CN102643810B - The antisense oligonucleotide of people miR-299-5p and application thereof - Google Patents
The antisense oligonucleotide of people miR-299-5p and application thereof Download PDFInfo
- Publication number
- CN102643810B CN102643810B CN201110040777.7A CN201110040777A CN102643810B CN 102643810 B CN102643810 B CN 102643810B CN 201110040777 A CN201110040777 A CN 201110040777A CN 102643810 B CN102643810 B CN 102643810B
- Authority
- CN
- China
- Prior art keywords
- antisense oligonucleotide
- mir
- modification
- cell
- mirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses a kind of suppress people microRNA-299-5p to express antisense oligonucleotide and application.This antisense oligonucleotide specific binding is in people miR-299-5p, comprise the sequence with 13 ~ 22 continuous nucleotide complementations in following nucleotide sequence: 5 '-UGGUUUACCGUCCCACAUACAU-3 ', particularly it comprises sequence: 5 '-AUGUAUGUGGGACGGUAAACCA-3 '.Antisense oligonucleotide of the present invention can be the mosaic of ribonucleotide, deoxyribonucleotide or ribonucleotide and deoxyribonucleotide, and can modify Nucleotide arbitrary in chain.MiR-299-5p antisense oligonucleotide of the present invention can effectively suppress miR-299-5p in human glioma cell to express, and suppresses its growth and propagation, thus effectively treats the tumour of cerebral glioma and other miR-299-5p high expression levels.
Description
Technical field
The invention belongs to technical field of biomedical materials and pharmaceutical field.Particularly, the present invention relates to a kind of microRNAs (miRNA) antisense oligonucleotide, especially relate to people microRNA-299-5p (people miR-299-5p) antisense oligonucleotide and application thereof.This antisense nucleic acid can be complementary with people miR-299-5p, thus suppress the expression of people miR-299-5p and play antineoplastic action.The invention still further relates to the pharmaceutical composition comprising this miRNA antisense oligonucleotide.
Background technology
MiRNAs (being also called microRNA or Microrna) is little non-coding RNA, length is 20-25bp, normally transcribed by rna plymerase ii (PolII), general initial product is the large pri-miRNA (primarymiRNA, elementary miRNA) with cap sequence (7MGpppG) and polyadenylic acid tail (AAAAA).These pri-miRNA are processed into the precursor miRNA (precursormiRNA, pre-miRNA) of 70 Nucleotide compositions under the effect of RNaseIIIDrosha and its cofactor Pasha.This precursor molecule is transported in tenuigenin by RAN-GTP and exportin5 (exporting albumen 5).Subsequently, another RNaseIIIDicer (endoribonuclease) is sheared the double-strand producing and be about 22 length of nucleotides.This double-strand is directed into miRISC (miRNA-inducedsilencingcomplex very soon, the silencing complex of miRNA induction) in complex body, wherein containing Argonaute albumen (AGO albumen), and the strand miRNA of maturation is retained in this mixture.Ripe miRNA is attached to and is expressed by the machine-processed negative regulator gene that two kinds depend on complementarity with the site of the mRNA of its complementation, and the miRNA not exclusively complementary with said target mrna suppresses it to express in protein translation level.But also evidence suggests recently, these miRNA also likely affect the stability of mRNA.Use the miRNA binding site of this mechanism usually at 3 ' the end non-translational region of mRNA.If miRNA and target site complete complementary (or almost complete complementary), so the combination of these miRNA often causes the degraded of target molecule mRNA.MiRNAs is quite conservative in spore, and animal, the miRNAs found in plant and fungi etc. expresses all strict tissue specificity and timing.
At present, the biological function of very little a part of miRNAs is only had to be elucidated.These miRNAs regulate Growth of Cells and tissue differentiation, relevant with biological growth and development.A series of research shows: miRNAs plays a significant role in the processes such as Growth of Cells and apoptosis, hemocyte differentiation, Homeobox gene adjustment, the formation of neuronic polarity, insulin secretion, brain form, heart generation and late embryogenesis growth.Such as, miR-273 participates in the nervous system development process of nematode; MiR-430 participates in the brain development of zebra fish; It is B cell that miR-181 controls mammalian hematopoietic cytodifferentiation; MiR-375 regulates mammalian islet cell to grow and insulin secretion; MiR-143 works at Adipocyte Differentiation; MiR-196 take part in Mammals four limbs and is formed, and miR-1 is relevant with heart development.Many neural miRNAs are subject to sequential and regulate in pallium is cultivated separately to have researchist to find, show its mRNA translation that may control compartmentation.
MiRNA expresses relevant to kinds cancer, and these genes may play tumor suppressor gene or oncogene effect.In B cell chronic lymphatic leukemia (CLL), find that there is the change of miRNA expression level at first, in various human tumor, the change of miRNA expression level all detected subsequently successively.Research finds, miRNAs and tumour are formed relevant, can play the effect (as miR-15a and miR-16-1) of tumor suppressor gene, can play again the effect (as miR-155 and miR-17-92 bunch) of oncogene.Think at present, in tumour cell, the ripe body of some miRNA or precursor expression horizontal abnormality, and the miRNA of abnormal expression plays a role by affecting said target mrna translation, participates in neoplastic process, and plays an important role.If Ras proto-oncogene is by the regulation and control of let-7 family, BCL2 anti-apoptotic genes expression is by miR-15a-miR-16-1 bunch of regulation and control, and E2F1 transcription factor is by miR-17-92 bunch of regulation and control, and BCL6 anti-apoptotic genes expression is by the regulation and control etc. of miR-127.The down-regulated expression of miRNAs also has substantial connection with tumour, this imply that miRNA has the function of oncogene.Such as, miR-143 and miR-145 obviously lowers in colorectal carcinoma.What is interesting is, precursor molecule content in tumour with healthy tissues of its hairpin structure is similar, and this shows, the down-regulated expression of miRNAs may be because its course of processing is damaged.But the tumor suppressor gene function of miR-143 and miR-145 not only may be confined to colorectal carcinoma, and in the clones such as mammary cancer, prostate cancer, uterus carcinoma, lymphatic cancer, its expression amount is also obviously lowered.Another report shows, miR-21 expresses increase in glioblastoma multiforme.The expression amount of this gene in tumor tissues is than high 5-100 times in the normal tissue.
MiRNAs is natural antisense acting factor, can regulate and control and to survive to eukaryote and to breed relevant several genes.In oncotherapy, the application prospect of miRNA is bright.Utilizing miRNA as in therapy target, existing experimental data support: as in the process for the treatment of at gemcitabine (gemcitabine), to occur the change of miRNA express spectra; The expression level (as making miR-21 process LAN) of regulation and control part miRNA, can promote the susceptibility of cholangiocarcinoma cell to chemotherapeutics.By introducing the antisense oligonucleotide with the synthesis of the miRNA complementation with oncogene characteristic---the miRNAs in the effective deactivation tumour of anti-miRNA oligonucleotide (AMOs)-possibility, delays its growth.Clinically, the antisense oligonucleotide administration that nucleic acid (LNA) etc. modifies can be methylated or lock by 2 '-O-that is frequent or that continue and make miRNA inactivation.These modifications make oligonucleotide more stable, lower than other treatment means toxicity.Use antagomirs (with the AMOs of cholesterol coupling), miRNA effectively can be suppressed active in Different Organs after injection mouse, thus may become a kind of medicine likely.Contrary, process LAN those there is the miRNAs of tumor suppressor gene effect, as let-7 family, also may be used for treating some specific tumour.
Antisense oligonucleotide (FlanaganWM.Antisensecomesofage.Cancer & MetastasisReviews1998; 17 (2): 169-76) refer to one section can with the Nucleotide of the base complementrity of its target gene.Antisense oligonucleotide can suppress the expression of corresponding gene.
People microRNA-299 (hsa-miR-299) is positioned at No. 14 karyomit(e)s, and precursor sequence is AAGAAAUGGUUUACCGUCCCACAUACAUUUUGAAUAUGUAUGUGGGAUGGUAAACC GCUUCUU (SEQIDNo.1).There are 2 ripe microRNA:hsa-miR-299-5p (MIMAT0002890, sequence is UGGUUUACCGUCCCACAUACAU (SEQIDNo.2)) and hsa-miR-299-3p (MIMAT0000687, sequence is UAUGUGGGAUGGUAAACCGCUU (SEQIDNo.3)).Shevde etc. find hsa-mir-299-5p down-regulated expression in breast carcinoma cell strain (MCF7, MCF10ATandMCF10), its target gene osteopontin (OPN) up-regulated (Shevde etc., 2010).Lowery etc. find that miR-299 and oestrogenic hormon (oestrogen) react closely related (Lowery etc., 2009) in mammary cancer.
Padgett etc. utilize miR-299-5p in QuantitativePCR scientific discovery primary biliary cirrhosis to express and raise (Padgett etc., 2009).Guled etc. utilize chip technology to find, and in malignant mesothe patient, smoking and the middle miR-299-3p of non-smoking express different (Guled etc., 2009).Chim etc. utilize TaqManMicroRNAAssays (TaqManMicroRNA analysis) scientific discovery miR-299-5p gene expression abundance in pregnant women placental higher, and this miRNA down-regulated expression of blood in postpartum (Chim etc., 2008).Chen etc. find that Growth of Cells is suppressed (Chen etc., 2005) after the inhibitor of HeLa transit cell dye miR-299.But also not about the function of miR-299 and the research report of expression level in glioma.
Nearly 30 years, although the complex therapy of tumour is very general clinically, but be that auxiliary complex therapy to improve the survival rate of tumour patient and not obvious based on operation, chemicotherapy, within 5 years, overall survival is still lower, hover about 30% ~ 55%, do not significantly improve, 5 years survival rates of middle and advanced stage patient are lower, are about 20%.And these methods all exist respective limitation, particularly to middle and advanced stage and patients with recurrent unsatisfactory curative effect, to poorer with distant metastasis person's curative effect.Therefore, finding safer and more effective therapy approach is improve tumour patient survival rate and a life quality difficult problem urgently to be resolved hurrily.
Summary of the invention
For deficiency of the prior art, the present invention devises a series of antisense oligonucleotide molecule that can be incorporated into miR-299-5p different positions, and in culturing cell U87/MG, verify the antisense nucleic acid cell growth ability that miR-299-5p expression specificity is suppressed, the impact of multiplication capacity, antisense oligonucleotide molecular length can comprise 13 ~ 22 nucleotide residues, all there is suppression growth of human tumor cells ability in various degree, the characteristic of multiplication capacity, wherein the shortest antisense oligonucleotide length is 13 bases, the antisense oligonucleotide of different lengths all has good growth of tumour cell and proliferation inhibition activity.Therefore, above-mentioned antisense oligonucleotide all can be used to the preparation preparing inhibition tumor cell energy for growth, multiplication capacity, wherein the tumour cell of preferred miR-299-5p high expression level.Complete the present invention on this basis.
Therefore, the subject matter that the present invention will solve just is to provide the antisense oligonucleotide (inhibitor) of one group of new people miR-299-5p, for efficient, low toxicity or the expression suppressing miR-299-5p innocuously, and then treat the disease caused by miR-299-5p overexpression, comprising tumour, is especially cerebral glioma.
Another problem that the present invention will solve just is to provide the purposes of above-mentioned antisense oligonucleotide in the medicine of the relative disease of preparation treatment mir-299-5p overexpression.
The problem again that the present invention will solve is to provide a kind of pharmaceutical composition comprising above-mentioned antisense oligonucleotide.
The present inventor is by extensive and deep research, designed and synthesized a series of specificity for the different antisense nucleic acid (antisense oligonucleotide) of the length of miR-299-5p different zones, and checking has the antisense nucleic acid of inhibition in culturing cell.Research display, these antisense nucleic acides can the growth of inhibition tumor cell and malignant proliferation ability.
A first aspect of the present invention, provides the antisense oligonucleotide of a kind of people miR-299-5p, and described antisense oligonucleotide suppresses the expression of miR-299-5p in people's cell.Usually, continuous 13 ~ 22 nucleotide sequence complementary in described antisense oligonucleotide and 5 '-UGGUUUACCGUCCCACAUACAU-3 '.The length of usual antisense oligonucleotide is 13 ~ 35bp, and for the ripe body of miRNA, preferably antisense oligonucleotide length is 18 ~ 22bp.The length of antisense oligonucleotide of the present invention is not particularly limited, and in general, in order to reach the specificity of hybridization, antisense oligonucleotide needs the Nucleotide of at least 13 monomer compositions.In a preferred embodiment of the invention, the length of described antisense oligonucleotide is 18 ~ 22 Nucleotide.More preferably, the sequence of described antisense oligonucleotide is 5 '-AUGUAUGUGGGACGGUAAACCA-3 ' (SEQIDNo.4).
In another preferred embodiment of the present invention, the Nucleotide in antisense oligonucleotide of the present invention can be the mosaic of ribonucleotide, deoxyribonucleotide or ribonucleotide and deoxyribonucleotide.At present, the avidity that in nucleic acid hybridization, the hybridization avidity of RNA and miRNA is hybridized than DNA and miRNA is high, has very high pharmaceutical use.But the cost of artificial-synthetic DNA is lower than the cost of synthesis RNA far away, also has good market potential.And the ribose RNA monomer antisense nucleic acid that be connected chimeric with ribodesose DNA single body can be adopted to develop as medicine.A series of antisense nucleic acid molecules of the present invention's design, both comprised DNA molecular, also comprised RNA molecule, and two kinds of molecules all have the activity suppressing miR-299-5p to express.
The antisense nucleic acid of the present invention's design, its sequence has specific biological activities, it has much relations for the length that the antisense nucleic acid in the site of a certain gene complementation is complementary, length as complementation is a little, then biologic activity can be higher, inhibition also can be more better, increasing or reducing one is complementary to same gene site antisense nucleic acid to several base, equally also there is biologic activity in various degree, also inhibition tumor cell growth in various degree and the effect of breeding can be reached, research of the present invention shows, the shortest reach 13 bases still have suppress miR-299-5p express effect.In antisense nucleic acid research of the present invention, various chemical modification method is a lot, comprises the combination etc. of one or more be selected from ribose modification, base modification and phosphate backbones modification.It will be clear that any modifying method that can increase antisense nucleic acid stability and bioavailability can be applied, as one or more in cholesterol modification, PEG modification, thio-modification and 2 '-methoxyl group modification etc.Described antisense oligonucleotide is modified through 2 '-methoxy substitution herein.
Above-mentioned antisense nucleic acid of the present invention has the effect suppressing miR-299-5p to express.After in the cell strain U87 above-mentioned antisense nucleic acid being transfected into miR-299-5p high expression level, can the effectively growth of inhibition tumor cell and malignant proliferation ability.
Present invention also offers a kind of pharmaceutical composition, it contains the oligonucleotide of the present invention of safe and effective amount and pharmaceutically acceptable carrier or vehicle.This kind of carrier includes but not limited to: salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should match with administering mode.Pharmaceutical composition of the present invention can be made into injection form, such as, be prepared by ordinary method with physiological saline or the aqueous solution containing glucose and other assistant agents.
Described " significant quantity " refer to can to people and/or animal produce function or active and can by people and/or animal the amount that accepts.
Described " pharmaceutically acceptable " composition is applicable to people and/or animal and without excessive bad side reaction (as toxicity, stimulation and transformation reactions), namely has the material of rational benefit/risk ratio.
In a third aspect of the present invention, provide the purposes of antisense oligonucleotide of the present invention in the medicine for the preparation of the following disease for the treatment of, wherein, described antisense oligonucleotide and other treatment is medication combined uses; Described disease is the disease relevant with human body miR-299-5p process LAN, comprises tumour, is preferably cerebral glioma.
As used herein, " antisense oligonucleotide " refers to the nucleotide oligomer of antisense.Antisense oligonucleotide is by base complementrity (A-T, A-U, G-C) pairing and double-stranded DNA form three chains (anti-gene), or form heteroduplex (antisense) with single stranded RNA, thus the processing copying, transcribe or transcribe rear mRNA of blocking gene and translation.Meanwhile, double-stranded RNA can degrade by intracellular ribonuclease H (RNaseH), thus more effectively block the expression of target gene.Because antisense nucleotide can only be combined with the target sequence of reverse complemental, therefore there is specificity high, the feature that side effect is little.
The antisense oligonucleotide of people miR-299-5p provided by the invention can be complementary with people miR-299-5p, thus suppress the expression of people miR-299-5p and play antineoplastic action, and its tool has the following advantages:
1, antisense oligonucleotide provided by the invention acts on specific target site, and the site of non-specific binding is little, and specificity is high;
2, antisense oligonucleotide provided by the invention is through suitable chemically modified, has that toxicity is low, side effect is little and the feature such as long half time;
3, antisense oligonucleotide provided by the invention has good inhibition, to the inhibiting rate of growth of tumour cell more than 40%.
Accompanying drawing explanation
Fig. 1 shows growth and the propagation of miR-299-5p antisense oligonucleotide inhibition tumor cell U87/MG cell, and wherein, Figure 1A is the U87/MG cell microscopic (20 ×) after the negative control of transfection FAM mark; The microgram (10 ×) of Figure 1B to be U87/MG cell microscopic (20 ×, under fluorescence) Fig. 1 C after the negative control that marks of transfection FAM be transfection negative control (5 '-CAGUACUUUUGUGUAGUACAA-3 ') U87/MG cell state afterwards; Fig. 1 D is the microgram (10 ×) of antisense oligonucleotide (5 '-AUGUAUGUGGGACGGUAAACCA-3 ') the U87/MG cell state afterwards of transfected with human miR-299-5p.
Embodiment
Antisense oligonucleotide of the present invention, continuous 13 ~ 22 nucleotide sequence complementary in its sequence and 5 '-UGGUUUACCGUCCCACAUACAU-3 ', and also not with the RNA complementary of other genes.In a preferred embodiment of the invention, the sequence of described antisense oligonucleotide is 5 '-AUGUAUGUGGGACGGUAAACCA-3 '.Antisense oligonucleotide provided by the invention can be modified outcome, it contains at least two, at least 4 usually, preferably at least 6, at least 8 better Nucleotide do not have the Nucleotide of the modification of toxic side effects, and described modification mode comprises 2 '-position methoxy substitution, thio-modification etc.In order to increase the cellular uptake rate of antisense oligonucleotide, on the basis of above-mentioned modification, cholesterol modification or PEGization modification can also be carried out to antisense oligonucleotide.Oligonucleotide after above-mentioned modification can continue effectively to match with target sequence, and has the longer transformation period in vivo than common not modified Yeast Nucleic Acid or thymus nucleic acid.
In further detail the present invention is described below in conjunction with embodiment and accompanying drawing.But should be appreciated that enumerating these embodiments is to play an illustration, and be not for limiting the scope of the invention.
Embodiment: the antisense oligonucleotide of people miR-299-5p detects neuroglia cell of human oncocyte system U87/MG inhibit activities
First, synthesize miR-299-5p antisense oligonucleotide by Shanghai JiMa pharmacy Technology Co., Ltd, sequence is: 5 '-AUGUAUGUGGGACGGUAAACCA-3 '.The sequence used related in an embodiment is synthesized by Shanghai JiMa pharmacy Technology Co., Ltd.
Cell cultures:
By U87/MG cell (human brain astrocytes's blastoma, purchased from the American Type Culture Collection council of Chinese Academy of Sciences cell bank) at 10%FBS-DMEM substratum, (FBS (foetal calf serum) is purchased from Gibco, DMEM (a kind of conventional medium) is purchased from Hyclone) in, in 37 DEG C, 5%CO
2lower cultivation.Collect the U87/MG cell that growth conditions is good, centrifugal counting, with 2 × 10
3every hole is laid in 96 orifice plates, 37 DEG C, 5%CO
2cultivate 24h.
Transfection:
1) day before transfection, does not contain antibiotic culture medium inoculated culturing cell with appropriate, makes the degree of converging of cell during transfection reach 30 ~ 50% in 96 orifice plates;
2) transfection sample prepares oligomer-Lipofectamine as follows
tM2000 (a kind of transfection reagent) mixture:
A. with 25 μ l containing serum
i substratum (Gibco) dilutes the negative control of miR-299-5p antisense oligonucleotide (5 '-AUGUAUGUGGGACGGUAAACCA-3 '), negative control (SEQIDNo.5:5 '-CAGUACUUUUGUGUAGUACAA-3 '), FAM mark respectively, adding final concentration after in hand-hole is 50nM, mix gently, 3 multiple holes are established in each transfection;
B. Lipofectamine is mixed gently before using
tM2000 (Invitrogen), then get 0.25 μ l and use
i substratum is diluted to 25 μ l, at room temperature hatches 5min gently after mixing;
C. after hatching 5min, the Lipofectamine of dilution
tM2000 mix with the antisense nucleotide and contrast of dilution respectively, at room temperature hatch 20min, to allow the formation of mixture after mixing gently;
3) mixture being joined each comprises in the hole of cell and substratum, and the culture plate that rocks back and forth lightly mixes; The final concentration of antisense nucleotide and contrast is 50nM.
4) 37 DEG C, 5%CO
2after incubator continues to hatch 72 hours, microscopic examination U87/MG cell, takes a picture.
As shown in Figure 1, transfection is after 72 hours, the negative control (Figure 1A, Figure 1B) of FAM mark of the U87/MG cell Successful transfection more than 80%.After transfection negative control, U87/MG cell is complete, light transmission strong (Fig. 1 C); Most of U87/MG necrocytosis (Fig. 1 D) after transfection miR-299-5p antisense oligonucleotide.
Cytotoxicity experiment based on MTT:
The cell obtained in previous step, add MTT (Sigma) 5mg/ml (normal saline with 0.9%) prepared, every hole adds 20 μ l, 37 DEG C, 5%CO
2suck substratum and MTT after hatching 4 hours, every hole is added DMSO100 μ l and is read the absorbance (as table 1) of OD570-OD630 by microplate reader.
Table 1
Calculate inhibiting rate:
The inhibiting rate calculating Growth of Cells is 44.71 ± 4.64%.
Result shows: the antisense oligonucleotide of people miR-299-5p provided by the invention has good inhibition, to U87/MG growth inhibiting rate more than 40%.
Claims (7)
1. the purposes of the antisense oligonucleotide of a people microRNA-299-5p in the medicine of preparation treatment cerebral glioma, it is characterized in that, described antisense oligonucleotide is made up of the sequence with following nucleotide sequence complementation: 5 '-UGGUUUACCGUCCCACAUACAU-3 '.
2. purposes as claimed in claim 1, it is characterized in that, described antisense oligonucleotide sequence is 5 '-AUGUAUGUGGGACGGUAAACCA-3 '.
3. purposes as claimed in claim 1, it is characterized in that, described antisense oligonucleotide is the mosaic of ribonucleotide, deoxyribonucleotide or ribonucleotide and deoxyribonucleotide.
4. the purposes according to any one of claims 1 to 3, is characterized in that, described antisense oligonucleotide is modified further.
5. purposes as claimed in claim 4, is characterized in that, described modification is selected from one or more in ribose modification, base modification and phosphate backbones modification.
6. purposes as claimed in claim 5, is characterized in that, described modification is selected from one or more in thio-modification, the modification of 2 '-methoxyl group and cholesterol modification.
7. purposes as claimed in claim 1, is characterized in that, described antisense oligonucleotide and other treatment is medication combined uses.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110040777.7A CN102643810B (en) | 2011-02-18 | 2011-02-18 | The antisense oligonucleotide of people miR-299-5p and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110040777.7A CN102643810B (en) | 2011-02-18 | 2011-02-18 | The antisense oligonucleotide of people miR-299-5p and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102643810A CN102643810A (en) | 2012-08-22 |
| CN102643810B true CN102643810B (en) | 2015-12-16 |
Family
ID=46656887
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110040777.7A Active CN102643810B (en) | 2011-02-18 | 2011-02-18 | The antisense oligonucleotide of people miR-299-5p and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102643810B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104313171A (en) * | 2014-11-06 | 2015-01-28 | 南京大学 | MicroRNA molecular marker for diagnosing glioma and application of microRNA molecular marker |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005079397A2 (en) * | 2004-02-13 | 2005-09-01 | Rockefeller University | Anti-microrna oligonucleotide molecules |
| WO2009043353A2 (en) * | 2007-10-04 | 2009-04-09 | Santaris Pharma A/S | Micromirs |
-
2011
- 2011-02-18 CN CN201110040777.7A patent/CN102643810B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005079397A2 (en) * | 2004-02-13 | 2005-09-01 | Rockefeller University | Anti-microrna oligonucleotide molecules |
| WO2009043353A2 (en) * | 2007-10-04 | 2009-04-09 | Santaris Pharma A/S | Micromirs |
Non-Patent Citations (1)
| Title |
|---|
| MiRNA-196 Is Upregulated in Glioblastoma But Not in Anaplastic Astrocytoma and Has Prognostic Significance;Guan et al;《Clin Cancer Res》;20101231;4289-4297 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102643810A (en) | 2012-08-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102080086B (en) | Human miR-133a antisense nucleic acid and application thereof | |
| CN102533755A (en) | Human miR-328 antisense nucleic acid and application thereof | |
| CN102140468A (en) | Human miR-185* antisense nucleic acid and application thereof | |
| CN102031256B (en) | Human miR-485-5p antisense nucleic acid and application thereof | |
| CN102140469B (en) | Human miR (microRNA)-1233 antisensenucleic acid and application thereof | |
| CN102080085B (en) | Human miR-193b antisense nucleotide and application thereof | |
| CN101993877A (en) | Human miR-296-5p antisense nucleic acid and application thereof | |
| CN102643811B (en) | The antisense oligonucleotide of people miR-1229 and application thereof | |
| CN102080083B (en) | Human miR-149 antisense nucleotide and application thereof | |
| CN102643810B (en) | The antisense oligonucleotide of people miR-299-5p and application thereof | |
| CN102643809B (en) | The antisense oligonucleotide of people miR-1274b and application thereof | |
| CN102643807B (en) | Antisense oligodeoxyncleotide of human miR-484 and application thereof | |
| CN102643813B (en) | The antisense oligonucleotide of people miR-504 and application thereof | |
| CN102031254B (en) | Human miR-150 antisense nucleic acid and application thereof | |
| CN102140465B (en) | Human miR-1249 antisense nucleic acid and application thereof | |
| CN102140470B (en) | Human miR-1236 antisense ribonucleic acid and application thereof | |
| CN102140467B (en) | Human miR-365 antisense nucleic acid and application thereof | |
| CN102643806B (en) | The antisense oligonucleotide of people miR-1913 and application thereof | |
| CN102140464B (en) | Human miR-1238 antisense nucleic acid and applications thereof | |
| CN102643808B (en) | The antisense oligonucleotide of people miR-1539 and application thereof | |
| CN102643812B (en) | The antisense oligonucleotide of people miR-1227 and application thereof | |
| CN102643814B (en) | Antisense oligonucleotide for human miR-431 and application thereof | |
| CN102382825B (en) | Human miR-1826 antisense nucleic acid and application thereof | |
| CN102031255B (en) | Antisense nucleic acid of human miR-223 and applications of antisense nucleic acid | |
| CN102140462B (en) | Human miR-1260 antisense nucleic acid and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |