CN102399870B

CN102399870B - Reagent for determining survival and prognosis of patients with esophagus cancer

Info

Publication number: CN102399870B
Application number: CN201110316542.6A
Authority: CN
Inventors: 郭永; 陈照丽; 程京; 赫捷; 凯斯·米切尔逊; 张亮; 孟欣
Original assignee: Boao Biological Co Ltd; Tsinghua University; Cancer Hospital and Institute of CAMS and PUMC
Current assignee: TUMOUR INST CHINA MEDICAL SCIENCE RESEARCH ACADEMY; Tsinghua University; CapitalBio Corp
Priority date: 2006-11-28
Filing date: 2006-11-28
Publication date: 2014-04-16
Anticipated expiration: 2026-11-28
Also published as: CN102399870A

Abstract

The invention provides a method and composition for diagnosis, genotyping and prognosis of esophagus cancer according to the level or corresponding gene state of specific miRNAs. The invention also provides a composition containing components for lowering the level of miRNA. By using the composition, the survival rate of patients with esophagus cancer can be increased.

Description

The survive reagent of prognosis of a kind of definite esophagus cancer patient

The application is dividing an application of application number is 200680019815.8, the applying date is on November 28th, 2006, invention and created name is " for method and the composition of esophagus cancer diagnosis, prognosis and raising survival rate " application for a patent for invention.

Technical field

This application relates to the method for carrying out disease (for example esophageal carcinoma) diagnosis, prognosis and raising survival rate according to patient's microRNA level.

Background technology

The esophageal carcinoma is gastral the third-largest cancer, is also the lethal the seventh-largest cause of global cancer.The modal type of the esophageal carcinoma is squamous cell cancer and gland cancer.Squamous cell cancer betides the pinacocyte of arranging along oesophagus.Gland cancer betides oesophagus internal layer relevant with Barrett ' s oesophagus.

Squamous cell carcinoma of esophagus have typical from attacking heteroplasia to the developmental stage of aggressive squamous cell cancer, conventionally follow transfer (Wen et al., Fam.Cancer.2006 May 25 late period; [Epub ahead of print]).The esophageal carcinoma is conventionally followed and is permitted polygenic expression variation.Such as, COX-2 is conventionally relevant with heteroplasia with change hair tonic exhibition with VEGF, and related to cancer, (Liang et al, Cancer Res.2006,66:7111-7118 relevant to potential transfer; Vallbohmer et al, Arch Surg.2006,141:476-481; Fam.Cancer.2006 May 25, [Epub ahead of print]; Matsumoto et al, J Gastrointest Surg.2006,10:1016-1022; Soma et al, Int J Cancer.2006,119:771-782).

MicroRNA (miRNA) is that a class is little, 22 non-coding single stranded RNAs that Nucleotide is long, partially or completely with target sequence homology, interacting with the 3` non-coding region (3`-UTR) of target mRNA molecule, (Bartel, Cell 2004,116:281-297).The interaction of miRNA and target mRNA stops mRNA to be translated as albumen.In some cases, when target mRNA and miRNA exact matching, mRNA also can degrade.MiRNA participates in a series of cell processes, for example cytodifferentiation, Growth of Cells and necrocytosis (Cheng et al, Nucleic Acids Res 2005,33:1290-7; John et al, PLoS Biol.2004,2:e363).(Zamore and Haley, Science 2005,309:1519-1524) on human genome, according to estimates nearly 1000 miRNA.Approximately having 1/3rd human mRNA may be that (Lewis et al, Cell 2005,115:787-798) for potential miRNA target.

Increasing evidence shows, different miRNA sequences for generation and the development of cancer play an important role (Lu et al, Nature 2005,435:834-838; Volinia et al, Proc.Natl.Acad.Sci.USA 2006,103:2257-2261; Wynter, Med.Hypotheses.2006,66:612-35; Li et al, Biochem.Biophys.Res.Commun.2006,348:229-237).MiRNA gene is usually located at cancer on genome the site of modifying easily occurs, fragile site (FRAs) for example, breaking point and region, the Minimum Area of genome amplification, and lose heterogeneous region (Calin et al, Proc.Natl.Acad.Sci.USA.2002,99:15524-15529; Calin et al, Proc.Natl.Acad.Sci.USA.2004,101:2999-3004), in above explanation cancer, the variation of more viewed miRNA expression levels is results of genomic instability.

People utilize miRNA chip express spectra (Babak et al., RNA 2004,10:1813-9; Barad et al., Genome Res.2004,14:2486-94; Calin et al., Proc Natl Acad Sci USA.2004,101:11755-11760; Liu et al., Proc Natl Acad Sci USA.2004,101:9740-4; Nelson et al., Nat Methods 2004,1:155-61; Thomson et al., Nat Methods 2004,1:47-53; Ciafre et al., Biochem.Biophys.Res.Commun.2005,334:1351-1358; Shingara et al., RNA 2005,11:1461-1470), Magnetic bead hybridization (Lu et al., Nature 2005,435:834-838) and RT-PCR (Bandres et al., Mol Cancer 2006,5:29) studies the miRNA expression level of cancerous tissue.In many cancers, all found that miRNA expression level changes, lymphocytic leukemia (Calin et al. for example, Proc Natl Acad Sci USA.2004,101:11755-11760), the rectum cancer (Bandres et al., Mol Cancer 2006,5:29), glioblastoma multiforme (Ciafre et al., Biochem.Biophys.Res.Commun.2005,334:1351-1358) and thymic carcinoma (Iorio et al., Cancer Research 2005,65:7065-7070).At present, the cancerous tissue slicer of some preservations, as the paraffin-embedded tissue of formalin-fixed (FPPE) (Nelson et al., RNA 2006,12:187-191), stored frozen tissue (Lu et al, Nature 2005,435:834-838), or two kinds of methods each preserve organize application simultaneously (He et al, Nature 2005,435:828-833), or other do not clearly state tissue (Volinia et al., Proc Natl Acad Sci USA.2006, the 103:2257-2261 of preservation situation; Yanaihara et al., Cancer Cell 2006,9:189-198) is successfully applied to the analysis of miRNA express spectra in cancer.

Reference is all intactly classified in related all publications, patent, patent application and published patent application herein as.

Summary of the invention

The present invention relates to, according to the state of the level of miRNA or corresponding gene, carry out the diagnosis and prognosis of cancer, especially for the diagnosis and prognosis of the esophageal carcinoma.The present invention also provides the diagnosis and prognosis of application probe for cancer, particularly applying detection miRNA or corresponding gene state probes to be used for the diagnosis and prognosis of the diagnosis and prognosis, the particularly esophageal carcinoma of cancer in addition.

Corresponding therewith, the invention provides the method for individual cancer diagnosis, the method includes the steps of: a) measure at least one miRNA level in group of individuals tissue samples, b) the miRNA level in comparative measurement sample with reference to miRNA level, if miRNA level, with relatively having obvious change with reference to miRNA level, illustrates that individuality has canceration in working sample tissue.

On the other hand, the invention provides diagnosing esophageal cancer method in individuality, the method includes the steps of: a) measure in individual esophageal tissue sample and suspect and have canceration at least one miRNA level partly, for example measure at least one or its corresponding homologue in the miRNA in Fig. 1, b) the miRNA level in comparative measurement sample with reference to miRNA level, if miRNA level, with relatively having obvious change with reference to miRNA level, illustrates that individuality has esophagus cancer in working sample tissue.Specifically, the esophageal carcinoma that aforesaid method is measured can be esophageal squamous cell carcinoma, can be also adenocarcinoma of esophagus.

Specifically, the miRNA measuring in aforesaid method is not miR-29b, miR-29a, miR-96, miR-182s, miR-182as, miR-183 and miR-129-1, neither miR-15 and miR-16.

Specifically, in above-mentioned esophagus cancer diagnostic method, at least one (can be also for example at least 2,5,10,14) be determined from miRNA level or their corresponding homologue levels of the selection that contains SEQ ID Nos.1-14; If have at least a miRNA who contains SEQ ID Nos.1-14 or their corresponding homologues to have remarkable rising in detection in result, showing has esophagus cancer in sample.Under other particular case, at least one is determined from the level of the miRNA that contains SEQ ID Nos.15-38 and select or their corresponding homologues, if have at least a miRNA who contains SEQ ID Nos.15-38 or their corresponding homologues to have remarkable reduction in detection in result, showing has esophagus cancer in sample.Specifically, in aforesaid method, at least one miRNA selecting from SEQ ID Nos.1-14 selects from the miRNA of SEQ ID Nos.15-38 with at least one, if have at least a miRNA who contains SEQ ID Nos.1-14 to have the miRNA of remarkable rising and at least one SEQ ID Nos.15-38 to have remarkable reduction in detection in result, showing has esophagus cancer in sample.

Specifically, in aforesaid method, measure the level analyzing biochips method of miRNA.

Specifically, in aforesaid method, miRNA level is determined by the hybridization signal of miRNA on chip.Specifically in aforesaid method, between the hybridization signal of miRNA level by miRNA on chip and reference sample hybridization signal, ratio is determined.Either method in specifically Northern hybridization for miRNA level in aforesaid method, in situ hybridization and quantitative RT-polymerase chain reaction method is determined.

Specifically, a kind of in human body the method for diagnosing esophageal cancer, the method comprises to analyze suspects the corresponding gene appearance of at least one miRNA, for example corresponding gene appearance of the miRNA in Fig. 1 in the tissue part that has canceration in esophageal tissue's sample in human body; The gene appearance that relatively detects the miRNA in sample and gene appearance with reference to product miRNA, if the corresponding gene that detects the miRNA in sample tissue is with the obvious change of having compared with reference to gene in product miRNA, illustrate that human body has esophagus cancer.Specifically, the gene appearance of measuring miRNA in aforesaid method is determined by gene elmination or amplification.Specifically, in aforesaid method, the gene alteration of definite miRNA is the change according to gene copy number.

Specifically, for example the invention provides, for measuring at least one system of the level of miRNA or their corresponding analogs (or corresponding miRNA gene appearance), micro-array chip as shown in Figure 1; This system is comprised of a plurality of probes, each probe can detect a miRNA in esophageal tissue's sample or the gene appearance of corresponding miRNA, the probe of (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) can detect miRNA or their corresponding analogs as shown in Figure 1 to have 15% at least, or the gene appearance of corresponding miRNA.Specifically, the invention provides the system of carrying out diagnosis of esophageal, for example a micro-array chip; This system is comprised of many probes, each probe can detect the miRNA (or gene appearance of corresponding miRNA) in sample, and the probe of (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) can detect miRNA (or gene appearance of corresponding miRNA) as shown in Figure 1 to have 15% at least.

Specifically, the invention provides a system of application and carry out diagnosis of esophageal, this system is comprised of at least one (comprising for example at least 2,5,10,15,20,25,30,35 and 40) probe, oligonucleotide for example, each probe can detect the gene appearance of miRNA level as shown in Figure 1 or corresponding miRNA, if miRNA level or their corresponding analogues as shown in Figure 1, or at least one in the gene appearance of corresponding miRNA have obvious change, and the esophageal carcinoma has been described.Specifically, the invention provides application system and carry out diagnosis of esophageal, micro-array chip for example, this system is comprised of many probes, each probe can detect the level of the gene appearance of a miRNA in sample or corresponding miRNA, wherein have 15% at least and (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) probe can detect miRNA or their corresponding analogs as shown in Figure 1, or the level of the gene appearance of corresponding miRNA, if the level of the gene appearance of miRNA or their corresponding analogs or corresponding miRNA has considerable change to show there is the esophageal carcinoma as shown in Figure 1.

The present invention also provides the probe that detects miRNA for the preparation of said system.Specifically, for example the invention provides, with one or more probes (oligonucleotide) and manufacture for diagnosing the system of the individual esophageal carcinoma, each probe can detect miRNA or their corresponding analogs as shown in Figure 1, or the gene appearance level of corresponding miRNA.Specifically, probe for the present invention (for example oligonucleotide) is manufactured the system (for example micro-array chip) in order to diagnosis of esophageal, each probe can detect the level of a miRNA or the gene appearance of corresponding miRNA in sample, the probe of (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) can detect miRNA or their corresponding analogs as shown in Figure 1 to have 15% at least, or the gene appearance level of corresponding miRNA.

On the other hand, the present invention also provides the method for patient with esophageal carcinoma somatotype, for example, determine level of differentiation, neoplasm staging and the histological type of esophagus cancer.Specifically, the invention provides the method for dividing Patients With Carcinoma of Esophagus, comprise and for example judge level of differentiation, neoplasm staging and histological type, at least one miRNA in the individual human esophageal carcinoma of the method inclusion test, the miRNA that example is as shown in table 2 or their corresponding analogs, or the gene appearance of corresponding miRNA, and the level of miRNA or the gene appearance of corresponding miRNA are as the basis of dividing Patients With Carcinoma of Esophagus.

Specifically, the invention provides the method that determines individual esophageal carcinoma level of differentiation, miRNA as shown in Figure 2 a or the level of their corresponding analogs in the individual human esophageal carcinoma of inclusion test, or the gene appearance of corresponding miRNA, and the level of miRNA or the gene appearance of corresponding miRNA are as the basis that determines individual esophageal carcinoma level of differentiation.Specifically, the miRNA of detection at least one be hsa-miR-335 or its corresponding analogs.In some cases, at least one miRNA is hsa-miR-25 or its corresponding analogs.Specifically, the miRNA of detection at least one be hsa-miR-130b or its corresponding analogs.Specifically, the miRNA of detection at least one be hsa-miR-130a or its corresponding analogs.Specifically, the miRNA of detection at least one be hsa-miR-181d or its corresponding analogs.

Specifically, the invention provides a system and detect at least one miRNA as shown in table 2 or their corresponding analogs in sample, or the level of corresponding miRNA gene appearance, microarray system for example, this system includes a plurality of probes, each probe can detect a miRNA in sample or the gene appearance of corresponding miRNA, have 15% at least and (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) probe can detect miRNA as shown in table 2 or their corresponding analogs (or gene appearance of corresponding miRNA).Specifically, the invention provides by a system and divide patient with esophageal carcinoma, for example microarray; This system is comprised of a plurality of probes, each probe can detect a miRNA in sample or the gene appearance level of corresponding miRNA, and have 15% at least the probe of (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) can detect the level of miRNA as shown in table 2 or their corresponding analogs (or gene appearance of corresponding miRNA).

Specifically, the invention provides a system of application and divide patient with esophageal carcinoma, this system is comprised of one or more probes, and each probe can detect the level of miRNA as shown in table 2 or their corresponding analogs, or the gene appearance of corresponding miRNA.Specifically, the invention provides a system of application and divide patient with esophageal carcinoma, system is comprised of one or more probes, and each probe can detect a miRNA in sample, and at least 50% probe can detect the level of miRNA as shown in table 2 or their corresponding analogs.

Specifically, the invention provides the system that the one or more probe manufactures of application are divided patient with esophageal carcinoma, each probe can detect the level of miRNA as shown in table 2 or their corresponding analogs, or the gene appearance of corresponding miRNA.Specifically, the invention provides the system that application probe manufacture is divided patient with esophageal carcinoma, for example microarray; Each probe can detect the level of a miRNA in sample or the gene appearance level of corresponding miRNA, and have 15% at least the probe of (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) can detect the level of miRNA as shown in table 2 or their corresponding analogs (or gene appearance of corresponding miRNA).

Specifically, native system is applied to determine the level of differentiation of individual patient with esophageal carcinoma esophagus cancer.Specifically, native system is applied to divide squamous cell carcinoma of esophagus from pathology.Specifically, native system can be applied to determine the neoplasm staging of the individual esophageal carcinoma.

The present invention provides the method about the prognosis of judgement patient with esophageal carcinoma in addition on the one hand, comprises the existence prognosis that judges patient with esophageal carcinoma.Specifically, the existence method of prognosis of judgement patient with esophageal carcinoma is provided, the method includes the steps of: the level that a) detects at least one miRNA in individual human esophageal carcinoma sample, b) level of this miRNA and threshold value are compared, this ratio becomes positive correlation or negative correlation with individual survival rate.Specifically, the invention provides the method for the existence prognosis of judgement patient with esophageal carcinoma, comprise and analyze at least one miRNA gene appearance, for example the gene appearance of in hsa-miR-103, hsa-miR-107 and hsa-miR-23b, compares changing of gene appearance patient's high survival rate or low survival rate is described with check sample.

Specifically, in above-mentioned miRNA, at least one is one or their corresponding analogs in hsa-miR-103, hsa-miR-107 or hsa-miR-23b.Specifically, at least one miRNA is hsa-miR-107.Specifically, at least one miRNA is hsa-miR-23b.Specifically, survival rate is overall survival.Specifically, survival rate is disease free survival rate.Specifically, individual early stage in the esophageal carcinoma.Specifically, the method also comprises the suitable course for the treatment of that determines individuality.

The probe that the present invention also provides application can detect the gene appearance of miRNA level or corresponding miRNA, or application include one or more probes system for judging existence prognosis.Specifically, the invention provides one or more probes or include the existence prognosis that the system being comprised of one or more probes is judged patient with esophageal carcinoma, each probe can detect a miRNA in sample, the level of this miRNA and threshold value are compared, and this ratio survival rate individual with this becomes positive correlation or negative correlation.Specifically, the invention provides the one or more probes of application and judge the existence prognosis of patient with esophageal carcinoma, the level of miRNA and threshold value are compared, this ratio and this individual survival rate negative correlation, these miRNA have at least one to be hsa-miR-103, hsa-miR-107 or hsa-miR-23b or their corresponding analogs.

Specifically, the invention provides the one or more probe manufactures of application and predict the reagent (or system) of patient with esophageal carcinoma existence prognosis, each probe can detect the miRNA in sample, the level of this miRNA and threshold value are compared, and this ratio survival rate individual with this becomes positive correlation or negative correlation.Specifically, the reagent (or system) of predicting patient with esophageal carcinoma existence prognosis with one or more probe manufactures is provided, miRNA level and critical ratio and this individual survival rate negative correlation, such miRNA has at least one to be hsa-miR-103, hsa-miR-107 or hsa-miR-23b or their corresponding analogs.Specifically, having a miRNA at least is hsa-miR-103, hsa-miR-107 or hsa-miR-23b.

The present invention provides the method that improves patient with esophageal carcinoma survival rate simultaneously.Specifically, the invention provides the method that improves patient with esophageal carcinoma survival rate, the method comprises reagent, the ratio of this miRNA level and threshold value and this individual survival rate negative correlation that the significant quantity that reduces certain miRNA level is provided to patient.Specifically, the invention provides the application of reagent in preparing medicine that reduces certain miRNA level, this medicine is used for improving patient with esophageal carcinoma survival rate, the ratio of this miRNA level and threshold value and this individual survival rate negative correlation.

Specifically, the invention provides the method that improves patient with esophageal carcinoma survival rate, the method comprises that miRNA comprises hsa-miR-103, hsa-miR-107, hsa-miR-23b or their corresponding analogs to reducing the reagent of certain miRNA level with patient's effective dose.Specifically, the present invention also provides and has used the reagent that reduces certain miRNA level, in the medicine of preparation raising patient with esophageal carcinoma survival rate, applies, and this type of miRNA comprises hsa-miR-103, hsa-miR-107, hsa-miR-23b or their corresponding analogs.Specifically, these reagent reduce by two kinds in hsa-miR-103, hsa-miR-107 or hsa-miR-23b at least simultaneously.Specifically, these reagent can reduce hsa-miR-103, hsa-miR-107 and hsa-miR-23b simultaneously.

Specifically, the invention provides to contain and at least can reduce a kind of reagent of miRNA level and the medicinal composition of the applicable carrier of a kind of medicine, the miRNA that this medicinal composition can reduce comprises at least one in hsa-miR-103, hsa-miR-107 or hsa-miR-23b or their corresponding analogs.In some situation, at least one miRNA is hsa-miR-103.Specifically, at least one miRNA is hsa-miR-107.Specifically, at least one miRNA is hsa-miR-23b.Specifically, this kind of medicine is for example ribozyme of double-stranded RNA (for example short or little RNA interfering, or siRNA), antisense nucleotide or the RNA molecule with enzymic activity.

The present invention also comprises the test kit that above-mentioned the whole bag of tricks is provided.

Accompanying drawing explanation

Fig. 1 miRNA that level changes in patient with esophageal carcinoma.

Fig. 2 a miRNA that level changes in the patient with esophageal carcinoma of different differential periods.

Fig. 2 b is at the miRNA that in cap type and medullary squamous cell carcinoma of esophagus, level changes

Fig. 2 c miRNA that level changes in the patient with esophageal carcinoma of different tumor stages (N0/N1).

The miRNA of Fig. 3 expression level and esophageal carcinoma survival rate negative correlation.

The cluster analysis of the miRNA that microarray significance analysis for Fig. 4 (SAMs) method is picked out.There is 40 miRNA differential expression in freezing human esophageal carcinoma and cancer beside organism, the express spectra of these 40 miRNA in 31 pairs of sample groups is carried out to cluster analysis.Sample is arranged by row, and miRNA by rows.The sample that indicates # represents " mis-classification ".

Fig. 5 has compared the miRNA express spectra of flesh tissue and frozen tissue.MiRNA express spectra is verified by 5 pairs of flesh tissues.These 10 sample SVM method validations, confirm all correct classification of 10 samples.Indicate the learning sample prompting " mis-classification " of #.

Fig. 6 is the Kaplan-Meier survival curve of patient with esophageal carcinoma.The low expression (n=15) of Fig. 6 A prompting hsa-miR-103 and the overall survival positive correlation of patient with esophageal carcinoma, the overall survival negative correlation of the high expression level of hsa-miR-103 (n=16) and patient with esophageal carcinoma.The low expression (n=14) of Fig. 6 B prompting hsa-miR-107 and the overall survival positive correlation of patient with esophageal carcinoma, the overall survival negative correlation of the high expression level of hsa-miR-107 (n=17) and patient with esophageal carcinoma.The low expression (n=17) of figure C prompting hsa-miR-23b and the overall survival positive correlation of patient with esophageal carcinoma, the overall survival negative correlation of the high expression level of hsa-miR-23b (n=14) and patient with esophageal carcinoma.The figure D prompting low expression (n=15) of hsa-miR-103 and the disease free survival rate positive correlation of patient with esophageal carcinoma, the disease free survival rate negative correlation of the high expression level of hsa-miR-103 (n=16) and patient with esophageal carcinoma.The figure E prompting low expression (n=14) of hsa-miR-107 and the disease free survival rate positive correlation of patient with esophageal carcinoma, the disease free survival rate negative correlation of the high expression level of hsa-miR-107 (n=17) and patient with esophageal carcinoma.

embodiment

The present invention is the miRNA express spectra research of the genomic level based on 31 pairs of normal esophageal tissues and human esophageal carcinoma are carried out mainly.Specifically, be to compare the miRNA differential expression in cancerous tissue and corresponding adjacent tissues with micro-array chip.We find the miRNA of 40 high expression level or low expression in cancerous tissue.We have also found and under various disease state, have expressed discrepant miRNA.In addition, we also find that the level of three miRNA and the overall survival of patient with esophageal carcinoma and disease free survival rate are relevant.

The expression level of the present invention based on some miRNA or the state of corresponding gene, for example, for the diagnosis and prognosis of cancer (esophageal carcinoma) provides method and medicine.

From an aspect, we provide method and the medicine of relevant cancer (for example esophageal carcinoma) diagnosis based on some miRNA expression level.

From another aspect, we also provide based on some miRNA expression level, the method for dividing cancer patients, especially patient with esophageal carcinoma according to histological type, level of differentiation and neoplasm staging.

From another aspect, we also provide based on some miRNA expression level, judge method and the medicine of the existence prognosis of cancer patients, especially patient with esophageal carcinoma.

From an aspect, we provide the method that detects miRNA expression level with RT-PCR, in order to diagnose the illness.

The present invention provides the methodical system of above-mentioned institute and test kit.

" individuality " represents vertebrates, especially a Mammals, particularly people.Mammals not only refers to domestic animal, wild poultry, pet, primates, Mouse and rat.In some cases, individuality refers to people.In some cases, individuality refers to study the model animal of the esophageal carcinoma.That is to say, if that individual, refer to is not people, and miRNA just refers to corresponding analogs or the homologue of corresponding human miRNAs so.

In some cases, individuality refers to the male sex.In some cases, individuality refers to women.In some cases, the individual histological type that does not represent the esophageal carcinoma.In some cases, individuality has referred to esophageal carcinoma family history.

Here said one " esophageal tissue's sample " refers to the tissue samples of oesophagus.In some cases, tissue samples is flesh tissue.In some cases, tissue samples is frozen tissue.In some cases, tissue samples is fixed.In some cases, tissue samples is fixed by formaldehyde.In some cases, tissue samples is by paraffin embedding.As described below, according to concrete method, use complete tissue, or use the tissue that is divided into fritter, or cell mass or individual cells.

The esophageal carcinoma includes, but are not limited to squamous cell carcinoma of esophagus and adenocarcinoma of esophagus.

In order to diagnosing cancer, the particularly method of the esophageal carcinoma and medicine

From an aspect, the present invention is that the method that individual disease (for example cancer) diagnosis provides comprises: a) detect the level from least one miRNA of certain individual specimen; B) level of this miRNA and contrast are compared, the typical change of miRNA level can be used as the prompting of disease (for example cancer).

By the disease that the present invention can be diagnosed, comprise: cancer, for example lung cancer, mammary cancer, the esophageal carcinoma, cancer of the stomach, liver cancer, large bowel cancer, carcinoma of the pancreas, leukemia, lymphoma, kidney, bladder cancer, cervical cancer, carcinoma of endometrium, ovarian cancer, carcinoma of testis; Cardiovascular disorder, for example coronary heart disease, hypertension, arteriosclerosis; Age related disease, for example Parkinson's disease, A Erci Mohs disease, diabetes.

From an aspect, the present invention comprises for the method that esophagus cancer diagnosis provides: a) detect for example, level from least one miRNA (at least one miRNA showing in Fig. 1 or their corresponding homologues) of esophageal tissue's sample of certain esophageal carcinoma suspected case; B) by the level of this miRNA with reference to comparing, the characteristic of miRNA level changes the prompting that can be used as the esophageal carcinoma.

In some cases, the present invention comprises for the method that esophagus cancer diagnosis provides: a) for example, by the miRNA of the esophageal tissue's sample from certain esophageal carcinoma suspected case (at least one miRNA showing in Fig. 1 or their corresponding homologues) level with reference to comparing; B) according to the characteristic of at least one miRNA level, change to judge whether individuality suffers from the esophageal carcinoma.In some cases, method also comprises the step that obtains esophageal tissue's sample from individuality.In some cases, method also comprises the step of extracting miRNA from tissue samples.

In some cases, the present invention comprises for the method that esophagus cancer diagnosis provides: a) detect for example, level from least one miRNA (at least one miRNA showing in Fig. 1 or their corresponding homologues) of esophageal tissue's sample of certain esophageal carcinoma suspected case; B) according to the level of this miRNA, provide information for esophagus cancer diagnosis, the level of this miRNA can be used as diagnostic base, and the characteristic of this miRNA level changes the prompting that can be used as the esophageal carcinoma.

In some cases, miRNA is not miR-29b, miR-29a, and miR-96, miR-182*, miR-182a*, miR-183, and miR-129-1, in some cases, miRNA is not miR-15 and miR-16.

In some case, detect the level of at least one miRNA (being at least for example in 2,5,10) in SEQ ID numbering 1-14 or corresponding analogs, wherein the remarkable increase of at least one miRNA level can be pointed out the esophageal carcinoma.In some case, detect the level of at least one miRNA (being at least for example in 2,5,10,15,20,24) in SEQ ID numbering 15-38 or corresponding analogs, wherein the remarkable increase of at least one miRNA level can be pointed out the esophageal carcinoma.In some case, for example, at least one miRNA (being at least in 2,5,10,14) and SEQ ID numbering 15-38 or corresponding analogs at least one miRNA (being at least for example in 2,5,10,14) in detection SEQ ID numbering 1-14 or corresponding analogs, wherein in Fig. 1, number in the miRNA of 1-14 and their corresponding analogs and have at least a miRNA level significantly to increase, number in the miRNA of 15-38 and their corresponding analogs simultaneously and have at least the remarkable decline of miRNA level can point out the esophageal carcinoma.

In some case, we detect the level of all miRNA shown in Fig. 1, in SEQ ID numbering 1-14, the level of at least one miRNA (being at least for example in 2,5,10) raises, and in SEQ ID numbering 15-38, the level decline of at least one miRNA (being at least for example in 2,5,10,14) can be pointed out the esophageal carcinoma simultaneously.In some cases, in SEQ ID numbering 1-14, the level of at least two miRNA raises, and in SEQ ID numbering 15-38, the level decline of at least two miRNA can be pointed out the esophageal carcinoma simultaneously.In some cases, the level of the miRNA in SEQ ID numbering 1-14 raises, and the level decline of the miRNA in SEQ ID numbering 15-38 simultaneously can be pointed out the esophageal carcinoma.

In tissue samples, the level of miRNA can reflect the variation of miRNA gene appearance.The change of gene appearance can be reflected or be changed to reflect by the copy number of miRNA gene by miRNA genetically deficient or amplification.

Therefore in some cases, the method that we provide for esophagus cancer diagnosis comprises at least one miRNA (at least one miRNA for example showing in Fig. 1 or their corresponding homologues) gene appearance of analyzing from the tissue samples of esophageal carcinoma suspected case, if can point out the esophageal carcinoma than the change of check sample producer state.In some cases, the change of gene appearance is decided by miRNA genetically deficient or amplification, and in some cases, the change of gene appearance is decided by the copy number variation of miRNA gene.

In some cases, the method that we provide for esophagus cancer diagnosis comprises that analysis is from the miRNA shown at least one Fig. 1 of the tissue samples of esophageal carcinoma suspected case, see whether this miRNA gene has disappearance or amplification, if can point out the esophageal carcinoma than check sample producer disappearance or amplification.For example, in some cases, whether the miRNA gene that we analyze in SEQ ID numbering 1-14 increases, and the amplification of at least one miRNA gene can be pointed out the esophageal carcinoma.In some cases, whether the miRNA gene that we analyze in SEQ ID numbering 15-38 lacks, and the disappearance of at least one miRNA gene can be pointed out the esophageal carcinoma.In some cases, method also comprises the step that obtains esophageal tissue's sample from suspected case.In some cases, method also comprises the step of extracting DNA from tissue samples.

In some cases, the method that we provide for esophagus cancer diagnosis comprises in the tissue samples of analyzing from esophageal carcinoma suspected case, whether has the variation of the miRNA gene copy number shown in Fig. 1.If had on women's euchromosome or sex chromosome more than two miRNA genes, if there is more than one miRNA gene can point out the esophageal carcinoma on male sex chromosome.For example, in some cases, we analyze the copy number of the miRNA gene in SEQ ID numbering 1-14, if at least one miRNA gene has more than two copy numbers on women's euchromosome or sex chromosome, have more than one copy number can point out the esophageal carcinoma on male sex chromosome.In some cases, we analyze the copy number of the miRNA gene in SEQ ID numbering 15-38, if at least one miRNA gene is less than two copy numbers on women's euchromosome or sex chromosome, on male sex chromosome, is less than a copy number and can points out the esophageal carcinoma.In some cases, method also comprises the step that obtains esophageal tissue's sample from suspected case.In some cases, method also comprises the step of extracting DNA from tissue samples.

MiRNA as described herein has following effect: according to the level of an above miRNA in human esophageal carcinoma sample and a treatment that above miRNA gene appearance is divided the progress of Patients With Carcinoma of Esophagus type, the prediction esophageal carcinoma, the course of disease of monitoring Patients With Carcinoma of Esophagus and monitoring Patients With Carcinoma of Esophagus.

In some situation, we for example provide, for detecting the system (microarray) of miRNA as shown in Figure 1 or their corresponding analogs level, or for example provide, for detecting the system (microarray) of the gene appearance of miRNA as shown in Figure 1 or their corresponding analogs.These systems are for judging that as shown in Figure 1 miRNA or their corresponding analogs level and diagnosis of esophageal are very useful.Tell about emphatically to detect the system of miRNA level below, but for the personnel that are familiar with this generic operation, also can skillfully grasp the system that detects miRNA gene appearance.

In some situation, we for example, judge at least one level of miRNA or their corresponding analogs (or corresponding miRNA gene appearance) as shown in Figure 1 by a system (microarray), system is comprised of many probes, each probe can detect the miRNA (or gene appearance of corresponding miRNA) in esophageal tissue's sample, have 15% at least and (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) probe can detect miRNA or their corresponding analogs (or gene appearance of corresponding miRNA) as shown in Figure 1.In some situation, we for example, carry out diagnosis of esophageal by a system (microarray), system is comprised of many probes, each probe can detect the miRNA (or gene appearance of corresponding miRNA) in sample, and the probe of (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) can detect miRNA (or gene appearance of corresponding miRNA) as shown in Figure 1 to have 15% at least.In some situation, we for example, carry out diagnosis of esophageal by a system (microarray), system for example, is comprised of at least one (comprising for example at least 2,5,10,15,20,25,30,35 and 40) probe (oligonucleotide), and each probe can detect miRNA level (or gene appearance of corresponding miRNA) as shown in Figure 1.To describe these systems (for example microarray) below in detail.

The system of these diagnosis of esophageal can have multiple effect.In some situation, we carry out diagnosis of esophageal by a system, system for example, is comprised of at least one (comprising for example at least 2,5,10,15,20,25,30,35 and 40) probe (oligonucleotide), each probe can detect miRNA level (or gene appearance of corresponding miRNA) as shown in Figure 1, thus as shown in Figure 1 in miRNA or their corresponding analogues (or gene appearance of corresponding miRNA) horizontal properties of at least one change and can point out the esophageal carcinoma.In some situation, we for example, carry out diagnosis of esophageal by a system (microarray), system is comprised of many probes, each probe can detect the level of a miRNA (or gene appearance of corresponding miRNA) in sample, thereby have 15% at least and (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) probe can detect the level of miRNA as shown in Figure 1 or their corresponding analogs (or gene appearance of corresponding miRNA), and the horizontal properties of miRNA or their corresponding analogs (or gene appearance of corresponding miRNA) changes and can point out the esophageal carcinoma as shown in Figure 1.

It is below the description about the probe of manufacturing system detection miRNA used.In some situation, we for example, manufacture to diagnose the system of the individual esophageal carcinoma with one or more probes (oligonucleotide), each probe can detect the level of miRNA as shown in Figure 1 or their corresponding analogs (or gene appearance of corresponding miRNA).In some situation, we for example, manufacture the system (for example microarray) in order to diagnosis of esophageal with probe (oligonucleotide), each probe can detect the level (or gene appearance of corresponding miRNA) of a miRNA in sample, and have 15% at least the probe of (for example comprise at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%) can detect the level of miRNA as shown in Figure 1 or their corresponding analogs (or gene appearance of corresponding miRNA).

The miRNA that diagnosis of esophageal is related

40 miRNA that level is relevant to the esophageal carcinoma have been determined in existing invention.As shown in Table 2 and Figure 1.Fig. 1 provides title, sequence and the chromosomal localization of these miRNA.Can pass through the information that http://miRNA.sanger.ac.uk/. (referring to Griffths-Jones et al., Nucleic Acids Research, 2006, Vol.34, Database issue) obtains these miRNA.MiRNA level and the gene appearance of the method for diagnosis of esophageal based on shown in Fig. 1.System as described herein is exactly for the miRNA level shown in surveillance map 1, and then diagnosis of esophageal.

By practice, can determine that these methods are in order to detect the sensitivity accepted and the specificity of single miRNA, yet when detection more than two during miRNA the validity (for example sensitivity and specificity) of method will greatly improve.For example, in some cases, at least to detect 3,4 in Fig. 1,5,6,7,8,9,10,15,20,25,30,35 or No. 38 miRNA.

In some cases, we at least detect two miRNA (being at least for example in 3,5,10) in SEQ ID numbering 1-14.In some cases, we at least detect two miRNA (being at least for example in 3,5,10,15,20) in SEQ ID numbering 15-38.In some cases, we at least detect miRNA in SEQ ID numbering 1-14 and the gene appearance of a miRNA in SEQ ID numbering 15-38.In some cases, we at least detect the gene appearance that two miRNA (being at least for example in 3,5,10) in SEQ ID numbering 1-14 and SEQ ID number two miRNA (being at least for example in 3,5,10,15,20) in 15-38.In some cases, we detect the gene appearance of all miRNA in Fig. 1.

In some cases, need to judge the level of the corresponding analogs of above-mentioned miRNA." corresponding analogs " of above-mentioned miRNA refers to the miRNA (also comprising at least 60%, 70%, 80%, 90%, 95%, 98% and 99% sequence similarity) with miRNA with at least 50% sequence similarity.For example, the corresponding analogs of SEQ ID NO:1 miRNA has the sequence similarity (also comprising at least 60%, 70%, 80%, 90%, 95%, 98% and 99% sequence similarity) with SEQ ID NO:1 miRNA at least 50%.

The miRNA with reference sequences (SEQ ID NO:1 miRNA) with 95% above similarity can think identical with reference sequences, unless every 100 Nucleotide have 5 point mutation.These 5 point mutation can be disappearances, replace, insert, and can, in the generation Anywhere of sequence, can be dispersed in reference sequences or concentrate on one or more bunches of reference sequences.

Esophagus cancer diagnosis method based on miRNA level

In some cases, esophagus cancer diagnosis method is based on miRNA level.

Here said " level " refers to amount or the speed that miRNA or its precursor are piled up.This word can refer to the absolute magnitude (for example representing by hybridization signal intensity) of miRNA in certain sample, also can refer to miRNA amount and the ratio contrasting (the hybridization signal ratio for example contrasting with sample ratio) in sample.Contrast miRNA can be the relatively constant different miRNA of level in same sample, can be also same miRNA in different samples (for example, from the non-cancer tissue sample of same individuality, or the tissue samples of another non-esophageal carcinoma individuality).

The precursor of miRNA molecule or " miRNA precursor " refer to miRNA genetic transcription of not shearing, and typically comprise rna transcription of about 70 length of nucleotides.MiRNA precursor for example, is become active miRNA molecule by RNA enzyme (Dicer, Argonaut or RNA enzyme III) digestion, is typically 19-25 length of nucleotides.

" the miRNA level of esophageal tissue's sample " refers to the miRNA level of tissue samples.In most of the cases, the miRNA level of esophageal tissue's sample is that the miRNA level by direct measurement esophageal tissue sample obtains, yet the miRNA level of esophageal tissue's sample also can for example, reflect as sputum by lymphoglandula (contiguous lymphoglandula or lymph liquid) sample, blood plasma, whole blood or the body fluid being close to.In some cases, miRNA level is that for example, miRNA level by lymphoglandula sample (lymphoglandula work is cut or pin inhale) decides.In some cases, miRNA level is to decide by the miRNA level in whole blood or blood plasma.In some cases, miRNA level is that the miRNA level that esophageal tissue draws in the net decides.In some cases, miRNA level is to guide the miRNA level (for example RT-PCR analyzes) in sampling gained sample to decide by endoscope.It is the technology of invasive minimum that the pin of endoscope guiding is inhaled (FNA) sampling, especially applicable for the sampling of mediastinal lymph nodes Non-surgical, and can carry out more detailed molecular marker analysis.To the miRNA horizontal analysis of non-human esophageal carcinoma, can combine use separately and with other method.For example, can first determine the miRNA level in blood plasma, the miRNA level of analyzed area lymphoglandula then, the analysis of multi-step can provide abundanter information and increase the confidence level of diagnosis like this.

Can detect in different periods miRNA level.For example, can be in the preoperative, in art, postoperative, and before oncotherapy, in treatment, detect miRNA level after treatment.In some cases, the miRNA level that the horizontal Shi You of miRNA esophageal tissue draws in the net in obtained sample (particularly esophageal tissue) decides.

The method of measuring miRNA level has report in the literature.For example, Northern dot hybridization, in situ hybridization, RT-PCR and microarray.These methods have report in the literature, Einat for example, Methods Mol.Biol.2006,342:139-157; Thompson et al., Genes Dev.2006,20:2202-2207.

According to classical way, total RNA of cell can be by kytoplasm homogenization in the environment at nucleic acid extraction damping fluid and then centrifugal obtaining.Nucleic acid is precipitated, and DNA is by DNA enzyme effect centrifugal rear removal again.RNA uses gel electrophoresis separated by standardisation technique, then transfers to nitrocellulose filter, carries out Northern dot hybridization etc.RNA is fixed on film by heating.By the fluorescently-labeled DNA with target RNA complementation or rna probe, identify with quantitative.On one-tenth phase film, by radioautograph method, also can identify miRNA.Be scanned into phase film, horizontal accurate quantification that can be to rna transcription.Also can to hybridization spot, carry out rna level accurate quantification by light tomography computer method of calculation.

Except Northern and other dot hybridization technology, the sub-level of rna transcription can also be measured by situ hybridization.This technology is that whole cell or tissue is fixed on cover glass, and the probe that utilization contains radioactive rays mark or the solution of other mode label probes (for example cRNA probe) are measured the nucleic acid of cell or tissue.

MiRNA level also can, by miRNA transcripton reverse transcription, then be carried out polymerase chain reaction,PCR (RT-PCR) and detect.The level of miRNA can be by comparing quantitatively with internal reference, and internal reference can be the mRNA of house-keeping gene in same sample etc.Suitable house-keeping gene as internal reference comprises myosin, 3` phosphoglyceraldehy-de dehydrogenase or people U6 gene.There are in the literature quantitative RT-PCR and other description of related art.Table 1 has been listed the conventional primer of RT-PCR.In some cases, real-time RT-PCR (qRT-PCR) detection miRNA cuts than classical tissue work or is sensitiveer in the early stage miRNA staining examine of cancer method.QRT-PCR detection miRNA level is sensitiveer and special method for diagnosis, classification and the prognosis evaluation of the esophageal carcinoma.Existing invention, provides the method that detects individuality (suffering from disease, for example the individuality of cancer) miRNA level with RT-PCR.In some cases, miRNA level detects by qRT-PCR method.

In some cases, miRNA level detects with the microarray that this literary composition is described.

Nucleic acid probe described in aforesaid method can obtain by the method for vitro recombination or chemosynthesis, and this has been reported in the literature.In addition, hybridization probe can carry out mark by different marking methods, for example radio isotope, fluorescent substance, reporting system enzyme, vitamin H and other parts.The all right coupling optical detection material of these detectable markers, and then can detect with photochemical method.The probe of mark and detection also has report in the literature.

Nucleic acid probe for detection of miRNA can be hybridized by the miRNA under stringent condition and in sample.According to diverse ways, the mature technology in document can change condition, thereby optimizes the detection to specific miRNA in specific sample.

Generally speaking, the stability dependency of hybrid is in ionic concn and temperature.In general, hybridization carries out under the condition of low preciseness, then under the condition of high preciseness, washs.Appropriateness preciseness hybridization refers to for example condition of probe and complementary nucleic acid molecule hybridization of nucleic acid molecule that allows.The nucleic acid molecule of hybridization has 60% similarity at least, also comprises 70%, 75%, 80%, 85%, 90%, or 95% similarity.Appropriateness preciseness hybridization conditions is equivalent to 42 ℃ hybridizes under 50% methane amide, 5xDenhart`s solution, 5xSSPE, 0.2%SDS condition, and then 42 ℃ are washed with 0.2xSSPE, 0.2%SDS.High preciseness hybridization conditions can be 42 ℃ hybridizes under 50% methane amide, 5xDenhart`s solution, 5xSSPE, 0.2%SDS condition, and then 65 ℃ are washed with 0.1xSSPE, 0.1%SDS.

Low preciseness hybridization refers under the hybridization conditions suitable with following condition hybridizes: 10% methane amide, 5 * Denhart ' s solution, 6 * SSPE, 0.2%SDS, 22 ℃ of hybridization, then clean with 1 * SSPE, 0.2%SDS at 37 ℃.Denhart ' s solution contains 1%Ficoll, 1% polystyrene triphenol and 1% bovine serum.20 * SSPE (sodium-chlor, sodium phosphate, EDTA) contains 3M sodium-chlor, 0.2M sodium phosphate and 0.025M EDTA.The moderate preciseness that other are suitable and high preciseness hybridization solution and condition all for this reason the people in field know, they also reported, for example: Sambrook et al, Molecular Cloning:A Laboratory Manual, 2nd ed, Cold Sping Harbor Press, Plainview, N.Y. (1989); And Ausubel et al., supra, 1999).

Specifically, the level of miRNA obtains from a patient at more than one time point.The method of this " continuous " sampling is well suited for the cancer development of patient with esophageal carcinoma is monitored.Serial sampling can be carried out at different time points as required, as every half a year, every year, every two years or longer time sampling once.Between the level measuring and reference level relatively can measure a fresh sample at every turn after carry out, carry out again after also can obtaining certain take off data.

Method described here, reference level refer to the level that certain miRNA is considered to " normally " conventionally.Sometimes, reference level refer to the miRNA level in the non-human esophageal carcinoma of same person.Sometimes, refer to the people's who there is no the esophageal carcinoma level.Sometimes refer to that a group does not have the people's of the esophageal carcinoma the mean level (ML) of level.Sometimes, reference level come from sample library, comprise sample itself.Reference level can determine also can in measure sample, determine in advance.

The value of " reference " can be absolute value as used herein, and relative value has the value of the upper limit or lower limit, a sequential value, and mean value, intermediate value, intermediate value, or contrast or the value of benchmark value comparison with specific.

With reference value can be relatively in Fig. 11,2,3,4,5,6,7,8,9,10,15,20,25,30,35, or any miRNA of 38 or their homologue.Comparing the process of a miRNA level and reference level can carry out according to the type that detects miRNA value in tissue method easy to use.For example, when the hybridization signal by miRNA detects miRNA level, the naked eyes that relatively may pass through of level compare the power of hybridization signal qualitatively.For detection by quantitative, relatively may pass through observed data, the connotation of seeing clearly data representative carry out (as, by observed data diagrammatic representation, such as histogram, linear graph).Process relatively can be that manual (as the method by professional is carried out vision observation) can be also automatic.

Sometimes, contrast is (for example, relatively the difference of " ratio " or per-cent) that the order of magnitude by level that compare and measure and reference carries out.At this, it is different from the order of magnitude between reference value that " ratio " refers to the miRNA observed value of numeral description.

In miRNA level one " distinctive change " may to be that in patient, miRNA level is significant relative reference level reduce or increase." significantly increase " referred to herein as miRNA level at least increases by 5%, for example comprises at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50% or more.Similarly, " significantly reduce " refers to miRNA level and at least reduces 5%, for example comprises at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50% or more.

The summary that the miRNA meaning that Fig. 1 shows changes.The change of miRNA horizontal properties is the basis for diagnosis of esophageal.For example, sometimes, in SEQ ID Nos.1-14, the level of at least one miRNA has been determined, at least one significant just hint that increases of the miRNA level of measurement has the possibility of suffering from the esophageal carcinoma.Sometimes, in SEQ ID Nos.15-38, the level of at least one miRNA has been determined, at least one significant just hint that reduces of the miRNA level of measurement has the possibility of suffering from the esophageal carcinoma.Sometimes, in SEQ ID Nos.1-14 the level of at least one miRNA determined with SEQ ID Nos.15-38 in the level of at least one miRNA determined, in SEQ ID Nos.1-14, have at least one significant increase and SEQ ID Nos.15-38 in have at least one to reduce the possibility that hint just has the trouble esophageal carcinoma significantly.

Sometimes in Fig. 1, all miRNA levels have all determined, have at least in a significant increase and SEQ ID Nos.15-38 and have at least a significant minimizing with regard to hint, to have the possibility of the trouble esophageal carcinoma in SEQ ID Nos.1-14.Sometimes, in SEQ ID Nos.1-14, have at least in two significant increases and SEQ ID Nos.15-38 and have at least two significant minimizings with regard to hint, to have the possibilities of the trouble esophageal carcinoma.

In those situations, when when using more than one miRNA, the level of these miRNA inconsistent hint suffer from the esophageal carcinoma, the indication of " great majority " can be considered to detected result.For example, when using 5 miRNA, wherein 3 hints have the esophageal carcinoma, and result can think that hint this person is diagnosed as the esophageal carcinoma.Yet in some cases, the diagnosis of the esophageal carcinoma needs at least one or the how special distinctive variation of miRNA.For example, suppose that a miRNA is has-miR-16, the significant increase of has-miR-16 level may be the prerequisite of esophagus cancer diagnosis.

Diagnostic method based on miRNA gene level

In some cases, the level of the gene based at least one miRNA in Fig. 1 or their homologue in patient's sample can provide multiple esophagus cancer diagnosis method.

Sometimes, the assessment of gene level is by analyzing deletion or the amplification of at least one miRNA gene in sample, detects to delete or increase to imply that this patient has the possibility of suffering from the esophageal carcinoma with respect to control sample in miRNA gene.

The deletion of miRNA gene or amplification can be by detecting structure or the sequence of gene in the patient's who suffers from the esophageal carcinoma under a cloud human esophageal carcinoma cell, then with gene structure or the sequence contrast of control sample.Anyly be applicable to detect the technology that gene structure or sequence change and can be used to put into practice this method.For example, miRNA gene elmination or amplification can hybridize to realize by Southern Blot and the miRNA sequence specific dna probe of genomic dna.Also can utilize sequential analysis and single strand conformation polymorphism.

The deletion of miRNA gene or amplification also can detect by these gene fragments of pcr amplification, whether identical with contrast analyze the fragment sequence or the length that from patient DNA sample, increase out by order-checking or electrophoresis.The deletion of miRNA gene also can be identified by near the deletion of the chromosomal marker it.

MiRNA gene level in a patient's cell also can be assessed by the copy number of at least one miRNA gene in measure sample, wherein gene only has a copy number to mean that this patient has the possibility of suffering from the esophageal carcinoma, rather than two copies on somatic chromosome and on female chromosome, a copy on neither male sex's karyomit(e).

Any technology that is applicable to detect gene copy number can be applied to this method, comprises Southern Blot and pcr amplification technology.The method that also has miRNA copy number in a definite human esophageal carcinoma sample is to be all closely connected with chromosomal marker or other genes according to a lot of miRNA or gene cluster.In patient, the loss of a miRNA gene being connected with mark or other heterozygous geness can be learnt from the information of heterozygosity or marker gene.Therefore the technology of determining heterozygosity mark also can be used for this method.

" control sample " can be from the tissue sample that there is no patient with esophageal carcinoma.Or from a group patient's tissue sample set.

MiRNA

1,2,3,4,5,6,7,8,9,10,15,20,25,30,35 in Fig. 1, or the gene level of 38 any one or its homologues can be determined.When use more than one miRNA gene level but and inconsistent while showing to have the esophageal carcinoma, the indication of " great majority " can be considered to detected result.For example, when using 5 miRNA, wherein 3 hints have the esophageal carcinoma, and result can think that hint this person is diagnosed as the esophageal carcinoma.Yet in some cases, the diagnosis of the esophageal carcinoma needs at least one or the how special distinctive variation of miRNA.

Have multiple technologies can be used for determining miRNA gene level, the allele-specific being for example included as on array extends, PCR/LDR general array, the single base chain extension based on droplet, the sequencing by hybridization of sequence label molecular inversion probes and combination.

The sorting technique of Patients With Carcinoma of Esophagus

On the other hand, this provides a sorting technique for oesophagus patient, for example, and the classification of level of differentiation, tumour stage and pathology.Just being to provide specifically an oesophagus patient (comprises such as the level of determining differentiation, determine the tumour stage, pathological classification with oesophagus patient) sorting technique, comprise and detect the level of at least one miRNA (for example miRNA in table 2 or their homologue) or the miRNA gene level in Patients With Carcinoma of Esophagus tissue, in the level (or corresponding miRNA gene level) of this miRNA, be used as oesophagus patient classification's basis.

This provides a kind of method for determining the level of differentiation in patient with esophageal carcinoma, comprise the level of at least one miRNA in Fig. 2 a (or corresponding gene) in patient's human esophageal carcinoma, in this miRNA (or corresponding gene) level, be used as the basis of determining esophageal carcinoma level of differentiation.For example, by the miRNA level of measuring, can determine patient's high, medium and low level of differentiation.Relation between miRNA (or corresponding gene) level and level of differentiation also can be determined, for example, the level of miRNA (or corresponding gene) that can use known method to be divided into the esophageal carcinoma colony sample of different level of differentiation by analysis realizes.

MiRNA can be hsa-miR-25, any one of hsa-130b and hsa-miR-130a or their homologue, miRNA level in esophageal carcinoma sample is contrary with level of differentiation, that is to say low-level miRNA and differentiated Horizontal correlation connection, and high-caliber miRNA is associated with low level of differentiation.Sometimes at least one miRNA is hsa-miR-335.Sometimes at least one miRNA is hsa-miR-25.Sometimes at least one miRNA is hsa-miR-130b.Sometimes at least one miRNA is hsa-miR-130a.Sometimes at least one miRNA is hsa-miR-181d.

This provides a kind of method for esophageal epithelial cell cancer patient pathological classification, comprise the level of at least one miRNA in Fig. 2 b (or corresponding gene) in patient's human esophageal carcinoma, in this miRNA (or corresponding gene) level, be used as the basis of classification of patient's pathology.For example, certain patient is likely confirmed as fungate or medullary substance shape esophageal epithelial cell cancer, and this depends on the miRNA level detecting.Relation between the level of miRNA (or corresponding gene) pathological state different from cancer can be set up, for example, the level that can use known method to be divided into the miRNA (or corresponding gene) of the sample of different pathological classification by analysis realizes.

This provides a kind of method for determining the tumour stage in patient with esophageal carcinoma, comprise the level of at least one miRNA in Fig. 2 c (or corresponding gene) in patient's human esophageal carcinoma, in this miRNA (or corresponding gene) level, be used as the basis of determining the tumour stage.For example, certain patient has likely been confirmed as I, II, or the tumour in III stage, and this depends on the miRNA level detecting.Sometimes certain patient is defined T1, T2, or the tumour in T3 stage, and this also depends on the miRNA level detecting.Sometimes certain patient is defined N0 or the tumour in N1 stage, and this also depends on the miRNA level detecting.The level of miRNA (or corresponding gene) and the relation between tumour different steps can be set up, and for example, the level that can use known method to be divided into the miRNA (or corresponding gene) of the sample in different tumour stage by analysis realizes.

Some systems (for example microarray) are also provided here, these systems have comprised and can (comprise Fig. 2 a by detection table 2,2b, any miRNA in 2c or its homologue) in the probe of miRNA and decision table 2 in the system of the gene of miRNA or the level of its homologue.These systems miRNA (or its corresponding gene) level and patient with esophageal carcinoma is classified of great use in decision table 2.Therefore, the system (for example microarray) that this provides at least one miRNA in a definite table 2 or its homologue (or corresponding gene) level has comprised most probes in this system, each probe can detect a kind of miRNA (or its gene), at least 15% (comprises 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect miRNA or its homologue (or corresponding gene) in table 2.This classifies a system (as microarray) is provided for Patients With Carcinoma of Esophagus, in this system, comprised most probes, each probe can detect a kind of miRNA (or its gene), and at least 15% (comprises 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect miRNA or its homologue (or corresponding gene) in table 2.This provides a system (as microarray) for suffering from patient's classification of the esophageal carcinoma, in this system, has comprised at least 2,5,10,20,30, or 40 probes, each probe can detect a kind of miRNA or its homologue (or its corresponding gene) in table 2.

Here the system providing in addition can also be used to Patients With Carcinoma of Esophagus to classify.For example, provide a useful system to classify to suffering from the patient of the esophageal carcinoma here, comprised one or more probes in this system, each probe can detect miRNA or its homologue (or its corresponding gene) in a kind of table 2.Here provide a useful system can be used for determining the level that the esophageal carcinoma is broken up, this system has comprised one or more probes, and each probe can detect miRNA or its homologue (or its corresponding gene) in a kind of table 2a.Here provide a useful system can be used for esophageal epithelial cell cancer patient to carry out pathological classification, this system has comprised one or more probes, and each probe can detect miRNA or its homologue (or its corresponding gene) in a kind of table 2b.Here provide a useful system can be used for determining the tumour stage of patient with esophageal carcinoma, this system has comprised one or more probes, and each probe can detect miRNA or its homologue (or its corresponding gene) in a kind of table 2c.

Also for manufacturing, provide the described probe that is used for detecting the system of miRNA (or its corresponding gene).Here for manufacturing one or more probes that patient with esophageal carcinoma categorizing system is provided, each probe can be determined a miRNA or its homologue (or its corresponding gene) level in table 2.Here for production provides a probe that is used for patient with esophageal carcinoma to carry out categorizing system (as microarray), each probe can detect the level of different miRNA (or its corresponding gene), at least 15% (comprises 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect a kind of miRNA or its homologue (or its corresponding gene) in table 2.

This provides one or more probes for determining the system production of esophageal carcinoma level of differentiation, and every kind of probe can be determined a miRNA or its homologue (or its corresponding gene) level in Fig. 2 a.This provides one or more probes for determining the system production of esophageal epithelial cell cancer patient pathological classification, and every kind of probe can be determined a miRNA or its homologue (or its corresponding gene) level in Fig. 2 b.This provides one or more probes for determining the system production in Patients With Carcinoma of Esophagus tumour stage, and every kind of probe can be determined a miRNA or its homologue (or its corresponding gene) level in Fig. 2 c.

The existence of the method for prognosis and composition and promotion patient with esophageal carcinoma

This invention for Patients With Carcinoma of Esophagus prediction provides method, for example, comprises the method for determining Patients With Carcinoma of Esophagus survival rate on the other hand.The Forecasting Methodology of this invention is being determined aspect the therapeutic process of Patients With Carcinoma of Esophagus of great use.For example, determine that the possibility of existence can help to determine to use conservative treatment or radical therapy, or whether various modality can be combined with.In addition, this prognosis can help to determine to improve whether the medicament (medicament as mentioned here) of surviving is necessary or no effective.

Here for patient with esophageal carcinoma prognosis survival probability provides method, comprise: (a) determine the level of at least one miRNA in patient's human esophageal carcinoma sample and (b) miRNA level and the threshold value of above-mentioned sample compared, being wherein associated with survival of patients with the miRNA level of threshold value comparison or anti-phase associated." being associated " herein refers to be compared low-level miRNA and implies low survival rate with threshold value, vice versa." anti-phase association " herein refers to be compared high-caliber miRNA and implies high survival rate with threshold value, vice versa.

Sometimes, at least one miRNA is the miRNA that regulates goal gene, and goal gene is elected from one group of gene, comprising: PPP6C, SATB2, CHST11, CRELD1, ESRRA, MTMR4, RNF125, SYNJ1, TAF5, YWHAH, ZYX, CHST11, KIAA1033, TGFBR3, SNRK, RNF125, AXIN2, CAPZA2, SYNJ1, DLL1, YWHAH, MTMR4, PPP6C, CAMKV, and TAF5, PPP1CB, POU4F2, MYH1, MYH2, TOP2B, STX17, GBAS, MYH4, CPSF4, EIF4EBP3, LHX4, CLK3, CAPN6, KIAA1622, AUH, PPIF, KCNK3, IL6R, CSNK2A2, ZNF579, NRGN, CUL3, CIB2, ZBTB26, GPBP1, TMEM16D, HOXA1, CAMTA1, MCM3AP, MPPED2, HOOK2, PLAU, MCFD2, BLCAP, DHX15, FBN1, NCOA6, SNRPC, CCK, SFRS15, TMOD1, GPRC5B, ZNF403, DCUN1D5, ZNF423, and GPR64.Sometimes, at least one miRNA can regulate the goal gene being selected from next group gene: PPP6C, SATB2, CHST11, CRELD1, ESRRA, MTMR4, RNF125; SYNJ1, TAF5, YWHAH, and ZYX..Sometimes, at least one miRNA can regulate the goal gene being selected from next group gene: CHST11, KIAA1033, TGFBR3, SNRK, RNF125, AXIN2, CAPZA2, SYNJ1, DLL1, YWHAH, MTMR4, PPP6C, CAMKV, and TAF5.Sometimes, at least one miRNA can regulate the goal gene being selected from next group gene: PPP1CB, POU4F2, MYH1, MYH2, TOP2B, STX17, GBAS, MYH4, CPSF4, EIF4EBP3, LHX4, CLK3, CAPN6, KIAA1622, AUH, PPIF, KCNK3, IL6R, CSNK2A2, ZNF579, NRGN, CUL3, CIB2, ZBTB26, GPBP1, TMEM16D, HOXA1, CAMTA1, MCM3AP, MPPED2, HOOK2, PLAU, MCFD2, BLCAP, DHX15, FBN1, NCOA6, SNRPC, CCK, SFRS15, TMOD1, GPRC5B, ZNF403, DCUN1D5, ZNF423, with GPR64. sometimes, the corresponding gene of miRNA is positioned at 5, 10, on any one in No. 9 karyomit(e)s.Sometimes, miRNA is any one or their homologue in Fig. 3.Sometimes, at least one miRNA is hsa-miR-103.Sometimes, at least one miRNA be has-miR-107. sometimes, at least one miRNA is has-miR-23b.

Here for patient with esophageal carcinoma prognosis survival probability provides method, comprise: (a) determine the level of at least one miRNA in patient's human esophageal carcinoma sample and (b) miRNA level and the threshold value of above-mentioned sample compared, wherein anti-phase associated with miRNA level and the above-mentioned survival of patients of threshold value comparison, this wherein at least one miRNA be hsa-miR-103, hsa-miR-107, or hsa-miR-23b or their corresponding homologue.Sometimes, at least one miRNA is hsa-miR-103.Sometimes, at least one miRNA is has-miR-107.Sometimes, at least one miRNA is has-miR-23b.

Here the miRNA level of narration has also likely reflected the variation (miRNA as described herein) of miRNA gene level.Sometimes, this provides the method for a prognosis for suffering from the patient of the esophageal carcinoma, comprise analyze at least one miRNA gene level (as with hsa-miR-103, hsa-miR-107, the miRNA gene of or its homologue corresponding with hsa-miR-23b), wherein implying high or low survival rate with the change of control sample icp gene level.For example, sometimes, this provides the method for a prognosis for suffering from the patient of the esophageal carcinoma, comprise and analyze at least one and hsa-miR-103, hsa-miR-107, with the miRNA gene of the corresponding amplification of hsa-miR-23b, relative comparison miRNA gene wherein, the miRNA gene of amplification is associated with low survival rate.Sometimes, this provides the method for a prognosis for suffering from the patient of the esophageal carcinoma, and comprise and determine at least one and hsa-miR-103, hsa-miR-107, and the copy number of the corresponding miRNA gene of hsa-miR-23b, wherein copy number is more than 2 the low survival rate of hint.

A kind of method is also provided in addition, i.e. utilization can detect miRNA (or its corresponding gene) probe of level or the system that contains one or more probes is carried out prognosis.For example, sometimes, utilize one or more probes (or the system that contains one or more probes) to determine the chances of survival of patient with esophageal carcinoma, probe wherein can detect the miRNA in sample, compares that its miRNA level is associated with above-mentioned patient's chances of survival or anti-phase associated with threshold value.Sometimes, this provides one or more probes being used for as patient with esophageal carcinoma prognosis, and the chances of survival of comparing miRNA level and above-mentioned patient with threshold value is anti-phase associated, and wherein at least one miRNA is hsa-miR-103, hsa-miR-107, or hsa-miR-23b or their corresponding homologue.

Here one or more probes are provided for the manufacture of reagent (or system), this reagent (or system) can be used for as suffering from patient's prognosis of the esophageal carcinoma, these probes can detect the miRNA level in sample, compare that its miRNA level is associated with above-mentioned patient's chances of survival or anti-phase associated with threshold value.Sometimes, one or more probes are provided here, can be used for as suffering from patient's prognosis of the esophageal carcinoma, the chances of survival of comparing its miRNA level and above-mentioned patient with threshold value is anti-phase associated, wherein at least one miRNA is hsa-miR-103, hsa-miR-107, or hsa-miR-23b or their corresponding homologue.

This invention also improves survival condition method is provided for suffering from the people of the esophageal carcinoma.Specifically, comprise that to patient, taking effective dose of medicine thing lowers miRNA level, compare with threshold value, the level of this miRNA and above-mentioned patient's chances of survival are inverse correlation.Here for medicament manufacturers provides a kind of medicament, thereby use this medicament can reduce the survival state that miRNA level is improved the patient who suffers from the esophageal carcinoma, compare with threshold value, this miRNA level is anti-phase associated with above-mentioned patient's chances of survival.

This provides a method for suffering from patient's situation of making the life better of the esophageal carcinoma, comprise that to patient, taking effective dose of medicine thing lowers miRNA level, this miRNA is selected from and comprises hsa-miR-103, hsa-miR-107, or one group of miRNA of hsa-miR-23b or their corresponding homologue.The medicament of the patient's that a kind of improvement suffers from the esophageal carcinoma survival state is provided for medicament manufacturers here, and this medicament can reduce the level of above-mentioned miRNA.

First method in this narration may be thought of as patient's prognosis (for example, by the method for mentioning) herein, then considers giving of medicament.

Sometimes, the level of more than one miRNA has decline.This medicament that can for example lower by utilizing two or more miRNA levels is realized.Also can lower with two or more medicaments the level of two or more miRNA.For example, sometimes, this provides a method for suffering from patient's situation of making the life better of the esophageal carcinoma, comprise that one or more medicines of taking effective dose to patient lower at least two kinds of miRNA levels, these miRNA are selected from and comprise hsa-miR-103, hsa-miR-107, or one group of miRNA of hsa-miR-23b or their corresponding homologue.Sometimes, the medicament of the patient's that one or more improvement suffer from the esophageal carcinoma survival state is provided for medicament manufacturers here, this medicament can reduce the level of at least two kinds of miRNA, these miRNA are selected from and comprise hsa-miR-103, hsa-miR-107, or one group of miRNA of hsa-miR-23b or their corresponding homologue.Sometimes, this provides a method for suffering from patient's situation of making the life better of the esophageal carcinoma, comprises that one or more medicines of taking effective dose to patient lower hsa-miR-103, hsa-miR-107, or the level of hsa-miR-23b.Sometimes, provide the medicament of the patient's that one or more improvement suffer from the esophageal carcinoma survival state here for medicament manufacturers, this medicament can reduce hsa-miR-103, hsa-miR-107, or the level of hsa-miR-23b.

Acceptable carrier in a kind of drug component of the miRNA of reduction level and a kind of pharmaceutics is provided here, and wherein at least one miRNA is hsa-miR-103, hsa-miR-107, or hsa-miR-23b.Sometimes, at least one miRNA is hsa-miR-103.Sometimes, at least one miRNA is hsa-miR-107.Sometimes, at least one miRNA is hsa-miR-23b.Sometimes, this medicament is double-stranded RNA (for example short or siRNA or " siRNA "), antisense nucleic acid chain, or the RNA molecule with enzymic activity is as ribozyme.The method of the situation of making the life better will be explained below.

Here said survival state can be survival state or the comprehensive survival state without disease.At this, " disease free survival situation " refers to and do not occur the rear individual destiny of tumor recurrence and/or diffusion and diagnosis, and for example, someone hereafter tumour is not recurred." total survival state " refers to the destiny after patient diagnosis, and no matter whether tumor recurrence.

Existence prognosis

Some are for survival on the method for person's prognosis and basis that method described here is the miRNA level based on relative threshold.

Threshold value can decide by several different methods, and given threshold can provide a boundary line, should exist one group of miRNA level different lower than patient's survival rate of threshold value from another group miRNA level higher than patient's survival rate of threshold value.

Threshold value can be determined by the miRNA level in the human esophageal carcinoma sample of non-cancer.Also the miRNA level that can suffer from the crowd of the esophageal carcinoma by analysis decides.This can come by histogram analysis perfect, and in figure, by the detected people's of a group data display out, wherein an axle represents miRNA level, and another represents individual survival rate.Two or more independently colonies can be divided into different subgroups by identical or different miRNA level and determine.For example, in some cases, on the basis of the mean level (ML) of the people that threshold value can be based on a group high viability and the people's of the low survival rate of a group miRNA.Threshold value also can represent two or more miRNA.This can embody by the ratio of every kind of miRNA level.

Threshold value can be an individual digit, can apply to each patient with esophageal carcinoma, or different and different according to concrete subgroup.For example, aging man may be different from the threshold value of young man, and woman may be different from man's threshold value.Further, a threshold value can be determined for a people.For example, threshold value may be a definite ratio, i.e. the ratio of the miRNA level of the relative non-cancer tissue of human esophageal carcinoma in same person.

Threshold value can will distinguish lower than threshold value with higher than the Patients With Carcinoma of Esophagus survival probability of threshold value, and this can realize by single argument or multivariate analysis.These methods are determined may be related between one or more variablees and given result.Under special circumstances, these methods can determine that a miRNA level and cancer patients are without may contact between disease or comprehensive survival state.Any method that this alanysis is carried out in well known can being used in this field can be utilized.The example of univariate analysis is as Kaplan-Meir method or the Cox proportional-hazards regression model.

For example by histogram, determine the threshold value based on crowd, can determine that with the patient of a group sufficient amount two or more sets independently have the patient of different levels miRNA.Typically, group comprises at least 25 patients like this, comprises at least 50,75,100,125,150, or 200.Similarly, confirm that threshold value can comprise at least 25 patients, comprise at least 50,75,100,125,150, or 200.

Further, threshold value can separated two groups of patients, may exist a plurality of threshold values can separated a large amount of patients.For example, the patient that two threshold values can first separated one group of high level miRNA, the patient of separated one group of medium level then, remaining one group of low-level patient.The different threshold values of some amount can be described a curve, and for example a continuous line, can describe patient without the possibility of survival state disease or comprehensive.This curve forms the miRNA level of " continuously ", and patient is proportional without miRNA level in the possibility of disease existence or comprehensive survival state and its body.Two or more miRNA levels thus curve represent.

In some cases, in the invention that is cancer patient prognosis at this, between miRNA, may mutually combine.The prognosis that is combined as of two or more miRNA determines to have play prior effect.

MiRNA level also can be used for combining with its dependent variable, this variable may be significant statistically, the possibility without disease or comprehensive survival state of hint Patients With Carcinoma of Esophagus, pathology hint (age for example for example, tumor size, tumor histology, clinical stage, family history etc.).For example, the clinical stage of cancer has hint statistically without disease or the comprehensive significance of existence, may be according at different clinical stages and difference in this threshold value.Therefore, the threshold value of miRNA may be according to the difference of another indication parameter and difference.

In a model method, Kaplan-Meier analyzes and is used for determining the relation between survival rate and miRNA level.

In some cases, this method comprises: (a) detect in individuality the level of at least one miRNA in human esophageal carcinoma, (b) individuality is divided into first group and second group, wherein first group has low-level miRNA and larger existence possibility, second group has high-caliber miRNA and less existence possibility, at this at least one miRNA, be hsa-miR-103, hsa-miR-107, or hsa-miR-23b.

After determining the level of one or more miRNA and comparing with threshold value, just patient can be assigned to corresponding without disease or the group of possibility of existence comprehensively.Then which lineup this patient just has determine without the possibility of disease or existence comprehensively without the possibility of disease or existence comprehensively.

For example, a sample can be considered to have low-level miRNA.This patient is assigned to patient's group of low-level miRNA.Because determine that the patient of high-level miRNA has the higher possibility without disease or comprehensive survival state, so specific patient may be considered to have the higher possibility without disease or comprehensive survival state.

Method described here can be further that individual determines suitable therapeutic process.In this field, one of them conventional method is exactly to be cancer patient prognosis, and cancer is early stage and Advanced Carcinoma Patient is different.For example, for cancer patients's prognosis in I stage, cancer continued growth or transfer may be tended to, to the cancer patients in IV stage, effective cancer treatment method may be tended to.These parameters are considered in definite nationwide examination for graduation qualification of suitable therapeutic modality.

Improve method and the measure of survival condition

The method of improving cancer patients's survival state is also provided here, and this medicament that reduces specific miRNA level by use is realized, example miRNA as shown in Figure 3.

Any medicament that can reduce miRNA level may be used to the method for this invention.The medicament of suitable inhibition miRNA genetic expression comprises double-stranded RNA (for example short or siRNA or title " siRNA "), and antisense nucleic acid, has the RNA molecule of enzymic activity as ribozyme, small molecules mixture and protein.These medicines can be used separately also can be combined with (example is other drug as mentioned here).These medicines are (as suppressed expression or the function of miRNA) or the indirect level of miRNA that reduces directly (as by affecting the level of miRNA gene).

For example, the RNA that the expression of a given miRNA can be passed through double-stranded RNA (dsRNA) induction disturbs inhibition, and this double stranded rna molecule and miRNA gene product have at least 70%, comprise at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence homology.In some cases, double-stranded RNA is exactly " short or siRNA " or claim " siRNA ".

The siRNA using in current method is comprised of the double-stranded RNA of 10-30bp, comprises for example 12-28,14-26,16-24, or 18-22 any one.SiRNA comprises a RNA chain that has adopted RNA chain and a reverse complemental, and the two combines by Watson-Crick basepairing rule.Sense strand comprise one section with target miRNA in the sequence of nucleic acid array complementation.The sense and antisense chain of siRNA can comprise two complementary, single stranded RNA molecules, or only comprises a single molecule, and its complementary portion has a chain to amount to valency by base pairing to be connected to form " hair fastener " structure and to form.

Insertion by single or multiple bases, disappearance, replacement, variation etc., siRNA is different from natural RNA.This variation comprises the insertion of non-nucleosides material, for example, in the end or one, two nucleosides of siRNA, or siRNA resist the modification of ribozyme digestion.In some cases, one of siRNA or two chains also comprise 3 ' protruding terminuses.SiRNA can obtain by chemosynthesis or biosynthesizing, or is expressed and obtained by recombinant plasmid or virus vector, and this will be explained below.

The expression of given miRNA can be suppressed by antisense nucleic acid." antisense nucleic acid " herein refers to by RNA-RNA or RNA-DNA and interacts, and the nucleic acid molecule of being combined with target RNA has so just changed the activity of target RNA.The antisense nucleic acid that is applicable to current method is the single-chain nucleic acid (for example, RNA, DNA, RNA-DNA mosaic, PNA, and LNA) of the sequence complementation of adjoining with miRNA.In some cases, antisense nucleic acid is to have 70%, 75%, 80%, 85%, 90%, 95% at least, or 100% and the nucleotide sequence that adjoins sequence complementation of miRNA.In some cases, antisense nucleic acid has 10-30 nucleosides, comprises for example 12-28,14-26,16-24, or 18-22 nucleosides.

Antisense nucleic acid also can have specific modification to strengthen target specificity, ribozyme resistibility, transportation or other features relevant to efficiency in nucleic acid backbone or sugar or base.These modifications comprise cholesterol, interact as acridine or comprise one or more ribozyme resistance groups.

Antisense nucleic acid can produce by chemical process or biological method, or also can obtain from recombinant plasmid or expressing viral.This will be explained below.

The nucleic acid that the genetic expression of given miRNA also can be had enzymic activity suppresses.Here " nucleic acid with enzymic activity " refers to the nucleic acid that comprises Binding Capacity region, the nucleic acid array complementation that this region and miRNA adjoin, specifically cracking miRNA.In some cases, the calmodulin binding domain CaM of the nucleic acid of enzymic activity and miRNA contiguous zone 50-100% are complementary, comprise as 75-100% or 95-100% complementation.The nucleic acid of enzymic activity also can include modification at base, glycosyl or phosphate.A typical nucleic acid with enzymic activity for current method is exactly ribozyme.

The nucleic acid with enzymic activity can produce by chemical process or biological method, or also can obtain from recombinant plasmid or expressing viral.This will be explained below.

By nucleic acid molecule transfered cell, comprise cancer cells, method in this field, have a lot.These methods comprise microinjection, and electroporation is liposome-mediated; the conversion of calcium phosphate mediation, the conversion of DEAE-dextran mediation, microparticle bombardment; colloid scattering system transmits (macromolecular complex for example; pearl, the fat liquor in water, micella; mixed micelle and liposome); and and antibodies, gramacidinS, artificial virion or other carriers are as TAT.

Utilize suitable carrier also can nucleic acid drug be imported in mammalian cell in vivo or in vitro.Suitable carrier comprises that virus vector and non-virus carrier are as plasmid vector.This carrier is very useful as sense-rna or siRNA to the medicament that therapeutic dose is provided.

System based on viral has an advantage: relatively high-caliber heterogeneous nucleic acid can be imported in different cells.The suitable virus vector of mediation nucleic acid comprises, herpes simplex virus carrier for example, vaccinia virus vector, cytomegalovirus carrier, murine leukemia virus carrier, adenovirus carrier, gland relevant viral vector, retroviral vector and lentiviral vectors.The orientation movement of virus vector also can be by modifying with other viral envelope proteins or surface antigen carrier.For example, AAV carrier can be modified by the surface protein of rabies blister virus (VSV), Ebola virus, Mokola etc.

Nucleic acid or carrier in this invention can contain inducible promoter or enhanser arbitrarily, thereby can stimulate or the expression of molecular Control sense-rna or siRNA by interpolation.Thisly can inducible system comprise for example tetracycline-inducible, the metallothionein(MT) of heavy metal induction, the insect steroid hormone of moulting hormone induction or related steroid are as curtain multitude sterone, and steroid is as the heat-inducible promoter of the mouse mammary tumour virus (MMTV) of glucocorticosteroid and estrogen-induced and temperature change induction.

The dosage that a kind of medicament can reduce miRNA level is effective dose.In some cases, medicament can reduce 10%, 20%, 30%, 40% of difference between miRNA level and threshold value, or 50%.The typical dosage of medicine (as nucleic acid drug) comprises 0.1-3000mg/kg body weight, 10-2000mg/kg body weight, and 50-1000mg/kg body weight, 100-500mg/kg body weight, but be not limited to this scope.In some cases, the dosage of medicine (as nucleic acid drug arbitrarily) is approximately 10-500mg/g tumour, 20-300mg/g tumour for example, 50-200mg/g tumour, and 100-150mg/g tumour.

In this field, there is a kind of conventional technology can determine at an easy rate the appropriate dose that a human therapy is used.The classical frequency of medicament comprises at least every three weeks once, once every two weeks, weekly, weekly twice, on every Wendesdays time, on every Thursdays time, on every Fridays time, on every Saturdays time or once a day, but be not limited to these.In some cases, the timed interval of each medication is less than a week, comprises 6,5,4,3,2,1 days.In some cases, each administration time interval is constant.For example, can be every day, every two days, every three days, every four days, every five days, or weekly.In some cases, can be every day twice, every day three times or more.

Administration time can be very long, as from one month to 3 years.For example, dosed administration can extend to 2,3,4,5,6,7,8,9,10,11,12,18,24,30, and 36 months.In some cases, administration arrangement can not stop.In some cases, a week can not be longer than in the interval of medication.

The synthetics of again describing can pass through conventional route administration, including, but not limited to intravenously, and intraperitoneal, intraocular, intra-arterial, in lung, oral, in vesicle, intramuscular, in tracheae, subcutaneous, by skin, by pleura, local, suck, by mucous membrane, skin, stomach, intraarticular, in ventricle, rectum, vagina, in skull, in urethra, in liver, in knurl.In some cases, systematically administration.Administration partly in some cases.

Here also provide medicinal composition, acceptable carrier in the composition that comprises a kind of miRNA of attenuating level and pharmacopedics.In some cases, above miRNA is selected from hsa-miR-103, hsa-miR-107, hsa-miR-23b or their homologue.In some cases, at least one is hsa-miR-103.In some cases, at least one is hsa-miR-107.In some cases, at least one is hsa-miR-23b.In some cases, this composition is siRNA.In some cases, this composition is sense-rna.In some cases, this composition is ribozyme.

In some cases, pharmaceutical cpd is aseptic.In some cases, pharmaceutical cpd is apyrogenic.

In suitable pharmacopedics, acceptable carrier has water, water damping fluid, conventional salt, 0.4% salt, 0.3% salt and hyaluronic acid.Pharmaceutical cpd also may comprise traditional pharmacology vehicle, and/or additive.Suitable pharmacology vehicle comprises stablizer, antioxidant, penetration degree conditioning agent, damping fluid, pH adjusting agent.Suitable additive comprises the biological suitable damping fluid of physiology, additional chelant (as DTPA or DTPA bisamide) or calcium chelated complexes are (as DTPA, CaNaDTPA bisamide) or calcium or sodium salt (calcium chloride, calcium ascorbate, calglucon or calcium lactate).The pharmaceutical cpd of this invention can be packed or freeze-drying with liquid form.

The solid pharmaceutical composition of this invention, can be with acceptable non-toxic carrier in traditional pharmacopedics, for example, and the N.F,USP MANNITOL of pharmacy grade, lactose, starch, Magnesium Stearate, soluble saccharin, talcum, Mierocrystalline cellulose, glucose, sucrose, magnesiumcarbonate etc.

MiRNA level detection system and/or miRNA gene level detection system

This invention provides multiple systems for detecting the miRNA level that has characteristic to change in Patients With Carcinoma of Esophagus, and the system of definite miRNA gene status is also provided.As mentioned above, these systems can comprise esophagus cancer diagnosis for multiple object, Patients With Carcinoma of Esophagus classification, and be Patients With Carcinoma of Esophagus prognosis.

System described herein comprises the probe that detects miRNA and/or miRNA gene appearance.Following discussion concentrates on the system that can detect miRNA, and the people with the routine techniques in this field is readily appreciated that particular aspects described herein is also applicable to comprise and can detects genetically deficient, the system of the probe that amplification or miRNA gene copy number change.

For example, in some cases, provide a system that comprises most probes here, each probe can detect different miRNA in sample, and wherein at least 15% (comprises 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect Fig. 1, the miRNA in table 2 or Fig. 3 or its homologue.In some cases, this system comprises at least 2,5, and 10,20,30,40, or 50 kinds of probes, wherein every kind of probe can detect Fig. 1, a kind of miRNA in table 2 or Fig. 3 or its corresponding homologue.

In some cases, a system that comprises most probes is provided here, and wherein each probe can detect a miRNA in sample, and wherein at least 15% (comprises 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect miRNA or its homologue in Fig. 1.In some cases, this system comprises at least 2,5, and 10,20,30,40, or 50 kinds of probes, wherein every kind of probe can detect a kind of miRNA or its corresponding homologue in Fig. 1.

In application, provide the system that multiple probe forms, wherein each probe can detect a different miRNA in sample, at least 15% (comprises at least 0%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect a miRNA in table 2 (comprising Fig. 2 a, 2b, and any miRNA in 2c).In application, this system has 2,5,10,20,30 at least, or 40 probes compositions, and wherein each probe can detect miRNA or their homologue (comprising Fig. 2 a, 2b, and any miRNA in 2c) in table 2.

In practical application, provide the system that multiple probe forms, wherein each probe can detect a different miRNA in sample, and at least 15% (comprises at least 0%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect a miRNA or their homologue in Fig. 3.In practical application, this system has at least 21 probes of 1,2,3,6,9,12,15,18, or to form, and wherein each probe can detect the miRNA in Fig. 3.

In system described herein with the identical miRNA of plural probe in detecting.For example, in actual applications, when system is chip, probe exists with multiple copy (as 2,3,4,5,6,7 or more).In application, in system, different probe detects identical siRNA.For example, these probes are attached to the different zones (overlapping or non-overlapped) of miRNA.

In some instances, probe is oligonucleotide.In order to detect miRNA, certain sequence variations is acceptable.Like this, the sequence of oligonucleotide (or his complementary sequence) and miRNA can deposit a little different.Professional and technical personnel knows, this sequence variations can not remarkably influenced oligonucleotide be determined the ability of miRNA level.For example, homologue and the varient of oligonucleotide are compared with standard method, determine relatively high sequence similarity.Oligonucleotide in invention and miRNA sequence have the similarity of 40% (comprising 50%, 60%, 70%, 80%, 90%, 95% or more) at least.In application, part oligonucleotide is for detection of miRNA and other albumen, and other parts are combined with matrix for oligonucleotide.In application, other parts are comprised of non-specific sequence (as polyT), increase the distance of complementary sequence part and stromal surface.

Oligonucleotide in system comprises DNA, RNA, PNA, LNA, above combination or modified forms.They also comprise that the oligonucleotide of employing modification is as main body.In some instances, oligonucleotide is at least by 9,10, and 12,13,14,15,16,17,18,19,20 or the more oligonucleotide composition complementary or identical with miRNA.Single oligonucleotide is comprised of plural complementary sequence.In some instances, active ingredient (as amino) is held combination with 5 ' or 3 ' of oligonucleotide, makes it to be combined with matrix.

In some instances, system is the micro-array chip that is furnished with probe.Micro-array chip and chip, can exchange use, and its surface is an array, a regular array, and the supposition of the uncertain biological sample of the character that distributing is in conjunction with (hybridization) site.In some practical applications, chip is the set that is fixed on the different oligonucleotides on matrix specific position.

For example, in application, provide the chip being formed by multiple probe, wherein each probe can detect a different miRNA in sample, and at least 15% (comprises at least 0%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect Fig. 1, table 2, or a miRNA and their homologue in Fig. 3.In application, the chip being comprised of multiple probe is provided, and wherein each probe can detect a different miRNA in sample, and at least 15% (comprises at least 0%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect a miRNA and their homologue in Fig. 1.In application, provide the chip being comprised of multiple probe, wherein each probe can detect a different miRNA in sample, at least 15% (comprises at least 0%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect Fig. 1, a miRNA and their homologue in table 2.In application, the chip being comprised of multiple probe is provided, and wherein each probe can detect a different miRNA in sample, and at least 15% (comprises at least 0%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) probe can detect a miRNA and their homologue in Fig. 3.

The micro-array chip of definite miRNAs gene appearance is provided.Micro-array chip is the classical way of determining gene appearance.For example, the molecular system of sequence label is for determining gene appearance.

Chip can be processed in the matrix of multiple material, as paper, and glass, plastics (polypropylene, nylon, polystyrene), polyacrylamide, nitrocotton, silicon, optical fiber or other solid-state or semi-solid state upholders being applicable to, form plane conformation (as sheet glass, silicon chip) or three-dimensional conformation (pin type, fiber, pearl, particle, microwell plate, kapillary).

In actual applications, probe is oligonucleotide, and the oligonucleotide of compositing chip can be combined with matrix by several different methods, is not limited to, and (1) adopts the in situ hybridization (for example high-density oligonucleotide array) of optical lithography; (2) at glass, nylon or nitric acid Mo Shangdianhuo India and China low density chip; (3) adopt and cover; (4) on nylon or nitric acid element Hybond membrane, put the marking.Oligonucleotide utilization hybridization, magnetic bead, or the fluid-phase such as micropore dish or kapillary, by being fixed in matrix of non covalent bond.

By the classical technology of nucleic acid and solid substrate (as sheet glass) combination.Method is that their part can be incorporated into solid substrate in conjunction with base or the analogue modified, for example amino, aminoderivative or other positively charged groups.The product of amplification with by the coated solid substrate of aldehyde radical or other reactive groups, contacted, as sheet glass, the product of amplification and active group formation covalent linkage, and be combined with slide with the form of covalency.Use Biodot (BioDot, Inc.Irvine, CA) point sample instrument, amplified production point, on the coated glass plate of aldehyde radical, is made into chip.According to the step of delivering, by amplified production point at aldehyde slide (Schena et al., Proc.Natl.Acad.Sci.U.S.A. (1995) 93:10614-10619)..Chip also robotic arm is imprinted on glass, nylon (Ramsay, G., Nature Biotechnol. (1998), 16:40-44), polypropylene (Matson, et al., Ahal Biochem. (1995), 224 (1): 110-6), (Marshall on silicone resin sheet, A.and Hodgson, J., Nature Biotechnol. (1998), 16:27-31).The method of other chip equipment comprises meticulous micropuncture in electric field (Marshall and Hodgson, supra), and by the direct point sample of polynucleotide on the flat board of positive electricity pocket cup.Certain methods is also commonly used, as www.cmt.corning.com and http:// cmgm.stanford.edu/pbrown/disclosed, with aminopropane silicone oil, carry out the method for chemical surface treatment.

By preparation high-density nucleosides chip, prepare chip.As everyone knows, this technology adopts the fast deposition (Blanchard et al., Biosensors & Bioelectronics, 11:687-690) of polynucleotide.Other prepare the method for chip, as passed through, cover (Maskos and Southern, Nucleic.Acids.Res. (1992), 20:1679-1684).In principle, above any chip of mentioning, can on nylon Hybond membrane, use by dot blotting.But professional and technical personnel is the very little chip of first-selection often, because they have less hybridization volume.

Test kit

This patent provides test kit for several different methods described herein.

For example, in application, provide a test kit, comprised the individual system (as micro-array chip) for detection of miRNA level.In application, test kit comprises the extra reagent detecting, and also furnish an explanation book or user manual are introduced the best practice of using this invention in detail, and these explanations are instructed and also can be obtained from Internet.

In application, test kit provides a system for diagnosing esophageal cancer (chip).This test kit further comprises that control sample is for determining reference level, and/or obtains the information of reference level.In application, test kit comprises specification sheets, introduces and how to use its diagnosing esophageal cancer.

In application, test kit provides a system (chip) for the esophagus cancer patient that classifies.This test kit further comprises that control sample is for the individuality of classifying, and/or the information of control sample.In application, test kit comprises specification sheets, introduces and how to use its classification individual.

In application, provide test kit for determining the prognosis of an esophagus cancer patient existence.For example, this test kit is comprised of the probe that detects miRNA (as shown in Figure 3).In application, test kit further comprises that control sample is for determining the information of critical level or relevant critical level.In application, test kit also comprises specification sheets, instruct to use test kit to patient's prognosis of surviving.In use, test kit also comprise some reagent for reducing miRNA level or medicine synthetics for improving survival rate.

This test kit further comprises some reality, but is not limited to these, as substrate, label, primer, the reagent of mark miRNA, the reagent of extracting miRNA, for feminine gender or the positive control of hybridizing and detecting, test tube and/or other annexes, the reagent of collection organization's sample, damping fluid, hybridizing box, sealed membranes etc., also comprise software package, as the statistical method for miRNA horizontal analysis and/or the change of miRNA horizontal properties, select arbitrarily password and account, for assessment of editor's database.

In application, test kit comprises a pharmaceutical composition, and its composition can reduce the level of miRNA shown in Fig. 3, and how to use composition to improve the survival rate of esophageal cancer patients.In use, test kit comprises that carrier or other media are for transport compositions.In use, test kit also has the use of instructions direct pharmaceutical composition.

Example is below used for illustrating this invention, but is not limited in this.

Embodiment 1

The sample preparation of miRNA level is analyzed in this example explanation.

Patient and sample

Training set comprises 31 pairs former esophagus unicorn cancer cells and corresponding contiguous normal esophagus cancer tissue.These samples gather from Cancer Hospital of Chinese Academy of Medical Sciences patient, and obtain informed consent.All tissue samples, from the patient who never treated, obtain by operation, freezing rapidly in liquid nitrogen, and-80 ℃ of storages (being less than 6 years) are until miRNA extracting.Flesh tissue in second independent sets from 5 pairs of cases, as efficacy data collection independently, be from identical hospital, to collect for 2006, the storage time is less than 6 months.The peripheral portion of cut esophagus cancer is coated with paraffin, and section, with conventional H & E (phenodin & eosin) dyeing.Pathologist assesses tumour cell concentration and definite tumour] histology.Tracking data is from the trace data storehouse of Cancer Hospital of Chinese Academy of Medical Sciences.The clinical pathology information of all samples (age, sex, pathology, differentiation, by stages, in the tumour stage, operation is survival time afterwards for TNM) be all available.This research is ratified by the medical ethics council of Cancer Hospital of Chinese Academy of Medical Sciences.

The preparation of miRNA chip

Have the miRNA chip design that 509 ripe miRNA sequences were assembled and were integrated into us, 435 people sources (miRNA that comprises 122 predictions that obtain from deliver document) wherein, from 196 rats of miRNA database and the ripe miRNA of 261 mouse.In addition, 8 short oligonucleotides have been designed, they and known RNA sequence be homology not, adopt Ambion miRNA probe to build test kit (Cat.No.1550, Austin, TX), by in-vitro transcription, obtain these 8 short oligonucleotides and synthesized accordingly miRNA. before analyzing, these synthetic miRNA of different quantities are joined in people's miRNA sample, as interior mark.

The ripe miRNA complete complementary of the miRNA probe sequence of all designs and the total length of their homologies.For by probe-immobilized to aldehyde group modified surface of glass slide, these probe sequences couple together length 40nt (the miRNA probe of 3 ' end adds the polyT of 5 ' end 19mer), and has C6 5 '-amido modified.Oligonucleotide probe is synthetic at MWG Biotech, is dissolved in EasyArray ^tMin spotting solution, concentration is 40 μ M.Use SmartArray ^tMeach probe of microarrayer (CapitalBio Corp.) repeats point sample 3 times.

The mark of target RNA

By TRIZOL reagent extracted total RNA, low molecular weight RNA Ambion ' s miRNA Isolation Kit extracting.According to Thomson ' protocol (Thomson et al., 2004), use T4RNA ligase enzyme labeling technique.Briefly, 4 μ g low molecular weight RNAs by 5 ' of 500ng-phosphate-cytidyl-uridyl-cy3-3 ' (Dharmacon, Lafayette, CO) at T4RNA ligase enzyme (New England Biolabs, Beijing, China) the lower mark of effect.Labeled reactant carries out 2 hours at 4 ℃.0.3M sodium acetate and 2.5 times of volume ethanol precipitations for the RNA of mark, then use washing with alcohol, after being dried, be resuspended in 15 μ l hybridization buffers, contain 3 * SSC, 0.2% SDS and 15% methane amide.

Slide hybridization

At LifterSlipTM (Erie, Portsmouth, NH) in, hybridize, hybridizing box method is at BioMixerTM (CapitalBio), so that the continual bulk crossing damping fluid of energy, make the hybridization of whole slide more balanced, prevent fringing effect, the validity of the method is confirmed in our full genome mrna expression chip.Hybridization is spent the night in 42 ℃ of water-baths.Chip, at room temperature washs 5 minutes with 0.2%SSC by washing soln (0.2% SDS, 2 * SSC) continuous washing 5 minutes at 42 ℃.Copolymerization Jiao's LuxScanTM scanner scanning for chip, obtains image with LuxScanTM 3.0TM software analysis.

Computational analysis

The mean value repeating a little of every miRNA is removed background, after stdn, is further analyzed.Adopt each chip intermediate value to carry out stdn, value matrix in use.In all samples, from data, remove expression signal lower than 800 gene.By chip significance analysis (SAM) (www-stat.stanford.edu/～tibs/SAM/index.html)) definite different miRNAs that express.For each gene, SAM, according to the expression changing conditions of the standard deviation with respect to all measurements, provides a numerical value.According to average chain and Pearson's dependency, carry out hierarchical clustering.Support vector machine method is for cross validation and prediction test set.

With 4 kinds, the available Algorithm Analysis target of the most significant miRNA is disclosed, as MIRANDA (http://www.miRNA.org/), TARGETSCAN (http://www.targetscan.org/), PICTAR (http://pictar.bio.nyu.edu/) and miRBase ( http:// miRNA.sanger.ac.uk/sequences/).In order to reduce false positive, the supposition target gene of accepting at least will be predicted by 3 programs.Kaplan-Meier curve is for definite miRNA expression and from diagnosing to the dependency for the treatment of the end time.

Table 1.

PCR in real time is analyzed

In order to verify miRNA express spectra, extract full RNAs and carry out qRT-PCR with the specific primer of microRNA.ThermoScript II reaction conditions: the full RNA of 2.5ng/ μ l, 25nM root-ring RT primer, 1 * RT buffer, every kind of dNTPs 0.25mM, 200 U M-MLV ThermoScript II, 0.25U/ml RNase inhibitor (Invitrogen).7.5ml reaction system temperature in MJ Research PTC-225 Thermocycler is bathed, and at 16 ℃, keeps 30 minutes, at 42 ℃ of C30 minute, keeps 5 minutes, then 4 ℃ of preservations at 85 ℃.All reverse transcriptions, comprise the contrast of non-template, have a repetition.FastStart DNA Master SYBR green I test kit and LightCycler for PCR in real time, carry out according to operational manual.10 μ l PCR systems comprise 1 μ l RT product, 1 * PCR Master Mix, 15nM upstream primer and 15nM downstream primer.React 95 ℃ and keep 10 minutes, then carry out 40 circulations: 95 ℃ keep 15 seconds, 60 ℃ keep 35 seconds, and 72 ℃ keep 3 seconds.All qRT-PCR reactions, comprise the contrast of non-template, have a repetition.Relative expression's ratio of miRNAs is determined in the point of crossing (CP) of employing cycle number.The gene expression analysis of people U6 is used as interior mark.Result is analyzed with LightCycler software version 3.5 (Roche Diagnostics).With solubility curve, analyze PCR in real time amplified production, and confirm with gel electrophoresis.Table 1 has been listed primer sequence.

Table 1.

Embodiment 2

The miRNA that this example explanation changes in esophagus cancer tissue sample expresses

More several expression to miRNA in sample, comprise bacterium shape and marrow shape, the classification in different tumour stages and the whole paired samples of squamous cell carcinoma.We have compared the expression intensity of 191 miRNA in freezing sample at first.All cancers and other cancer sample compare by average chain and Pearson's dependency, per sample between the similarity expressed carry out cluster.Initial clustering is successfully divided into two groups by 62 cancerous tissues and other cancerous tissue, except 1 cancer sample and 5 other cancer samples.

By SAM method, compare each cancerous tissue and its corresponding non-cancerous tissue, have 40 miRNA to have statistical discrepancy in two groups of express spectras.As Figures 1 and 4.Cancer sample by more different phenotypes and tissue typing obtains express spectra, finally compares each cancer sample and its corresponding non-cancer sample.We have determined in different tissues classification and cancer different steps and have expressed different miRNAs.Adopt two kinds of analytical procedures, a kind of directly according to the strength of signal of cancerous tissue, the second is according to the signal ratio of cancer and other cancerous tissue.The method of direct signal strength ratio ratio is determined more miRNA genes, some genes are all significant in two kinds of methods, 5 gene (hsa-miR-335,-181d,-25 ,-7 ,-495) for pathological classification (bacterium shape vs marrow shape), two genes (hsa-miR-25 ,-130b) are for determining the position of cancer at esophagus (in upper vs under vs).

The comparative analysis of the clinical esophagus cancer classification of table 2.

By fresh esophagus cancer setup action independent sets, the miRNA express spectra that checking is used cold storage tissue to obtain.Between the miRNA expression chip of 5 pairs of flesh tissues (test set) and 31 pairs of cold storage tissues (training set), compare, as shown in Figure 5.10 test set SVM method validations, 8/10 test sample is correctly classified.Compare two miRNA that cancerous tissue detects, cold storage tissue detection to 191 miRNA, flesh tissue detects 164.155 miRNA occur in two set of organizations.In addition, 40 miRNA of the discovery of significance have different expression at the cancerous tissue of training set and test set from other cancerous tissue, illustrate that freezing esophageal tissue is keeping representing miRNA level and the ratio of flesh tissue.

Embodiment 3

The relation of this example explanation miRNA level and esophageal cancer patients existence.

Initial training set has 31 patient samples, according to surviving and be shorter than or be longer than 20 months after initial diagnosis, is divided into two groups.According to the average signal of each existence group, detect the intensity of each individual different miRNA that express.The minimum detectable signal intensity that the average of these two average intensity value is analyzed as Kaplan-Meier.The low expression of 3 miRNAs (hsa-miR-103 ,-107 ,-23b) and high survival time (being greater than latter 90 months of diagnosis) have the dependency of height.At Fig. 3 and Fig. 6.The common function of most of miRNAs is lowered exactly their target mRNA and is translated as corresponding protein, and the function of this dependency explanation mRNA is as tumor inhibitor.Ironically, the expression level of hsa-miR-23b is also determined in I-III in neoplasm staging, but is only adopted direct signal intensity (table 2).Kaplan-Meier has analyzed the patient of disease free survival, has also determined 2 miRNAs (hsa-miR-103 ,-107), and low expression is relevant with the high disease free survival phase.

With PCR in real time analysis verification chip data.PCR in real time and chip are all for hsa-miR-23b, and hsa-miR-103 and hsa-miR-107, determine ripe miRNA abundance, as the signal to esophageal cancer patients prognosis.

Although aforesaid invention is described in detail, by chart and example, clearly understand object, less change and the correction of carrying out that obviously can be skilled for technical professional.Therefore, description and example can not be interpreted as this and invent limited use range.

Claims

1. probe is determined in preparation that esophageal squamous cell carcinoma patient survives in the preparation of prognosis and is applied, described probe be respectively with the probe of following minRNA complete complementary:

hsa-miR-103：agcagcauuguacagggcuauga；

hsa-miR-107：agcagcauuguacagggcuauca。

2. reagent improves the application in the pharmaceutical preparation of patients with esophageal squamous cell carcinoma existence in preparation, it is characterized in that described reagent for respectively with the probe of following minRNA complete complementary:

hsa-miR-103：agcagcauuguacagggcuauga；

hsa-miR-107：agcagcauuguacagggcuauca。