NL2030433B1

NL2030433B1 - Shrna lentivirus for inhibiting the expression of long non-coding rna malat1 and use thereof

Info

Publication number: NL2030433B1
Application number: NL2030433A
Authority: NL
Inventors: Wang Ying; Qian Lingjia; Xie Fang; Wang Xue; Zhao Yun
Original assignee: Acad Of Military Medical Sciences Acad Of Military Science Of Chinese Pla
Priority date: 2021-09-06
Filing date: 2022-01-05
Publication date: 2023-03-21
Also published as: CN113584037A

Abstract

Disclosed is an shRNA for inhibiting the expression of long non-coding RNA MALAT1, which is designed to target the site 286, 743, 1048, or 4807 of an MALAT1 transcript sequence NR_002847.3 or a corresponding site in other transcript sequences in Genbank. The present application also provides a corresponding plasmid, lentivirus, and pharmaceutical composition and their use in the treatment of cognitive dysfunction. The MALAT1-shRNA interference plasmid of the present invention can significantly and specifically inhibit the expression of MALAT1 in hippocampal neurons, promote the progress of neuronal cell cycle and inhibit neuronal apoptosis and the expression of key apoptosis proteins, thereby resisting stress-induced neuron damage.

Description

SHRNA LENTIVIRUS FOR INHIBITING THE EXPRESSION OF LONG NON-CODING RNA

MALAT1 AND USE THEREOF

TECHNICAL FIELD

The present invention belongs to the field of biotechnology, and specifically relates to an shRNA lentivirus for inhibiting the expression of long non-coding RNA MALAT1 and use thereof.

BACKGROUND

With the acceleration of the pace of life in modern society and the intensification of social competition, most people are under varying degrees of stress load. Long-term excessive stress has been recognized as an important driving factor for many major human diseases that can cause death. The occurrence and development of about 70% of human diseases are closely related to stress damage in the body. The brain is the body's regulatory centre for sensing and responding to stress, and it is also a target organ that is vulnerable to stress. In particular, cognitive functions involving high-level brain activities are particularly vulnerable when faced with stress. Epidemiological surveys show that the prevalence of mild cognitive impairment and dementia in people who have been under stress for a long time is more than twice that of non- stressed people of the same age. Among patients diagnosed with cognitive dysfunction, more than 70% are accompanied by dysfunction of the hypothalamic-pituitary-adrenal (HPA) axis.

The hippocampus is an important brain area that regulates learning, memory and other cognitive functions. Chronic stress can cause changes in structure and function of the hippocampus, including shrinkage in size of the hippocampus, reduction in number of dendritic spines, reduction in density of synapses, abnormality in synaptic plasticity, and inhibition of dentate gyrus neurogenesis, etc. Stress has been proven to be an important risk factor for cognitive impairment and even dementia. Stress response is mainly characterized by hyperfunction of the HPA axis and massive secretion of glucocorticoids (GCs). The damage of high concentration of GCs on neurons is one of the important mechanisms of stress-induced cognitive dysfunction, but clinically, there is still a lack of effective drugs for prevention and treatment of stress-induced cognitive dysfunction.

Long non-coding RNAs (IncRNAs) refer to a class of epigenetic regulatory molecules that are greater than 200 nt in length and cannot code for protein production. LncRNAs account for more than 80% of non-coding RNAs, and are closely related to the regulation of almost all physiological and pathological processes such as development, cell proliferation and apoptosis, metabolism, immune regulation, and the occurrence of various diseases. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) was first identified and discovered in non-small cell lung cancer tissues in 2003, and is one of the IncRNAs that were discovered earlier and have been most in-depth studied so far. MALAT1 has a high level of expression in organisms and its expression is relatively common, and it is highly conserved in mammalian evolution. Early research on MALAT1 mainly focused on the field of tumours, and found that MALAT1 is involved in the regulation of cell proliferation, apoptosis, drug resistance, metastasis and other cell behaviours, and is closely related to the occurrence and development of various tumours. In recent years, more and more evidence has shown that MALAT1 plays an important biological role in the regulation of brain cognitive functions such as learning and memory and related diseases. Studies have found that the expression level of MALAT1 in the brain tissues of patients with Parkinson's disease (PD), PD animal models, and rats with Alzheimer's disease (AD) has changed to varying degrees, and MALAT1 can perform a variety of biological functions through various molecular mechanisms such as regulating chromatin epigenetic modification, controlling gene transcription, regulating protein function, and competitively binding to microRNAs. Studies have also suggested that interference with MALAT1 in nerve cells can affect the response of the cells to GC stimulation, suggesting that MALAT1 may be involved in the regulation of stress response. However, the role of MALAT1 in stress-induced cognitive dysfunction has not been reported so far, and there is no related technology that targets

MALAT1 to treat stress-induced cognitive dysfunction.

Gene therapy refers to a treatment method through which a specific genetic material is transferred into specific target cells of a patient to ultimately prevent or change a specific disease state. Lentivirus (LV) vector is the most commonly used viral vector in gene therapy. It can infect both dividing and non-dividing cells, and has the advantages of accommodating large exogenous target gene fragments, low immune response, and stable long-term expression of the product. These unique advantages make it have a wide range of application prospects in gene therapy. At present, studies have confirmed that gene therapies with lentivirus as a vector are safe and effective in the treatment of various diseases such as severe combined immunodeficiency, Fabry disease, and adrenal leukodystrophy.

SUMMARY OF THE INVENTION

In one aspect, the present application provides an shRNA for inhibiting the expression of long non-coding RNA MALAT1, which is designed to target the site 286, 743, 1048, or 4807 of an MALAT1 transcript sequence NR_002847.3 or a corresponding site in other transcript sequences in Genbank.

Further, the shRNA for inhibiting the expression of long non-coding RNA MALAT1 is designed to target the site 743 of the MALAT1 transcript sequence NR_002847.3 or a corresponding site in other transcript sequences in Genbank.

Further, the sequence of the shRNA for inhibiting the expression of long non-coding RNA

MALAT1 is shown as SEQ ID NOs.5-12.

MALAT1 is shown as SEQ ID NOs.7 and 8.

In another aspect, the present application provides a plasmid, which carries the shRNA for inhibiting the expression of long non-coding RNA MALAT1 as described above.

In another aspect, the present application provides a lentivirus, which carries the shRNA for inhibiting the expression of long non-coding RNA MALAT1 or the plasmid as described above.

In another aspect, the present application provides use of the shRNA for inhibiting the expression of long non-coding RNA MALAT1, the plasmid or the lentivirus in the treatment of cognitive dysfunction.

Further, the cognitive dysfunction is stress-induced cognitive dysfunction.

Further, the treatment of cognitive dysfunction comprises protecting hippocampal neurons.

In another aspect, the present application provides a medicament for treating cognitive dysfunction, which comprises the shRNA for inhibiting the expression of long non-coding RNA

MALAT1, the plasmid or the lentivirus as described above.

The “corresponding site in other transcript sequences” described in the present application can be routinely obtained by those skilled in the art from transcript sequences other than NR_002847.3 through sequence alignment, structural analysis and other means.

The "protecting hippocampal neurons" described in the present application includes, but is not limited to, promoting the cell cycle of hippocampal neurons, inhibiting the apoptosis of hippocampal neurons, and inhibiting the expression of key apoptosis proteins, cleaved PARP and cleaved Caspase3, in hippocampal neurons.

The MALAT1-shRNA interference plasmid of the present invention can significantly and specifically inhibit the expression of MALAT1 in hippocampal neurons, while stress induces increased expression of MALAT1 in hippocampal neurons, leading to decreased cognitive function. MALAT1-shRNA lentivirus can promote the progress of neuronal cell cycle and inhibit neuronal apoptosis and the expression of key apoptosis proteins, thereby resisting stress- induced neuron damage and showing a potential application value in the treatment of cognitive decline caused by various stresses.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the plasmid structure of the lentiviral vector;

Figure 2 shows the effect of MALAT1-shRNA lentiviral vector on the expression of

MALAT1, *P<0.05, **P<0.01;

Figure 3 shows the results of infecting 293T cells with the MALAT1-shRNA lentivirus (10 pl) under phase contrast microscope and fluorescence microscope, magnification: 200 X;

Figure 4 shows the change in plasma GC concentration of stressed mice compared with that of control mice, **P<0.01;

Figure 5 shows the change in the expression level of MALAT1 in the hippocampal tissues of stressed mice compared with that of control mice, **P<0.01;

Figure 6 shows that stress specifically induces the increase of MALAT1 in neurons, **P<0.01;

Figure 7 shows stress-induced cognitive impairment in mice, *P<0.05, **P<0.01,

Figure 8 shows the effect of MALAT1-shRNA lentivirus on the distribution of neuronal cell cycle, *P<0.05, **P<0.01;

Figure 9 shows that MALAT 1-shRNA lentivirus inhibits neuronal apoptosis, **P<0.01; and

Figure 10 shows that MALAT1-shRNA lentivirus inhibits the expression of key apoptosis proteins.

DETAILED DESCRIPTION

Unless otherwise specified, biochemical reagents used in methods of the following examples are all commercially available, and all the methods are conventional methods.

Example 1 Construction and Identification of MALAT1-shRNA Lentiviral Vector

The transcript sequence of MALAT1 (NR_002847.3) was obtained from NCBI. shRNA interference sites for MALAT1 were designed and 4 highest-scoring sites were screened out.

MALAT1-shRNA oligos and negative control shRNA oligo were chemically synthesized (Shanghai Genechem Biological Co., Ltd.), annealed to form a double strand, cloned into a lentiviral expression vector, respectively, to obtain recombinant plasmids. . Design of interference target sites for MALAT1

The sequences of target sites are as below: site 288: 5-GCAGTTTAGGAGATTGTAAAG-3 (SEQ ID NO.1) site 743: 5-GGAAGTGAAAGACGAAGAAGA-3 (SEQ ID NO.2) site 1048:5’-GCAGTTTAGAAGAGTCTTTAG-3’ (SEQ ID NO.3) site 4807:5-GCTCAGGACTTTGCATATAAG-3’ (SEQ ID NO.4).

Il. Construction of MALAT1-shRNA lentiviral expression vector 1. MALAT1-shRNA oligos and negative control shRNA oligo were chemically synthesized (Shanghai Genechem Biological Co., Ltd.). Their sequences are as below: shRNA for site 286

Top Strand 5'-CcggGCAGTTTAGGAGATTGTAAAGCTCGAGTCTTCTTCGTCTTTCACTTCCTTTTTg-3' (SEQ ID NO.5)

Bottom Strand 5'- aattcaaaaaGCAGTTTAGGAGATTGTAAAGCTCGAGTCTTCTTCGTCTTTCACTTCC-3' (SEQ ID NO.6) 5 shRNA for site 743

Top Strand 5'-CcggGGAAGTGAAAGACGAAGAAGACTCGAGTCTTCTTCGTCTTTCACTTCCTTTTTg-3' (SEQ ID NO.7)

Bottom Strand 5'- aattcaaaaaGGAAGTGAAAGACGAAGAAGACTCGAGTCTTCTTCGTCTTTCACTTCC -3' (SEQ ID NO.8) shRNA for site 1048

Top Strand 5- CcggGCAGTTTAGAAGAGTCTTTAGCTCGAGTCTTCTTCGTCTTTCACTTCCTTTTTg-3' (SEQ ID NO.9)

Bottom Strand5'- aattcaaaaaGCAGTTTAGAAGAGTCTTTAGCTCGAGTCTTCTTCGTCTTTCACTTCC -3' (SEQ

ID NO.10) shRNA for site 4807

Top Strand 5'-CcggGCTCAGGACTTTGCATATAAGCTCGAGTCTTCTTCGTCTTTCACTTCCTTTTTg-3' (SEQ ID NO.11)

Bottom Strand 5'-aattcaaaaaGCTCAGGACTTTGCATATAAGCTCGAGTCTTCTTCGTCTTTCACTTCC -3' (SEQ ID NO.12)

Negative control shRNA

Top Strand 5'-CcggTTCTCCGAACGTGTCACGTCTCGAGTCTTCTTCGTCTTTCACTTCCTTTTTg-3' (SEQ ID NO.13)

Bottom Strand 5'-aattcaaaaaTTCTCCGAACGTGTCACGTCTCGAGTCTTCTTCGTCTTTCACTTCC -3' (SEQ ID NO.14).

2. The dry powder of the synthesized DNA was dissolved in an annealing buffer, maintained in a water bath at 90°C for 15 min, and naturally cooled to room temperature to form a double strand. 3. Vector digestion and recovery (1) The lentiviral expression vector used is GV493; the sequence of elements is hU6-MCS-

CBh-gcGFP-IRES-puromycin; the cloning sites: Agel and EcoRI. (Figure 1) (2) The vector was digested with restriction enzymes Agel and EcoR | (NEB, Inc.). The reaction solution was prepared according to the following system, and after mixing, digestion was performed overnight in a 37°C water bath. 10 x CutSmart Buffer 5 HI vector (1 pg/ul) 2 ul

Agel (10 U/ul) 1 HI

EcoR | (10 U/ul) 1 HI ddH0 41 ul

Total Volume 50 ul (3) 10 ul of 6x loading buffer was added to the digested product of the vector. Agarose gel electrophoresis was performed, and the target strip was cut under ultraviolet light. Recovery was performed according to the instructions of the gel recovery kit (Tiangen Biological Co.,

Ltd). 4. Ligation

Linearized vector and annealed double-stranded DNA was ligated by T4 DNA ligase. The reaction solution was prepared according to the following system, and placed at room temperature for 1-2 hrs after mixing. 2 x T4 Buffer 7 ul

T4 potent ligase (Invitrogen, Inc.) 1 ul

Double-stranded DNA (100 ng/ul) 1 ul

Linearized vector (100 ng/ul) 1 ul

Total Volume 10 ul 5. Transformation (1) E. coli DH5 competent cells (Takara, Inc.) were place on ice to thaw naturally. 10 pl of the ligation product was added to the competent cells and stood on ice for 20 min. Heat shock was performed for 90 sec in a 42°C water bath, then the cells were immediately placed on ice for 2 minutes. 700 pl of LB medium was added, and the bacteria were shaken in a shaker at 37°C for 45 min.

(2) The bacterial liquid was evenly spread on an agar plate containing ampicillin. The plate was placed upright in an oven at 37°C for 30 min, and then placed upside down and incubated for 12-16 hrs. (3) A number of single clones were picked and put into a shaking tube, then 3 ml of LB medium containing ampicillin was added. The bacteria were shaken in a shaker at 37°C for 12- 16 hrs. 6. Identification of positive recombinants (1) Primers were designed and synthesized for PCR identification, and the sequences are as below:

P1 (5-3). CCATGATTCCTTCATATTTGC,; P2 (5-3): GTAATACGGTTATCCACGCG. (2) PCR identification experiments of the bacterial liquid were performed with the bacterial liquid as a template, and the reaction system is as follows: 2 x PCR mix (TIANGEN CO.,LTD.) 10 pl

P1 primer (10 pM) 1 ul

P2 primer (10 pM) 1 ul

Bacterial liquid 1 HI ddH20 7 ul

Total Volume 20 ul

The PCR reaction was performed in the PCR machine according to the following procedures: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 sec, 60°C annealing for 30 sec, 72°C extension for 1 min, for a total of 35 cycles; and a final 72°C reaction for 10 min. (3) The positive bacteria colony initially identified by PCR was sequenced (Shanghai

Genechem Biological Co., Ltd.), and the sequencing result was correct and consistent with the synthesized sequence. (4) The correctly sequenced bacteria liquid was added to 10 ml of LB medium containing ampicillin antibiotics, and shaken in a shaker at 37°C for 12-16 hrs. The recombinant plasmid was extracted using the TIANprep Midi Plasmid Kit (Tiangen Biological Co., Ltd.) according to the instructions.

Example 2 Detection of the Interference Effect of MALAT1-shRNA plasmid

The identified positive recombinant plasmid was transfected into HT22 cells. The cells were collected to extract RNA, which was reverse transcribed to obtain cDNA. The effect of recombinant plasmids on MALAT expression was detected by real-time PCR experiments, and the plasmid with the most significant interference effect was selected for further lentivirus packaging. . Cell transfection

(1) HT22 cells in the logarithmic growth phase were seeded in a 6-well culture plate at a density of 50%, and cultured in a 5% CO», 37°C incubator until reaching the cell density of about 80%. (2) A mixture of the plasmid and transfection reagent was prepared according to the instructions of jetPEI transfection reagent (Polyplus, Inc.), and added dropwise to the cells. (3) The status of the cells was observed after 24 hours, and the medium was replaced with fresh complete medium. After 48 hours, the cells were collected to extract RNA for Real-time

PCR experiment.

Il. RNA extraction (1) The cells were washed twice with normal saline. 1 ml Trizol {Invitrogen} was added.

Then the cells were lysed at room temperature for 5 min, and transferred to a 1.5 ml Eppendorf tube. (2) 200 pl of chloroform was added to the tube and the tube was shaken vigorously for 15 sec and stood for 3 min. (3) Centrifugation was performed at 4°C, 12,000 g for 15 min. (4) The top layer in the tube was gently pipetted into a new 1.5 ml Eppendorf tube. An equal volume of isopropanol was added to the new tube and the new tube was shaken gently and stood for 10 min. (5) Centrifugation was performed at 4°C, 12,000 g for 10 min. (6) The supernatant was removed by aspiration, and 1 ml of 75% ethanol was added to wash the precipitate with gentle blow. Be careful not to blow the precipitate apart. (7) Centrifugation was performed at 4°C, 12,000 g for 5 min. (8) The supernatant was removed by aspiration, the RNA was dried for 5-10 minutes until the precipitate is transparent, and an appropriate amount of DEPC water was added. (9) After the RNA was completely dissolved, 1 pl the RNA was loaded into a NanoDrop

Micro Ultraviolet Spectrophotometer (Thermo) to detect the concentration and purity of the

RNA.

Ill. Reverse transcription PCR (1) The following reaction system was prepared in a PCR tube with 2 ug RNA:

RNA 2 ug

Random primer N6/Oligo d(T) 1 HI

DEPC water X HI

Total volume 17.5 ul (2) Reaction was performed in a water bath or PCR machine at 70°C for 5 min, then the

PCR tube was immediately taken out and placed in an ice bath for at least 2 min.

(3) The following reagents were added to each tube with gentle mixing. x RT buffer 5 ul dNTPs (100 mmol/L) 1 ul

MMLV (200 U/uL) 1 HL 5 RNasin (40 U/ulL) 0.5 yl

Total volume 7.5 ul (4) Reaction was performed at 37°C for 60 min and at 70°C for 10 min to obtain cDNA.

IV. Real-time fluorescence quantitative PCR (Real-time PCR) (1) The real-time PCR primers used to detect the expression level of MALAT1 were designed and synthesized. The sequences were as below:

Forward Primer (5'- 3'): CCATGATTCCTTCATATTTGC;

Reverse Primer (5'- 3'): GTAATACGGTTATCCACGCG; (2) The reaction solution was prepared according to the following system in triplicate: 2 x SYRB Green Master (Takara, Inc.) 5 pl cDNA 1 ul

Forward Primer (5 HM) 0.5 ul

Reverse Primer (5 WM) 0.5 ul

Milli-Q H2© 3 ul

Total volume 10 ul

Reaction was performed in a Real-time PCR machine according to the following procedures: 95°C pre-denaturation for 10 min; 95°C denaturation for 5 sec, 60°C annealing for 30 sec, 72°C extension for 35 sec, for a total of 40 cycles; a final 72°C reaction for 10 min. (3) The test results were analyzed with B-actin as an internal control. As shown in Figure 2, the plasmids for sites 286, 743, and 1048 all inhibit the expression of MALAT1, and the interference effect of the plasmid for site 743 is the most significant. As a result, this plasmid was selected for further lentivirus packaging.

Example 3 Lentivirus Packaging and Quality Inspection

The MALAT1-shRNA interference plasmid, VSVG plasmid and psPAX2 plasmid were co- transfected into 293T cells. The cells were cultured for 48 hours and then the cell supernatants were collected. The lentivirus was concentrated and purified by ultracentrifugation, and finally the virus titre was measured by fluorometry. . Cultivation of 293T cells 1. Thawing of 293T cells

(1) DMEM medium containing 10% FBS (also referred to as complete medium) was prepared for the cultivation of 293T cells. (2) 3 ml of the complete medium was added to a 10 ml glass centrifuge tube. (3) The cells were taken out of a liquid nitrogen tank or -80°C refrigerator, immediately placed into a 37°C water bath, and gently shaken for 1-2 min to thaw them completely. (4) The cryopreservation tube was transferred to a clean bench, and disinfected by wiping the surface with an alcohol cotton ball. The cell suspension was added to a centrifuge tube prepared in advance. (5) Centrifugation was performed at 800 g for 3 min, and the supernatant was discarded. 2 ml of fresh complete medium was added to the tube. The cells were suspended by gently blowing with a dropper. The cells were seeded into a 10 cm culture dish containing 8 ml of fresh complete medium, and incubated in a 37°C, 5% CO: incubator. 2. Passaging of 293T cells (1) The growth status and density of the cells were observed every day. Passage was performed when the cell density reaches 80%. (2) The original medium was removed by aspiration. The cells were washed twice with 10 ml of normal saline. After addition of 1 ml 0.5% trypsin solution, the cells were placed in a 37°C incubator for digestion for 1 to 3 min until the cells just fall off the culture dish. (3) 3 ml of the complete medium was added to terminate the digestion, and the cell suspension was transferred to a 10 ml glass centrifuge tube. (4) Centrifugation was performed at 800 g for 3 min, and the supernatant was discarded. 5 ml of fresh complete medium was added. The cells were suspended by gently blowing with a dropper. 1 ml cells were seeded into a 10 cm culture dish containing 8 ml of fresh complete medium for a total of 5 dishes, and incubated in a 37°C, 5% CO; incubator. 3. Freezing of 293T cells (1) The 293T cells in the logarithmic growth phase were taken out, and the original medium was removed by aspiration. The cells were washed twice with 10 ml of normal saline. After addition of 1 ml 0.5% trypsin solution, the cells were placed in a 37°C incubator for digestion for 1 to 3 min until the cells just fall off the culture dish. (2) 3 ml of the complete medium was added to terminate the digestion, and the cell suspension was transferred to a 10 ml glass centrifuge tube. (3) Centrifugation was performed at 800 g for 3 min, and the supernatant was discarded.

The cells were resuspended by adding 3 ml of cell cryopreservation solution (Suzhou New Cell & Molecular biotech Co., Ltd.), and dispensed into cryopreservation tubes with 1 ml/tube. The cryopreservation tubes were placed in a -80°C refrigerator, and transferred into a liquid nitrogen tank for long-term storage on the second day.

II. Plasmid transfection

(1) 293T cells were seeded in a 10 cm culture dish. Transfection was performed when the cell density reaches 70-80%. (2) To a 1.5 ml Eppendorf tube, 500 ul 0.9% sodium chloride solution was added. Then 2 ug VSVG, 6 pg psPAX2, and 8 pg of the above MALAT1-shRNA plasmids were added, respectively. The tube was shaken for homogeneous mixing, and centrifuged instantly. (3) To a 1.5 ml Eppendorf tube, 500 ul 0.9% sodium chloride solution was added. Then 64

Hi of transfection reagent jetPEI was added. The tube was shaken for homogeneous mixing, and centrifuged instantly. (4) The liposome diluent was added dropwise to the plasmid diluent. The tube was shaken for homogeneous mixing, centrifuged instantly and placed at room temperature for 20 min. (5) Fresh medium was provided to the cells, 7 ml/plate. (6) The solution containing the DNA-liposome complex was dropped onto the surface of the cells. The tube was incubated in a 5% CO, 37°C incubator. After 12 hours, the medium was replaced with 10 ml of fresh medium.

II. Harvesting, concentration and purification of lentivirus (1) After culturing for 48 hrs, the cell supernatant was collected, passed through a 0.45 uM filter and then added to a 40 ml ultracentrifuge tube. The tube was placed into a Beckman ultracentrifuge, and centrifuged at 4°C, 25000 rpm for 2 hrs. (2) After centrifugation, the supernatant was discarded. The remaining liquid on the tube wall was removed to the greatest extent. The virus stock solution was added to the tube, and the cells were resuspended by repeatedly gentle blowing. (3) After fully dissolving, centrifugation was performed at high speed at 10,000 rpm for 5 min. The supernatant was collected for packaging.

IV. Detection of lentivirus titre 1. Determination of virus titre by fluorometry (1) The day before the measurement, 293T cells was seeded into a 96-well plate with 4x 10% cells per well and a volume of 100 pl. (2) 7-10 sterile EP tubes were prepared according to the expected virus titres, and 90 pl serum-free medium was added to each tube; (3) 10 ul of the virus stock solution to be tested was added to the first tube and mixed evenly. Then 10 pl from the first tube was added to the second tube, and the same operation was proceeded to the last tube; (4) The desired cell wells were selected. 90 pl of medium was discarded, and 90 HI of diluted virus solution was added. Then the tube was incubated in an incubator; (5) After 24h, 100 pl of complete medium was added,

(6) After culturing for 4 days, the fluorescence expression was observed. The number of fluorescent cells decreases with the increase of the dilution factor. 2. Calculation of virus titre

The calculation formula is: virus titre = the number of fluorescent cells/the amount of virus stock solution (TU/mI)

According to the GFP expression in the fluorescence picture (Figure 3), two fluorescent cells were observed in the well infected by 10% pl virus stock solution, and the virus titre was 2x10 (TU/ml).

Example 4 Effect of Stress on MALAT1 Expression and Cognitive Function

Under stress conditions, GC secretion in the body increases, and neuronal damage induced by high concentrations of GC is an important pathological mechanism of cognitive dysfunction. Therefore, we established an animal model of chronic stress to detect the plasma

GC concentration and the expression level of MALAT1 in the hippocampal tissues in the brains of the mouse; hippocampal neurons and non-neuronal cells were further isolated to detect the effect of stress on the MALAT1 expression of neurons; and changes in mice's cognitive ability were detected through animal behaviour experiments. 1. A stress animal model was established by giving BALB/c mice chronic unpredictable mild stimulation. Plasma was collected from the mouse and the GC detection kit was used to detect the effect of stress on the secretion of GC. The results showed that the plasma GC level of stressed mice was increased significantly (Figure 4). 2. The hippocampal tissue was isolated to extract RNA. The effect of stress on the expression of MALAT1 in the hippocampal tissue was detected by a real-time PCR experiment.

The results showed that the expression of MALAT1 in the hippocampus of stressed mice was increased (Figure 5). 3. Magnetic separation technology (Miltenyi, Inc.) was used to isolate hippocampal neurons and non-neuronal cells from stressed mice and control mice. RNA was extracted, and the effect of stress on the expression level of MALAT1 in the hippocampal tissue was detected by a real- time PCR experiment. The results showed that stress specifically induced an increase expression of MALAT1 in neurons (Figure 6). 4. The effect of stress on the cognitive ability of mice was detected through an open field experiment and water maze experiment. The results showed that compared with the control, the mice in the stress group had lower open field scores, increased escape latency in water maze, and reduced times of platform passes, indicating that stress can cause cognitive impairment in mice (Figure 7).

Example 5 Protective Effect of MALAT1-shRNA Lentivirus on Hippocampal Neurons

In order to further observe the regulatory effect of MALAT1-shRNA lentivirus (LV- shMALAT1) on neurons, we established a hippocampal neuron cell line in which the MALAT1 expression is stably interfered. The effect of inhibiting MALAT1 expression on cell cycle and apoptosis of neurons was detected. 1. Establishment of MALAT 1-stably-interfered cell line (1) HT22 cells in the logarithmic growth phase were prepared into a single cell suspension with complete medium. 3-5x 105 cells were seeded on a 6-well plate. (2) After the cells adhered to the wall, the original medium was removed by aspiration, and 1 ml fresh medium and 40 ul infection enhancement solution were added. The above-mentioned lentivirus was added to the cell culture medium at MOI=50, and the medium was replaced at 12 hrs. (3) The cells were expanded into a 10 cm culture plate, then the cells were collected. GFP* cells were sorted out by flow cytometry, thereby establishing a MALAT 1-stably-interfered cell line. 2. Detection of the effect of inhibiting MALAT1 expression on hippocampal neurons (1) The MALAT 1-interfered cells were seeded into a 6-well plate. The cells were collected after 24 hours, fixed with 70% ice ethanol overnight, then stained with PI staining solution. The effect of LV-shMALAT1 on the cell cycle distribution of hippocampal neurons was detected by flow cytometry. The results showed that the proportion of cells in GO/G1 phase decreased and the proportion of cells in S phase increased after inhibiting the expression of MALAT1 by LV- shMALAT1, indicating that LV-shMALAT1 can promote the progress of the cell cycle (Figure 8). (2) The MALAT 1-interfered cells were seeded into a 6-well plate. The cells were collected after 24 hours, and stained with Annex V-APC/PI apoptosis detection kit (Thermo, Inc.). The effect of LV-shMALAT1 on the apoptosis level of hippocampal neurons was detected by flow cytometry. The results showed that LV-shMALAT1 can inhibit the apoptosis of hippocampal neurons (Figure 9). (3) Cellular proteins were extracted and a digital Wes automatic protein expression analyser (Proteinsimple, Inc.) was used to perform western blot experiment to detect the expression level of key apoptosis proteins. The results showed that LV-shMALAT1 can significantly inhibit the expression of key apoptosis proteins, cleaved PARP and cleaved

Caspase3 (Figure 10).

SEQLTXT

SEQUENCE LISTING

<110> Academy of Military Medical Sciences, Academy of Military Science of

Chinese PLA <120> shRNA Lentivirus for Inhibiting the Expression of Long Non-coding RNA

MALAT1 and Use Thereof <130> Lentivirus <140> <141> 2022-01-05 <150> CN202111938413.5 <151> 2021-09-06 <160> 18 <170> PatentIn version 3.5 <21e> 1 <211> 21 <212> DNA <213> artificial sequence <220> <223> Target site 286 <400> 1 gcagtttagg agattgtaaa g 21 <2105 2 <211> 21 <212> DNA <213> artificial sequence <220> <223> Target site 743 <400> 2 ggaagtgaaa gacgaagaag a 21 <2105 3 <211> 21 <212> DNA <213> artificial sequence <220> <223> Target site 1048 <400> 3

Pagina 1

SEQLTXT gcagtttaga agagtcttta g 21 <210> 4 <211> 21 <212> DNA <213> artificial sequence <220> <223> Target site 4807 <400> 4 gctcaggact ttgcatataa g 21 <210> 5 <211> 58 <212> DNA <213> artificial sequence <220> <223> Top strand oligo target site 286 <400> 5 ccgggcagtt taggagattg taaagctcga gtcttcttcg tctttcactt cctttttg 58 <210> 6 <211> 58 <212> DNA <213> artificial sequence <220> <223> Bottom strand oligo target site 286 <400> 6 ccgggcagtt taggagattg taaagctcga gtcttcttcg tctttcactt cctttttg 58 <210> 7 <211> 58 <212> DNA <213> artificial sequence <220> <223> Top strand oligo target site 743 <400> 7 ccggggaagt gaaagacgaa gaagactcga gtcttcttcg tctttcactt cctttttg 58 <210> 8

Pagina 2

SEQLTXT

<211> 58 <212> DNA <213> artificial sequence <220> <223> Bottom strand oligo target site 743 <400> 8 aattcaaaaa ggaagtgaaa gacgaagaag actcgagtct tcttegtctt tcacttcc 58 <210> 9 <211> 58 <212> DNA <213> artificial sequence <220> <223> Top strand oligo target site 1048 <400> 9 ccgggcagtt tagaagagtc tttagctcga gtcttcttcg tctttcactt cctttttg 58 <210> 10 <211> 58 <212> DNA <213> artificial sequence <220> <223> Bottom strand oligo target site 1048 <400> 10 aattcaaaaa gcagtttaga agagtcttta gctcgagtct tcttegtctt tcacttcc 58 <210> 11 <211> 58 <212> DNA <213> artificial sequence <220> <223> Top strand oligo target site 4807 <400> 11 ccgggctcag gactttgcat ataagctcga gtcttcttcg tctttcactt cctttttg 58 <210> 12 <211> 58 <212> DNA <213> artificial sequence

Pagina 3

SEQLTXT

<220> <223> Bottom strand oligo target site 4807 <400> 12 aattcaaaaa gctcaggact ttgcatataa gctcgagtct tcttegtctt tcacttcc 58 <2105 13 <211> 56 <212> DNA <213> artificial sequence <220> <223> Top strand oligo negative control <400> 13 ccggttctcc gaacgtgtca cgtctcgagt cttcttcgtc tttcacttcc tttttg 56 <210> 14 <211> 56 <212> DNA <213> artificial sequence <220> <223> Bottom strand oligo negative control <400> 14 aattcaaaaa ttctccgaac gtgtcacgtc tcgagtcttc ttegtctttc acttcc 56 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse identification primer <400> 15 ccatgattcc ttcatatttg c 21 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse identification primer <400> 16

Pagina 4

SEQLTXT gtaatacggt tatccacgcg 20 <21e> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward RT PCR Primer <400> 17 ccatgattcc ttcatatttg c 21 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse RT PCR Primer <400> 18 gtaatacggt tatccacgcg 20

Pagina 5

Claims

CONCLUSIONS

1. A shRNA for inhibiting the expression of long non-coding MALAT1 RNA designed to target position 286, 743, 1048 or 4807 of the MALAT1 transcript sequence NR_002847.3 or a corresponding position in other transcript sequences in Genbank.

The shRNA for inhibiting the expression of long non-coding MALAT1 RNA according to claim 1, wherein the shRNA for inhibiting the expression of long non-coding MALAT1 RNA is designed to target the 743 position of the MALAT1 - transcript sequence NR_002847.3 or a corresponding site in other transcript sequences in Genbank.

The shRNA for inhibiting the expression of long noncoding MALAT1 RNA according to claim 1, wherein the sequence of the shRNA for inhibiting the expression of long noncoding MALAT1 RNA is shown as SEQ ID NOs.5 - 12.

The shRNA for inhibiting the expression of long non-coding MALAT1 RNA according to claim 2 or 3, wherein the sequence of the shRNA for inhibiting the expression of long non-coding MALAT1 RNA is shown as SEQ ID NOs.7 and 8.

A plasmid containing the shRNA for inhibiting the expression of long non-coding MALAT1 RNA according to any one of claims 1 to 4.

A lentivirus containing shRNA for inhibiting the expression of long non-coding MALAT1 RNA according to any one of claims 1 to 4 or the plasmid according to claim 5.

Use of the shRNA for inhibiting the expression of long non-coding MALAT1 RNA according to any one of claims 1-4, the plasmid according to claim 5 or the lentivirus according to claim 6 in the treatment of cognitive dysfunction.

The use according to claim 7, wherein the cognitive dysfunction is stress-induced cognitive dysfunction.

The use according to claim 8, wherein the treatment of cognitive dysfunction comprises protecting neurons of the hippocampus.

A medicament for the treatment of cognitive dysfunction comprising the shRNA for inhibiting the expression of long non-coding MALAT1 RNA according to any one of claims 1 to 4, the plasmid according to claim 5 or the lentivirus according to claim 8.