CN102140465B - Human miR-1249 antisense nucleic acid and application thereof - Google Patents
Human miR-1249 antisense nucleic acid and application thereof Download PDFInfo
- Publication number
- CN102140465B CN102140465B CN 201010612894 CN201010612894A CN102140465B CN 102140465 B CN102140465 B CN 102140465B CN 201010612894 CN201010612894 CN 201010612894 CN 201010612894 A CN201010612894 A CN 201010612894A CN 102140465 B CN102140465 B CN 102140465B
- Authority
- CN
- China
- Prior art keywords
- mir
- antisense oligonucleotide
- modification
- sequence
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses antisense oligonucleotide inhibiting human microRNA-1249 from expressing and application thereof. The antisense oligonucleotide is specifically combined with human miR-1249, contains a sequence complementary with at least 13 continuous nucleotides in a 5'-ACGCCCUUCCCCCCCUUCUUCA-3' nucleotide sequence, particularly a sequence of 5'-UGAAGAAGGGGGGGAAGGGCGU-3'. The antisense oligonucleotide can be ribonucleotide, deoxyribonucleotide or chimera of both, and can modify any nucleotide in a chain. The miR-1249 antisense oligonucleotide effectively inhibits miR-1249 in a human glioma cell from expressing, and inhibits the cell from growing and propagating so as to effectively treat human glioma and other miR-1249 high-expression tumors.
Description
Technical field
The invention belongs to technical field of biomedical materials and pharmaceutical field.Particularly, the present invention relates to the purposes of a kind of microRNAs (miRNA), especially relate to people microRNA-1249 (people miR-1249) antisense nucleic acid and application thereof.This antisense nucleic acid can be complementary with people miR-1249, thereby suppress the expression of people miR-1249 and play antineoplastic action.The invention still further relates to the pharmaceutical composition that contains this miRNA antisense nucleic acid.
Background technology
MiRNAs is little non-coding RNA, and length is 20-25bp, is normally transcribed by rna plymerase ii (PolII), and general initial product is the large pri-miRNA with cap sequence (7MGpppG) and polyadenylic acid tail (AAAAA).These pri-miRNA are processed into the pre-miRNA precursor product that 70 Nucleotide form under the effect of RNase III Drosha and its cofactor Pasha.RAN-GTP and exportin 5 are transported to this precursor molecule in tenuigenin.Subsequently, another RNase III Dicer shears it and produces the two strands that is about 22 length of nucleotides.This two strands is directed in (miRISC) complex body very soon, wherein contains Argonaute albumen, and ripe strand miRNA is retained in this mixture.Ripe miRNA is attached to the site of the mRNA complementary with it and expresses by two kinds of machine-processed negative regulator genes that depend on the sequence complementarity, and the miRNA not exclusively complementary with said target mrna suppresses its expression on the protein translation level.Yet, also evidence suggests recently, these miRNA also might affect the stability of mRNA.Use the miRNA binding site of this mechanism usually to hold non-translational region at 3 ' of mRNA.If miRNA and target site complete complementary (perhaps almost completely complementary), the combination of these miRNA often causes the degraded of target molecule mRNA so.MiRNAs is quite conservative in spore, and animal, the miRNAs that finds in plant and fungi etc. expresses all strict tissue specificity and timing.
At present, only have the biological function of very little a part of miRNAs to be elucidated.These miRNAs regulate Growth of Cells and tissue differentiation, and are relevant with biological growth and development.A series of studies show that: miRNAs is at Growth of Cells and apoptosis, and hemocyte breaks up, and Homeobox gene is regulated, neuronic polarity, and insulin secretion, the brain form forms, and heart occurs, and plays a significant role in the processes such as late embryogenesis growth.For example, miR-273 participates in the nervous system development process of nematode; MiR-430 participates in the brain development of zebra fish; MiR-181 controls the Mammals hematopoietic cell and is divided into the B cell; MiR-375 regulates mammalian islet cell and grows and insulin secretion; MiR-143 works at Adipocyte Differentiation; MiR-196 has participated in the Mammals four limbs and has formed, and miR-1 is relevant with heart development.Separately there is the researchist to find that many neural miRNAs are subject to sequential and regulate in pallium is cultivated, shows the mRNA translation that it may control compartmentation.
MiRNA expresses relevant to kinds cancer, and these genes may play tumor suppressor gene or oncogene effect.Find to have at first the change of miRNA expression level in B cell chronic lymphatic leukemia (CLL), the variation of miRNA expression level all detected successively subsequently in various human tumors.Research finds, it is relevant that miRNAs and tumour form, and can bring into play the effect (as miR-15a and miR-16-1) of tumor suppressor gene, can play again the effect (as miR-155 and miR-17-92 bunch) of oncogene.Think at present, in tumour cell, the ripe body of some miRNA or precursor expression horizontal abnormality, and the miRNA of abnormal expression plays a role by affecting the said target mrna translation, participates in neoplastic process, and plays an important role.Be subjected to the regulation and control of let-7 family as the Ras proto-oncogene, the BCL2 anti-apoptotic genes expression is subjected to miR-15a-miR-16-1 bunch of regulation and control, and the E2F1 transcription factor is subjected to miR-17-92 bunch of regulation and control, and the BCL6 anti-apoptotic genes expression is subjected to the regulation and control of miR-127 etc.The down-regulated expression of miRNAs also has substantial connection with tumour, and this is indicating that miRNA has the function of oncogene.For example, miR-143 and miR-145 obviously lower in colorectal carcinoma.What is interesting is, the precursor molecule of its hairpin structure is similar with content in healthy tissues in tumour, and this shows, the down-regulated expression of miRNAs may be because its course of processing is damaged.But the tumor suppressor gene function of miR-143 and miR-145 may not only be confined to colorectal carcinoma, and its expression amount is also obviously lowered in the clones such as mammary cancer, prostate cancer, uterus carcinoma, lymphatic cancer.Another report shows, miR-21 expresses increase in glioblastoma multiforme.The expression amount of this gene in tumor tissues than high 5-100 in healthy tissues doubly.
MiRNAs is natural antisense acting factor, can regulate and control the several genes relevant with propagation to eukaryote existence.Aspect oncotherapy, the application prospect of miRNA is bright.Utilizing miRNA as aspect the treatment target spot, existing experimental data support: as in the process of gemcitabine (gemcitabine) treatment, the variation of miRNA express spectra occurs; The expression level (as making miR-21 cross expression) of regulation and control part miRNA can be promoted cholangiocarcinoma cell to the susceptibility of chemotherapeutics.By introducing and the effective miRNAs in the deactivation tumour of the synthetic antisense oligonucleotide---anti-miRNA oligonucleotide (AMOs)---of the miRNA complementation with oncogene characteristic, delay its growth.Clinically, can methylate or the antisense oligonucleotide administration of locking the modifications such as nucleic acid (LNA) makes the miRNA inactivation by 2 '-O-frequent or that continue.These modifications make oligonucleotide more stable, and are lower than other treatment means toxicity.Use antagomirs (with the AMOs of cholesterol coupling), can effectively suppress the miRNA activity in Different Organs after the injection mouse, thereby may become a kind of medicine likely.Opposite, cross and express the miRNAs that those have the tumor suppressor gene effect, as let-7 family, also can be used for the treatment of some specific tumour.
Antisense oligonucleotide (Flanagan WM.Antisense comes of age.Cancer ﹠amp; Metastasis Reviews 1998; 17 (2): 169-76) refer to one section can with the Nucleotide of the base complementrity of its target gene.Antisense oligonucleotide can suppress the expression of corresponding gene.
People microRNA-1249 (has-miR-1249) is positioned at karyomit(e) No. 22, and precursor sequence is GGGAGGAGGGAGGAGAUGGGCCAAGUUCCCUCUGGCUGGAACGCCCUUCCCCCCCU UCUUCACCUG.Contain 1 ripe microRNA:hsa-miR-1249 (MIMAT0005901, sequence is ACGCCCUUCCCCCCCUUCUUCA).At present also not about the function of microRNA-1249 and the research report of expression level.
Nearly 30 years, although the complex therapy of tumour is very general clinically, but take operation as main, to be auxiliary complex therapy improve and not obvious the survival rate of tumour patient chemicotherapy, overall survival rate was still lower in 5 years, hovered in 30%~55% left and right, did not significantly improve, 5 years survival rates of middle and advanced stage patient are lower, are about 20%.And all there are limitation separately in these methods, particularly to middle and advanced stage and patients with recurrent unsatisfactory curative effect, to poorer with distant metastasis person's curative effect.Therefore, seeking safer and more effective treatment approach is the difficult problem that raising tumour patient survival rate and life quality need to be resolved hurrily.
Summary of the invention
The subject matter that the present invention will solve is to provide the antisense nucleic acid (inhibitor) of one group of new miR-1249, be used for efficient, low toxicity or suppress innocuously the expression of miR-1249, and then treat the disease that is caused by the miR-1249 overexpression, and comprise tumour, be especially cerebral glioma.
Another problem that the present invention will solve is to provide the purposes of above-mentioned antisense oligonucleotide in the medicine of the relative disease of preparation treatment mir-1249 overexpression.
The problem again that the present invention will solve is to provide a kind of pharmaceutical composition that comprises above-mentioned antisense nucleic acid.
The inventor has designed and synthesized a series of specificitys for the different antisense nucleic acid of the length of miR-1249 different zones by extensive and deep research, and the antisense nucleic acid that checking has inhibition in culturing cell.Studies show that growth and malignant proliferation ability that these antisense nucleic acides can inhibition tumor cell.
The present invention has designed a series of antisense nucleic acid molecules that can be incorporated into the miR-1249 different positions, in culturing cell U87/MG, the antisense nucleic acid cell growth ability that checking suppresses the miR-1249 expression specificity, the impact of multiplication capacity, antisense nucleic acid molecule length can comprise 13~25 nucleotide residues, inhibition growth of human tumor cells ability in various degree, the characteristic of multiplication capacity are all arranged, wherein the shortest antisense nucleic acid length is 13 bases, and the antisense nucleic acid of different lengths all has good growth of tumour cell and proliferation inhibition activity.Therefore, above-mentioned antisense nucleic acid all can be used to prepare the preparation of inhibition tumor cell energy for growth, multiplication capacity, wherein the tumour cell of preferred miR-1249 high expression level.Completed on this basis the present invention.
A first aspect of the present invention provides the antisense oligonucleotide of a kind of miR-1249, and described antisense oligonucleotide suppresses the expression of miR-1249 in people's cell.Usually, continuous 13~22 nucleotide sequence complementations in described antisense oligonucleotide and 5 '-ACGCCCUUCCCCCCCUUCUUCA-3 '.In a preferred embodiment of the invention, the length of described antisense oligonucleotide is 18~22 Nucleotide.More preferably, the sequence of described antisense oligonucleotide is 5 '-UGAAGAAGGGGGGGAAGGGCGU-3 '.
At present, in nucleic acid hybridization, RNA is higher than the avidity of DNA and miRNA hybridization with the hybridization avidity of miRNA, has very high pharmaceutical use.But artificial-synthetic DNA's the cost cost than synthetic RNA far away is low, also has good market potential.And can adopt the chimeric antisense nucleic acid that forms that is connected of ribose RNA monomer and ribodesose DNA single body to develop as medicine.A series of antisense nucleic acid molecules of the present invention's design had both comprised DNA molecular, also comprised the RNA molecule, and two kinds of molecules all have the activity that suppresses the miR-1249 expression.
the antisense nucleic acid of the present invention's design, it is active that its sequence has specific biological, it has much relations for the complementary length of the antisense nucleic acid in the site of a certain gene complementation, length as complementation is a little, biologic activity can be higher, inhibition also can be more better, increasing or reducing an antisense nucleic acid that is complementary to the same gene site to several bases, equally also has biologic activity in various degree, also can reach in various degree inhibition tumor cell growth and the effect of breeding, of the present invention studies show that, the shortlyest reach 13 bases and still have the effect that miR-1249 expresses that suppresses.In antisense nucleic acid research, various chemical modification methods are a lot, comprise one or more the combination etc. that is selected from ribose modification, base modification and phosphoric acid backbone modification.Will be clear that any modifying method that can increase antisense nucleic acid stability and bioavailability can use, as cholesterol modification, PEG modification, thio-modification, 2 '-methoxyl group modification etc.Described antisense oligonucleotide is modified through 2 '-methoxyl group herein.
Above-mentioned antisense nucleic acid of the present invention has the effect that suppresses the miR-1249 expression.After in the cell strain U87 that above-mentioned antisense nucleic acid is transfected into the miR-1249 high expression level, the effectively growth of inhibition tumor cell and malignant proliferation ability.
The present invention also provides a kind of pharmaceutical composition, and it contains oligonucleotide of the present invention and pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier includes but not limited to: salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with physiological saline or the aqueous solution that contains glucose and other assistant agents.
Described " significant quantity " refers to and can produce function or amount active and that can be accepted by people and/or animal to people and/or animal.
Described " pharmaceutically acceptable " composition is applicable to people and/or animal and without excessive bad side reaction (as toxicity, stimulation and transformation reactions), the material of rational benefit/risk ratio is arranged namely.
In a third aspect of the present invention, the purposes of antisense oligonucleotide of the present invention is provided, for the preparation of the medicine of the following disease for the treatment of: treatment human body and miR-1249 cross the relevant disease of expression, comprise tumour, are preferably cerebral glioma.
As used herein, " antisense oligonucleotide " refers to the nucleotide oligomer of antisense.Antisense oligonucleotide is by base complementrity (A-T, A-U, G-C) pairing forms three chains (anti-gene) with double-stranded DNA, or forms heteroduplex (antisense) with single stranded RNA, thus the processing and the translation that copy, transcribe or transcribe rear mRNA of blocking gene.Simultaneously, double-stranded RNA can be degraded by intracellular ribonuclease H (RNaseH), thereby more effectively blocks the expression of target gene.Because antisense nucleotide can only be combined with the target sequence of reverse complemental, has specificity high, the characteristics that side effect is little.
The length of antisense oligonucleotide of the present invention is not particularly limited, and in general, in order to reach the specificity of hybridization, antisense oligonucleotide needs the Nucleotide of at least 13 monomer compositions.Usually the length of antisense oligonucleotide is 13~35bp, and for the ripe body of miRNA, better antisense oligonucleotide length is 18~25bp.
Description of drawings
Fig. 1 has shown growth and the propagation of miR-1249 antisense oligonucleotide inhibition tumor cell U87/MG cell, the U87/MG cell after A, B the have been transfection negative control of FAM mark; C is U87/MG cell state after transfection negative control (5 '-CAGUACUUUUGUGUAGUACAA-3 '); D is U87/MG cell state after transfection miR-1249 antisense oligonucleotide (5 '-UGAAGAAGGGGGGGAAGGGCGU-3 ').
Embodiment
Antisense oligonucleotide of the present invention, continuous 13~25 nucleotide sequence complementations in its sequence and 5 '-ACGCCCUUCCCCCCCUUCUUCA-3 ', and also not complementary with the RNA sequence of other genes.In a preferred embodiment of the invention, the sequence of described antisense oligonucleotide be 5 '-UGAAGAAGGGGGGGAAGGGCGU-3 '.Antisense oligonucleotide provided by the invention can be modified outcome, it contains at least two, and at least 4 usually, better at least 6, at least 8 better Nucleotide do not have the Nucleotide of the modification of toxic side effects, and described modification mode comprises 2 ' methoxy substitution, thio-modification etc.In order to increase the cellular uptake rate of antisense oligonucleotide, can also carry out cholesterol to antisense oligonucleotide on the basis of above-mentioned modification and modify or the PEGization modification.Oligonucleotide after above-mentioned modification can continue effectively to match with target sequence, and has in vivo the longer transformation period than common not modified Yeast Nucleic Acid or thymus nucleic acid.
The present invention has following advantage:
1, antisense oligonucleotide acts on specific target site, the site of non-specific binding seldom, specificity is high;
2, antisense oligonucleotide provided by the invention is through suitable chemically modified, has that toxicity is low, side effect is little and the characteristics such as long half time;
3, antisense oligonucleotide provided by the invention has good inhibition, and the inhibiting rate of growth of tumour cell is surpassed 85%.
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail.Yet should be appreciated that and enumerate these embodiment just for an illustration, and be not to limit the scope of the invention.
Embodiment
Embodiment 1, miR-1249 antisense oligonucleotide are that U87/MG suppresses active detection to the neuroglia cell of human oncocyte
At first, by the synthetic miR-1249 antisense oligonucleotide of Shanghai JiMa pharmacy Technology Co., Ltd, sequence is: 5 '-UGAAGAAGGGGGGGAAGGGCGU-3 '.The sequence used that relates in an embodiment is synthetic by Shanghai JiMa pharmacy Technology Co., Ltd.
Cell cultures:
U87/MG cell (available from typical case's culture collection council of Chinese Academy of Sciences cell bank), 10%FBS-DMEM substratum (FBS is available from Gibco, and DMEM is available from Hyclone) is cultivated, and 37 ℃, 5%CO
2Cultivate.Collect the good U87/MG cell of growth conditions, centrifugal counting is with 2 * 10
3Every hole is laid in 96 orifice plates, and 37 ℃, 5%CO
2Cultivate 24h.
Transfection:
1) transfection the day before yesterday, with not containing in right amount antibiotic culture medium inoculated culturing cell, when making transfection, the degree of converging of cell reaches 30~50% in 96 orifice plates;
2) the transfection sample is prepared oligomer-Lipofecta mine as follows
TM2000 mixtures:
A. do not contain the Opti-MEM of serum with 25 μ l
I substratum (Gibco) dilutes respectively the negative control of miR-1249 antisense oligonucleotide (5 '-UGAAGAAGGGGGGGAAGGGCGU-3 '), negative control (5 '-CAGUACUUUUGUGUAGUACAA-3 '), FAM mark, after adding in hand-hole, final concentration is 50nM, mixing gently, each transfection are established 3 multiple holes;
B. mixing Lipofecta mine gently before using
TM2000 (Invitrogen) then get the Opti-MEM that 0.25 μ l is diluted to 25 μ l
The I substratum is at room temperature hatched 5min gently after mixing;
C. after hatching 5min, the Lipofecta mine of dilution
TM2000 mix with antisense nucleotide and the contrast of dilution respectively, at room temperature hatch gently 20min after mixing, to allow complex formation;
3) mixture is joined in each hole that comprises cell and substratum, the culture plate that rocks back and forth lightly mixes; The final concentration of antisense nucleotide and contrast is 50nM.
4) 37 ℃, 5%CO
2After incubator continued to hatch 72 hours, microscopic examination U87/MG cell was taken a picture.
As shown in Figure 1, transfection is after 72 hours, surpassed 80% U87/MG cell success transfection the negative control of FAM mark (figure A, B); After the transfection negative control, the U87/MG cell is complete, light transmission strong (figure C); Most of U87/MG necrocytosis after transfection miR-1249 antisense oligonucleotide (figure D).
Cytotoxicity experiment based on MTT:
The cell that obtains in the previous step adds MTT (Sigma) 5mg/ml (the physiological saline preparation with 0.9%) for preparing, and every hole adds 20 μ l, 37 ℃, 5%CO
2Hatch after 4 hours and suck substratum and MTT, every hole adds DMSO 100 μ l and reads the absorbance of OD570-OD630 by microplate reader.
Calculate inhibiting rate:
The inhibiting rate that calculates Growth of Cells is 89.83 ± 2.12%.
Result shows: miR-1249 antisense oligonucleotide provided by the invention has good inhibition, and the inhibiting rate that U87/MG is grown surpasses 85%.
Claims (6)
1. an antisense oligonucleotide is for the preparation of the purposes of the medicine for the treatment of cerebral glioma, it is characterized in that, described antisense oligonucleotide sequence is the chimeric sequence with ribonucleoside acid sequence, deoxyribonucleotide sequence or ribonucleotide and the deoxyribonucleotide of the complementation of 5 '-ACGCCCUUCCCCCCCUUCUUCA-3 ' nucleotide sequence.
2. purposes as claimed in claim 1, is characterized in that, described antisense oligonucleotide sequence is 5 '-UGAAGAAGGGGGGGAAGGGCGU-3 '.
3. purposes as claimed in claim 1 or 2, is characterized in that, described antisense oligonucleotide is further modified.
4. purposes as claimed in claim 3, is characterized in that, described modification is selected from one or more the combination in ribose modification, base modification and phosphoric acid backbone modification.
5. purposes as claimed in claim 4, is characterized in that, described modification is selected from one or more in thio-modification, 2 '-methoxyl group modification and cholesterol modification.
6. purposes as claimed in claim 1, is characterized in that, described antisense oligonucleotide and other treatment are medication combined to be used.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010612894 CN102140465B (en) | 2010-12-30 | 2010-12-30 | Human miR-1249 antisense nucleic acid and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010612894 CN102140465B (en) | 2010-12-30 | 2010-12-30 | Human miR-1249 antisense nucleic acid and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102140465A CN102140465A (en) | 2011-08-03 |
CN102140465B true CN102140465B (en) | 2013-06-12 |
Family
ID=44408262
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201010612894 Active CN102140465B (en) | 2010-12-30 | 2010-12-30 | Human miR-1249 antisense nucleic acid and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102140465B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105483272A (en) * | 2016-01-29 | 2016-04-13 | 北京泱深生物信息技术有限公司 | Molecular marker for diagnosing and treating intervertebral disc degeneration disease |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009149182A1 (en) * | 2008-06-04 | 2009-12-10 | The Board Of Regents Of The University Of Texas System | Modulation of gene expression through endogenous small rna targeting of gene promoters |
CN101842484A (en) * | 2007-09-14 | 2010-09-22 | 俄亥俄州立大学研究基金会 | Mirna expression in human peripheral blood microvesicles and uses thereof |
-
2010
- 2010-12-30 CN CN 201010612894 patent/CN102140465B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101842484A (en) * | 2007-09-14 | 2010-09-22 | 俄亥俄州立大学研究基金会 | Mirna expression in human peripheral blood microvesicles and uses thereof |
WO2009149182A1 (en) * | 2008-06-04 | 2009-12-10 | The Board Of Regents Of The University Of Texas System | Modulation of gene expression through endogenous small rna targeting of gene promoters |
Non-Patent Citations (1)
Title |
---|
胡锦等.靶向胰岛素样生长因子受体的RNA干扰技术抑制胶质瘤生长.《上海交通大学学报(医学版)》.2006,第26卷(第7期), * |
Also Published As
Publication number | Publication date |
---|---|
CN102140465A (en) | 2011-08-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102080086B (en) | Human miR-133a antisense nucleic acid and application thereof | |
CN102140468A (en) | Human miR-185* antisense nucleic acid and application thereof | |
CN102533755A (en) | Human miR-328 antisense nucleic acid and application thereof | |
CN102382824A (en) | Human miR-145 antisense nucleic acid and application thereof | |
CN102031256B (en) | Human miR-485-5p antisense nucleic acid and application thereof | |
CN102140469B (en) | Human miR (microRNA)-1233 antisensenucleic acid and application thereof | |
CN102080085B (en) | Human miR-193b antisense nucleotide and application thereof | |
CN101993877A (en) | Human miR-296-5p antisense nucleic acid and application thereof | |
CN102080083B (en) | Human miR-149 antisense nucleotide and application thereof | |
CN102643811B (en) | The antisense oligonucleotide of people miR-1229 and application thereof | |
CN102140465B (en) | Human miR-1249 antisense nucleic acid and application thereof | |
CN102140470B (en) | Human miR-1236 antisense ribonucleic acid and application thereof | |
CN102140467B (en) | Human miR-365 antisense nucleic acid and application thereof | |
CN102140464B (en) | Human miR-1238 antisense nucleic acid and applications thereof | |
CN102643807B (en) | Antisense oligodeoxyncleotide of human miR-484 and application thereof | |
CN102643814B (en) | Antisense oligonucleotide for human miR-431 and application thereof | |
CN102643813B (en) | The antisense oligonucleotide of people miR-504 and application thereof | |
CN102643809B (en) | The antisense oligonucleotide of people miR-1274b and application thereof | |
CN102382825B (en) | Human miR-1826 antisense nucleic acid and application thereof | |
CN102643810B (en) | The antisense oligonucleotide of people miR-299-5p and application thereof | |
CN102140462B (en) | Human miR-1260 antisense nucleic acid and application thereof | |
CN102140466B (en) | Human miR-1825 antisense nucleic acid and application thereof | |
CN102031255B (en) | Antisense nucleic acid of human miR-223 and applications of antisense nucleic acid | |
CN102031254A (en) | Human miR-150 antisense nucleic acid and application thereof | |
CN102643808B (en) | The antisense oligonucleotide of people miR-1539 and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
DD01 | Delivery of document by public notice |
Addressee: Cheng Wenhong Document name: Notification that Application Deemed not to be Proposed |
|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |