nucleic acid of the present invention research, various chemical modification methods are a lot, comprise one or more the combination etc. that is selected from ribose modification, base modification and the phosphoric acid backbone modification.Will be clear that any modifying method that can increase antisense nucleic acid stability and bioavailability can use, as be selected from SUV modification, PEG modification, thio-modification and the 2 '-methoxyl group modification one or more etc.Antisense oligonucleotide described in this paper is modified through 2 '-methoxyl group.

Above-mentioned antisense nucleic acid of the present invention has the effect that suppresses the miR-431 expression.When with after above-mentioned antisense nucleic acid transfection is in the cell strain U87 of miR-431 high expression level, can effectively suppress the growth and the malignant proliferation ability of tumour cell.

The present invention also provides a kind of pharmaceutical composition, and it contains oligonucleotide of the present invention and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This type carrier includes but not limited to: salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical prepn should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example prepares through ordinary method with the saline water or the aqueous solution that contains glucose and other assistant agents.

Said " significant quantity " is meant and can produces function or amount active and that can be accepted by people and/or animal to people and/or animal.

Said " pharmaceutically acceptable " composition is applicable to people and/or animal and does not have excessive bad side reaction (like toxicity, stimulation and transformation reactions), the material of rational benefit/risk ratio is promptly arranged.

In the third aspect of the invention, provide antisense oligonucleotide of the present invention in the purposes that is used for preparing the medicine of treating following disease, wherein, said antisense oligonucleotide and other treatment are medication combined to be used; Said disease comprises tumour for to cross the expression diseases associated with human body miR-431, is preferably cerebral glioma.

As used herein, " antisense oligonucleotide " refers to the nucleotide oligomer of antisense.Antisense oligonucleotide through base complementrity (G-C) pairing forms three chains (anti-gene) with double-stranded DNA for A-T, A-U, or forms heteroduplex (antisense) with single stranded RNA, thus the processing and the translation of duplicating, transcribing or transcribing back mRNA of blocking gene.Simultaneously, double-stranded RNA can be degraded by intracellular ribonuclease H (RNaseH), thereby more effectively blocks target gene expression.Because GEM 132 can only combine with the target sequence of reverse complemental, therefore have specificity height, the characteristics that spinoff is little.

The antisense oligonucleotide of people miR-431 provided by the invention can be complementary with people miR-431, thereby suppress the expression of people miR-431 and play antineoplastic action, and it has following advantage:

1, antisense oligonucleotide provided by the invention acts on specific target site, the site of non-specific binding seldom, specificity is high;

2, antisense oligonucleotide provided by the invention is through suitable chemically modified, has that toxicity is low, spinoff is little and characteristics such as long half time;

3, antisense oligonucleotide provided by the invention has the good restraining effect, and the inhibiting rate of growth of tumour cell is surpassed 55%.

Description of drawings

Fig. 1 has shown that the miR-431 antisense oligonucleotide suppresses growth and the propagation of tumour cell U87/MG cell, wherein Figure 1A for transfection the U87/MG cell microscopic (20 *) behind the negative control of FAM mark; Figure 1B for transfection the U87/MG cell microscopic behind the negative control of FAM mark (20 *, under the fluorescence); Fig. 1 C is the microgram (10 *) of transfection negative control (5 '-CAGUACUUUUGUGUAGUACAA-3 ') back U87/MG cell state; Fig. 1 D is the microgram (10 *) of antisense oligonucleotide (5 '-UGCAUGACGGCCUGCAAGACA-3 ') the back U87/MG cell state of transfection people miR-431.

Embodiment

Antisense oligonucleotide of the present invention, continuous 13～21 nucleotide sequence complementations among its sequence and 5 '-UGUCUUGCAGGCCGUCAUGCA-3 ', and also not complementary with the RNA sequence of other genes.In a preferred embodiment of the invention, the sequence of said antisense oligonucleotide is 5 '-UGCAUGACGGCCUGCAAGACA-3 '.Antisense oligonucleotide provided by the invention can be modified outcome; It contains at least two, and at least 4 usually, preferable at least 6; At least 8 better Nucleotide do not have the Nucleotide of the modification of toxic side effects, and said modification mode comprises the methoxyl group replacement of 2 '-position, thio-modification etc.In order to increase the cellular uptake rate of antisense oligonucleotide, can also on the basis of above-mentioned modification, carry out SUV and modify or the PEGization modification antisense oligonucleotide.Oligonucleotide after the above-mentioned modification can continue effectively to match with target sequence, and has the longer transformation period in vivo than common Yeast Nucleic Acid or thymus nucleic acid without modifying.

To combine embodiment and accompanying drawing to describe the present invention in further detail below.Yet should be appreciated that and enumerate these embodiment, and be not to be used for limiting scope of the present invention just for an illustration.

Embodiment: the antisense oligonucleotide of people miR-431 suppresses active to human neuroglia glucagonoma clone U87/MG and detects

At first, by the synthetic miR-431 antisense oligonucleotide of Shanghai JiMa pharmacy Technology Co., Ltd, sequence is: 5 '-UGCAUGACGGCCUGCAAGACA-3 '.The used sequence that relates in an embodiment is synthetic by Shanghai JiMa pharmacy Technology Co., Ltd.

Cell cultures:

U87/MG cell (human brain astrocytoblast knurl; Available from typical case's culture collection council of Chinese Academy of Sciences cell bank), in 10%FBS-DMEM substratum (FBS (foetal calf serum) is available from Gibco, and DMEM (a kind of conventional substratum) is available from Hyclone); In 37 ℃, 5%CO ₂Cultivate.Collect the good U87/MG cell of growth conditions, centrifugal counting is with 2 * 10 ³Every hole is laid in 96 orifice plates, and 37 ℃, 5%CO ₂Cultivate 24h.

Transfection:

1) transfection previous day, with not containing antibiotic culture medium inoculated culturing cell in right amount, the degree of converging of cell reaches 30～50% when making transfection in 96 orifice plates;

2) the transfection sample is prepared oligomer-Lipofecta mine according to following method ^TM2000 (a kind of transfection reagent) mixture:

A. Opti-

the I substratum (Gibco) that does not contain serum with 25 μ l dilutes the negative control of miR-431 antisense oligonucleotide (5 '-UGCAUGACGGCCUGCAAGACA-3 '), negative control (SEQID No.5:5 '-CAGUACUUUUGUGUAGUACAA-3 '), FAM mark respectively; Final concentration is 50nM after adding in the hand-hole; Mixing gently, each transfection are established 3 multiple holes;

B. mixing Lipofecta mine gently before using ^TM2000 (Invitrogen) get 0.25 μ l then and use Opti-

The I substratum is diluted to 25 μ l with it, at room temperature hatches 5min gently behind the mixing;

C. after hatching 5min, the Lipofecta mine of dilution ^TM2000 mix with the GEM 132 and the contrast of dilution respectively, at room temperature hatch 20min gently behind the mixing, to allow the formation of mixture;

3) mixture is joined in each hole that comprises cell and substratum, the culture plate that rocks back and forth lightly mixes; The final concentration of GEM 132 and contrast is 75nM.

4) 37 ℃, 5%CO ₂After incubator continued to hatch 72 hours, microscopic examination U87/MG cell was taken a picture.

As shown in Figure 1, transfection is after 72 hours, surpass 80% U87/MG cell success transfection the negative control of FAM mark (Figure 1A, Figure 1B); Behind the transfection negative control, the U87/MG cell is complete, light transmission strong (Fig. 1 C); Most of U87/MG necrocytosis (Fig. 1 D) behind the transfection miR-431 antisense oligonucleotide.

Cytotoxicity experiment based on MTT:

The cell that upwards obtains in the step adds MTT (Sigma) 5mg/ml (the saline water preparation with 0.9%) for preparing, and every hole adds 20 μ l, 37 ℃, 5%CO ₂Hatch after 4 hours to inhale and remove substratum and MTT, every hole adds DMSO 100 μ l and reads the absorbance (like table 1) of OD570-OD630 through ELIASA.

Table 1

Calculate inhibiting rate:

The inhibiting rate that calculates the cell growth is 55.46 ± 2.05%.

The result shows: miR-431 antisense oligonucleotide provided by the invention has the good restraining effect, and the inhibiting rate that U87/MG is grown surpasses 55%.

Claims (11)

1. a people microRNA-431 antisense oligonucleotide is characterized in that, said antisense oligonucleotide comprise with following nucleotide sequence in 13～21 successive Nucleotide complementary sequence: 5 '-UGUCUUGCAGGCCGUCAUGCA-3 '.

2. antisense oligonucleotide as claimed in claim 1 is characterized in that, said antisense oligonucleotide sequence is 5 '-UGCAUGACGGCCUGCAAGACA-3 '.

3. antisense oligonucleotide as claimed in claim 1 is characterized in that, said antisense oligonucleotide is the mosaic of ribonucleotide, deoxyribonucleotide or ribonucleotide and deoxyribonucleotide.

4. like each described antisense oligonucleotide in the claim 1～3, it is characterized in that said antisense oligonucleotide is further modified.

5. antisense oligonucleotide as claimed in claim 4 is characterized in that, said modification is selected from one or more in ribose modification, base modification and the phosphoric acid backbone modification.

6. antisense oligonucleotide as claimed in claim 5 is characterized in that, said modification is selected from one or more in thio-modification, 2 '-methoxyl group modification and the SUV modification.

7. like the purposes of each described antisense oligonucleotide in the claim 1～3 at the medicine of the relative disease that is used for preparing treatment miR-431 over-expresses.

8. purposes as claimed in claim 7 is characterized in that, said antisense oligonucleotide and other treatment are medication combined to be used.

9. purposes as claimed in claim 7 is characterized in that, the relative disease of said miR-431 over-expresses is a tumour.

10. purposes as claimed in claim 9 is characterized in that, the relative disease of said miR-431 over-expresses is a cerebral glioma.

11. a pharmaceutical composition is characterized in that, comprises each described antisense oligonucleotide and pharmaceutically acceptable carrier in the claim 1～3 of treating significant quantity.

Images