CN110129334B

CN110129334B - Application of IiWRKY34 in regulation and control of Isatis Indigotica lignan biosynthesis and stress-resistant reaction

Info

Publication number: CN110129334B
Application number: CN201910421717.6A
Authority: CN
Inventors: 肖莹; 冯婧娴; 陈万生
Original assignee: Shanghai University of Traditional Chinese Medicine
Current assignee: Shanghai University of Traditional Chinese Medicine
Priority date: 2019-05-21
Filing date: 2019-05-21
Publication date: 2021-08-24
Anticipated expiration: 2039-05-21
Also published as: CN110129334A

Abstract

The invention provides an application of IiWRKY34 in regulation and control of Isatis Indigotica lignan biosynthesis and stress-resistant reaction, and relates to the technical field of biology. The open reading frame of the IiWRKY34 gene has a sequence shown in SEQ ID NO.1, the IiWRKY34 gene regulates the synthesis of lignans of isatis indigotica, and when the IiWRKY34 gene of isatis indigotica inhibits expression, the synthesis amount of the lignans is reduced by at least 50% compared with that of a wild type; when the IiWRKY34 gene of Isatis tinctoria is over-expressed, the synthetic amount of lignans is at least 2 times of that of wild Isatis tinctoria, thus providing an alternative target for researching and regulating the active ingredients of Isatis tinctoria from gene level.

Description

Application of IiWRKY34 in regulation and control of Isatis Indigotica lignan biosynthesis and stress-resistant reaction

Technical Field

The invention relates to the technical field of biology, in particular to application of IiWRKY34 in regulation and control of isatin biosynthesis and stress-resistant reaction.

Background

Isatis indigotica fortunei (Isatis indigotica fortine), also known as Daindigo indigotica, is an annual herbaceous plant of Isatis indigotica of Brassicaceae. Isatis tinctoria is originally produced in the northern part of China, has wide distribution and is a traditional common Chinese medicinal material in China.

The isatis root is also named as isatis root, which is cold in nature and bitter in taste, has the effects of clearing away heat and toxic materials, cooling blood and relieving sore throat, is one of the common traditional Chinese medicines, and is widely used for resisting virus, bacteria, tumors, enhancing the immunity of organisms and the like clinically. The isatis leaf is indigowoad leaf, has the effects of clearing heat and removing toxicity, cooling blood and removing ecchymoses, can clear heat-toxin excess fire in blood system and is good at cooling blood and removing ecchymoses. It is suitable for treating heat entering nutrient-blood, qi-blood two-way sowing, warm toxicity, macula, pharynx swelling, aphtha, etc.

Lignans in isatis tinctoria, such as lariciresinol and lariciresinol glycoside, are the main active ingredients of isatis tinctoria, and are valuable medicinal resources. However, as lignan is a secondary metabolic component of isatis tinctoria, the content of secondary products in natural plants is usually too low, and if the secondary products are obtained by a chemical synthesis method, on one hand, the cost of the medicine is increased, and the pharmaceutical process flow is increased; on the other hand, in the synthesis process, isomers are formed, and environmental pollution and other problems are caused. Therefore, the related genes of the active ingredients in the isatis tinctoria are searched, the active ingredients of the isatis tinctoria are researched and regulated from the gene level, the quality of the isatis tinctoria serving as a medicinal plant can be effectively improved, and the important significance is achieved for protecting the germplasm resources of the isatis tinctoria and solving the contradiction between huge market demands and limited resources.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first purpose of the present invention is to provide an IiWRKY34 gene, which can regulate the synthesis of lignans of Isatis Indigotica.

The second object of the present invention is to provide a biomaterial containing the above IiWRKY34 gene.

The third object of the present invention is to provide a marker relating to the property of Isatis tinctoria.

The fourth object of the present invention is to provide a kit for detecting the property of Isatis tinctoria.

The fifth object of the present invention is to provide a method for controlling the property of Isatis tinctoria.

The sixth object of the present invention is to provide the use of the above IiWRKY34 gene, a biomaterial containing the above IiWRKY34 gene, a marker related to the trait of Isatis tinctoria, a kit for detecting the trait of Isatis tinctoria, or a method for controlling the trait of Isatis tinctoria in the preparation of a medicament.

In order to solve the technical problems, the invention adopts the following technical scheme:

according to one aspect of the invention, the invention provides an IiWRKY34 gene, an open reading frame of the IiWRKY34 gene has a sequence shown as SEQ ID NO.1, and the IiWRKY34 gene regulates the synthesis of lignans of isatis indigotica.

Preferably, the lignan comprises lariciresinol.

Preferably, the IiWRKY34 gene also regulates at least one of biomass, lignification degree and stress resistance of Isatis tinctoria;

preferably, the stress resistance includes drought stress resistance and high salt environment stress resistance.

According to another aspect of the present invention, there is also provided a biomaterial selected from one or more of the following (n1) to (n 4):

(n1) an expression cassette comprising said IiWRKY34 gene;

(n2) a vector comprising said IiWRKY34 gene, or a vector comprising (n1) said expression cassette;

(n3) a recombinant microorganism containing said IiWRKY34 gene, a recombinant microorganism containing (n1) said expression cassette, or a recombinant microorganism containing (n2) said vector;

(n4) a cell line comprising the IiWRKY34 gene, a cell line comprising (n1) the expression cassette, or a cell line comprising (n2) the vector.

According to another aspect of the present invention, there is also provided a marker related to the property of Isatis tinctoria, which is selected from the group consisting of (a 1): the IiWRKY34 gene; (a2) a fusion gene comprising the IiWRKY34 gene; (a3) the method comprises the following steps (a1) Or (a2) transcribed RNA; (a4) the method comprises the following steps (a1) A protein expressed in any one of (a) to (a 3); the traits comprise lignan synthesis capacity of isatis indigotica;

preferably, the trait further comprises at least one of biomass, lignification degree and stress resistance of lignans.

According to another aspect of the present invention, the present invention also provides a kit for detecting the property of Isatis tinctoria, wherein the kit is used for detecting the above-mentioned marker;

preferably, the kit comprises a primer pair for amplifying the Isatis Indigotica IiWRKY34 gene, wherein the primer pair has a sequence shown as SEQ ID NO.6 and a sequence shown as SEQ ID NO. 7.

According to another aspect of the invention, the invention also provides a method for regulating the property of isatis tinctoria, which comprises over-expressing or inhibiting the expression of the IiWRKY34 gene;

the isatis indigotica trait comprises at least one of (b1) to (b4), and (b1) lignan synthesis capacity; (b2) biomass; (b3) degree of lignification; and, (b4) stress resistance.

Preferably, the overexpression comprises using a strong promoter to drive expression of the IiWRKY34 gene; the strong promoter is preferably 35S.

Preferably, said inhibiting expression comprises transforming an expression vector of an inverted repeat of the IiWRKY34 gene into Isatis tinctoria to silence expression of the IiWRKY34 gene.

According to another aspect of the invention, the invention also provides application of the IiWRKY34 gene, the biological material, the marker, the kit or the method for regulating the isatis tinctoria property in preparation of medicines.

Compared with the prior art, the invention has the following beneficial effects:

the open reading frame of the IiWRKY34 gene provided by the invention has a sequence shown in SEQ ID NO.1, the IiWRKY34 gene regulates the synthesis of lignans of isatis indigotica, and when the IiWRKY34 gene of isatis indigotica inhibits expression, the synthesis amount of the lignans is reduced by at least 50% compared with that of a wild type; when the IiWRKY34 gene of Isatis tinctoria is overexpressed, the amount of lignan synthesized is at least 2 times that of the wild type. The invention also provides a biological material containing the IiWRKY34 gene, which is used for regulating the expression of the IiWRKY34 gene to regulate the content of lignans in isatis tinctoria. Since the IiWRKY34 gene regulates the synthesis of lignans of isatis indigotica, the gene can also be used as a marker of the synthesis capability of isatis indigotica, so that the gene can be used for evaluating the synthesis capability of lignans of isatis indigotica and further evaluating the quality of isatis indigotica lines.

The IiWRKY34 gene, the biological material containing the IiWRKY34 gene, the isatis tinctoria trait related marker, the kit for detecting the isatis tinctoria trait or the method for regulating the isatis tinctoria trait provided by the invention can be applied to preparation of medicaments. Because lignans have anti-tumor, anti-virus and anti-bacterial effects and have protective effects on the cardiovascular system and the central nervous system, the expression of the lignans in the isatis tinctoria can be regulated and controlled by regulating the expression of the IiWRKY34 gene in the isatis tinctoria so as to prepare the isatis tinctoria with high content as a raw material of a medicament or as an extraction raw material of the lignans to prepare the medicament taking the lignans as active ingredients.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a schematic diagram of a vector pHB-flag-WRKY34 provided in example 1 of the present invention;

FIG. 2 is a schematic diagram of the vector pCAMBIA-1300-WRKY34 provided in example 2 of the present invention;

FIGS. 3 and 4 are the results of identification of hairy roots of Isatis tinctoria of each group as provided in example 3 of the present invention;

FIG. 5 shows the expression levels of IiWRKY34 gene in samples from WT, RNAi and OVX groups;

FIG. 6 shows the content of lariciresin in samples of WT group, RNAi group and OVX group in examples of the present invention;

FIG. 7 shows the biomass of hairy roots of Isatis tinctoria of each group in 0-45 days;

FIGS. 8 and 9 show hairy roots of Isatis tinctoria of the present invention;

FIG. 10 shows the results of safranine fast-green staining of hairy roots of Isatis tinctoria L of various groups according to the present invention;

FIG. 11 shows the results of phloroglucinol staining of hairy roots of Isatis tinctoria L of various groups according to the present invention;

FIG. 12 shows the expression of IiWRKY34 gene in different organ tissues of wild type Isatis tinctoria plants in flowering period;

FIG. 13 shows the IiWRKY34 gene expression level of wild type aseptic Isatis Indigotica seedlings in drought stress environment;

FIG. 14 shows IiWRKY34 gene expression level of wild type Isatis Indigotica aseptic seedling under high salt environment stress;

FIG. 15 shows IiWRKY34 gene expression level of wild type aseptic Isatis Indigotica seedlings induced by salicylic acid;

FIG. 16 shows the IiWRKY34 gene expression level of wild type Isatis Indigotica aseptic seedlings induced by methyl jasmonic acid;

FIG. 17 shows the growth of hairy roots in the non-stressed, drought-stressed and high-salt environmental stresses of WT group, OVX group and RNAi group;

FIG. 18 shows the results of ROS detection experiments on hairy roots of WT group, OVX group and RNAi group under no stress, drought stress and high salt environment stress;

FIG. 19 is a graph showing the total antioxidant capacity of hairy roots of WT group, OVX group and RNAi group under no stress, drought stress and high salt environment stress;

FIG. 20 shows proline contents of hairy roots of WT group, OVX group and RNAi group under stress-free, drought stress and high-salt environment stress.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments, and it should be understood that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The invention provides an IiWRKY34 gene, wherein the open reading frame of the IiWRKY34 gene has a sequence shown in SEQ ID NO.1, and the IiWRKY34 gene regulates the synthesis of lignans of isatis tinctoria.

Lignans (lignans), also known as lignans, are components isolated from angiosperms and gymnosperms, and are mostly present in the free state, and some are present in the wood and resin of plants in combination with sugars. The accumulation of lignans is associated with the stress tolerance of the species. Lignans are also antitoxins in plants and antifeedants in insects, have phytotoxicity and cytotoxicity, and are chemical substances of plants for defense against plant diseases and insect pests. In addition, lignans are also involved in plant growth regulation.

The monomers for composing lignan include cinnamic acid, cinnamaldehyde, cinnamyl alcohol, allyl benzene, etc., different kinds of monomers can be dehydrogenated to form different free radicals, and the free radicals are mutually condensed to form various different kinds of lignans. The lignan includes, but is not limited to, secoisolariciresinol, matairesinol, pinoresinol, lariciresinol, isolariciresinol, taurolidine, nordihydroguaiaretic acid, or entanglemenol.

The IiWRKY34 gene provided by the invention regulates the lignan synthesis of isatis tinctoria, is a related gene of active ingredients in isatis tinctoria, and provides an alternative target for researching and regulating the active ingredients of isatis tinctoria from the gene level.

In some preferred embodiments, the IiWRKY34 gene regulates laricirin of Isatis tinctoria, and the amount of laricirin synthesized will be at least 50% down-regulated compared to wild type when expression is inhibited by IIWRKY34 gene of Isatis tinctoria; when the IiWRKY34 gene of Isatis tinctoria is overexpressed, the synthesis amount of lariciresin is at least 2 times that of the wild type.

In some preferred embodiments, the IiWRKY34 gene also regulates the biomass and lignification degree of Isatis Indigotica. When the IiWRKY34 gene of Isatis tinctoria inhibits expression, the biomass of Isatis tinctoria is down-regulated by at least 50% compared with the wild type, and the lignification degree is lower than that of the wild type; when the IiWRKY34 gene of Isatis tinctoria is over-expressed, the biomass of Isatis tinctoria is at least 2 times of that of wild type, and the lignification degree is higher than that of wild type.

In some preferred embodiments, the IiWRKY34 gene is also associated with the stress tolerance of Isatis Indigotica, including drought stress and high salinity stress. On one hand, under the growth conditions of drought stress and high salt environment stress, the IiWRKY34 gene is up-regulated and expressed; and when exogenous Salicylic Acid (SA) or Methyl jasmonate (MeJA) capable of improving the stress capability of plants is applied to wild type isatis tinctoria, the IiWRKY34 gene of the wild type isatis tinctoria is also up-regulated. On the other hand, when the IiWRKY34 gene inhibits the expression, the stress resistance of Isatis Indigotica is reduced.

The present invention also provides a biomaterial containing the above-mentioned Isatis tinctoria IiWRKY34 gene, including but not limited to expression cassettes, vectors, recombinant microorganisms and cell lines. The "expression cassette" refers to a nucleic acid construct containing a target gene and an element for regulating the target gene. The "vector" refers to a substance capable of achieving replication and/or expression of a target gene and introduction of the target gene into prokaryotic or eukaryotic cells, and includes, but is not limited to, plasmids, phages, viral genomes or viruses, and the like. The term "recombinant microorganism" refers to a microorganism which, when manipulated, is not identical in genotype or phenotype to that exhibited by the wild-type of the microorganism.

In particular, the biological material is selected from the following: (n1) an expression cassette comprising said IiWRKY34 gene; (n2) a vector comprising said IiWRKY34 gene, or a vector comprising (n1) said expression cassette; (n3) a recombinant microorganism containing said IiWRKY34 gene, a recombinant microorganism containing (n1) said expression cassette, or a recombinant microorganism containing (n2) said vector; (n4) a cell line comprising the IiWRKY34 gene, a cell line comprising (n1) the expression cassette, or a cell line comprising (n2) the vector.

The invention also provides a marker related to the property of the isatis tinctoria, wherein the marker is selected from (a 1): the IiWRKY34 gene; (a2) a fusion gene comprising the IiWRKY34 gene; (a3) the method comprises the following steps (a1) Or (a2) transcribed RNA; (a4) the method comprises the following steps (a1) A protein expressed in any one of (a) to (a 3); the trait includes lignan synthesis ability of isatis indigotica.

As is clear from the above, the IiWRKY34 gene is involved in the lignan-synthesizing ability of Isatis Indigotica, and therefore, the lignan-synthesizing ability of Isatis Indigotica can be characterized by using the IiWRKY34 gene of Isatis Indigotica as a marker. The expression "fusion gene containing the IiWRKY34 gene" refers to the gene IWRKY34 gene which is removed, and the fusion gene may also contain other functional units, including but not limited to a gene part serving as a marker, such as a fluorescent protein gene or a screening marker gene; or a portion of a gene encoding a marker for another trait; it may also be an element for regulating the expression level of a gene, such as a promoter or an enhancer. Accordingly, RNA or protein molecules obtained by transcription of the IiWRKY34 gene and a fusion gene containing the same can also be used as markers of the lignan synthesis capability of isatis tinctoria.

Further, since the IiWRKY34 gene of Isatis Indigotica and the biomass, lignification degree and stress resistance of Isatis Indigotica, especially drought stress resistance and high-salt environment stress resistance, have a certain degree of correlation, in some alternative embodiments, the above markers can also be used as markers for at least one of the biomass, lignification degree and stress resistance of Isatis Indigotica.

The present invention also provides a kit for detecting the properties of isatis tinctoria, including but not limited to at least one of lignan synthesis capacity, biomass, lignification degree and stress resistance of isatis tinctoria, by detecting the above markers.

In some specific embodiments, the kit comprises a primer pair for amplifying the Isatis Indigotica IiWRKY34 gene, and preferably, the primer pair has a sequence shown as SEQ ID NO.6 and a sequence shown as SEQ ID NO. 7. The kit also contains reagents for performing PCR or fluorescent quantitative PCR reactions, including but not limited to enzymes, dNTPs, buffers, Mg²⁺And a fluorescent dye. In some specific embodiments, the kit comprises a kit of reagents for extracting mRNA from a sample. In some specific embodiments, the kit comprises a fusion for detecting the IiWRKY34 gene or the IiWRKY34 geneAntibodies to the genetically expressed proteins, and reagents and consumables for use in ELISA assays.

The present invention also provides a method for regulating at least one of the synthesis ability, biomass, lignification degree and stress resistance of isatis indigotica, which comprises overexpressing or inhibiting the expression of the IiWRKY34 gene of isatis indigotica.

In some alternative embodiments, overexpression of the IiWRKY34 gene in Isatis Indigotica can increase lignan synthesis ability of Isatis Indigotica, and increase at least one of biomass, lignification degree and stress resistance of Isatis Indigotica.

In some alternative embodiments, the over-expression of the IiWRKY34 gene comprises the use of a strong promoter to drive the expression of the IiWRKY34 gene, and in some preferred embodiments, the IiWRKY34 gene is transformed into isatis tinctoria by using a pHB vector containing a 35S promoter as a vector, so that the synthesis amount of the lariciresin of the isatis tinctoria compared with that of wild isatis tinctoria can be up-regulated by 5.6 times, the biomass can be increased by 3.7 times, and the lignification degree can be remarkably increased.

In some alternative embodiments, inhibiting the expression of the IiWRKY34 gene in Isatis tinctoria can reduce the lignan synthesis ability of Isatis tinctoria, reduce the biomass and lignification degree of Isatis tinctoria, and reduce the stress resistance of Isatis tinctoria.

In some alternative embodiments, the inhibition of expression of the ii wrky34 gene in isatis tinctoria comprises constructing an inverted repeat expression vector for the ii wrky34 gene, and then transforming the inverted repeat expression vector into isatis tinctoria to silence transcription and expression of the ii wrky34 gene. The principle is as follows: dsRNA (double-stranded RNA) and protein related to RNAi can participate in chromatin modification, so that histone and DNA in the dsRNA are methylated, and a corresponding gene cannot be transcribed, so that a hindered gene cannot be expressed. Constructing an inverted repeat sequence expression vector of a target gene, and after the vector is transferred into an organism, carrying out intramolecular hybridization on a transcript of the inverted repeat sequence to form dsRNA, thereby mediating the silencing of the target gene.

In some preferred embodiments, a plasmid containing an IiWRKY34 gene with an inverted repeat is constructed using pCAMBIA-1300 as a source vector, and then the plasmid is transferred into Isatis tinctoria, so that the synthesis amount of the lariciresinol in Isatis tinctoria can be reduced by 80%, the biomass can be reduced by 70%, the lignification degree can be reduced, and the stress resistance of Isatis tinctoria can be remarkably reduced.

The invention also provides the application of the IiWRKY34 gene, the biological material, the marker, the kit or the method for regulating the property of isatis tinctoria in preparing medicaments.

Lignans have antitumor activity, and can inhibit cell proliferation and induce differentiation; inducing apoptosis; anti-angiogenesis; reversing multidrug resistance of tumor cells, and preventing hormone-dependent tumor such as breast cancer, benign prostatic hyperplasia and prostatic cancer; lignans also have antiviral and antibacterial effects, and have protective effects on cardiovascular system and central nervous system. Therefore, the IiWRKY34 gene, the biological material, the marker, the kit or the method for regulating the property of the isatis indigotica provided by the invention can be applied to preparing medicaments.

In some specific embodiments, the method for regulating the properties of isatis tinctoria can be used for up-regulating the expression of the IiWRKY34 gene to enable isatis tinctoria to highly express lignans, especially lariciresin, so as to obtain isatis tinctoria with high lignan synthesis amount and good stress resistance. In other embodiments, the above-mentioned kit can also be used for identifying Isatis tinctoria as a raw material of a drug to control the quality of the raw material of the drug.

The advantageous effects of the present invention will be further described with reference to preferred embodiments.

Experimental materials: about 40 days of aseptic Isatis tinctoria seedlings, Agrobacterium rhizogenes C58C1 strain, plasmid vector pCAMBIA-1300, pHB-flag. Lariciresinol (Shanghai-derived leaf).

ROS fluorescent probe-DHE (wiggles biotechnology (beijing) ltd.), fluorescence microscope (olympus, japan), proline (Pro) content assay kit (solibao, beijing), other instruments and reagents as described above, and other conventional reagents (national medicine).

Example 1

Constructing an IiWRKY34 gene overexpression vector pHB-flag-WRKY34, which comprises the following steps:

the target fragment amplification primers were designed according to the vector construction method, and as shown in Table 1, the target fragments were amplified using Isatis tinctoria cDNA as a template, and the amplification products were recovered using 0.8% agarose gel electrophoresis and a DNA gel recovery kit.

Carrying out double enzyme digestion on pHB-flag vector plasmids by using BamH I and Spe I, carrying out double enzyme digestion on amplification recovery products by using Bcl I and Spe I, recovering the enzyme digestion products by using a 0.8% agarose gel electrophoresis and DNA gel recovery kit, and connecting by using T4 ligase. The ligation products were transformed into E.coli competence, plated and incubated at constant temperature.

Selecting a single colony, performing PCR identification by using pHB-flag-WRKY34-F/R as a primer, and using a 10 mu L amplification system and amplification conditions: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 55 ℃ for 30s, and 68 ℃ for 1min for 20 s; 7min at 68 ℃; the temperature is kept constant at 4 ℃, and the length of the target fragment is about 900 bp. Sequencing the single colony strains with positive identification, and storing strains with correct sequencing at-80 ℃ for later use. The vector pHB-flag-WRKY34 is schematically shown in FIG. 1.

TABLE 1 construction of vector pHB-flag-WRKY34 primer

Primer name	Sequence of	Numbering
			pHB-flag-WRKY34-F	aatgatcaatggaccagtactcatcgtctt	SEQ ID NO.2
pHB-flag-WRKY34-R	aaactagttttctcggtttgattctgttga	SEQ ID NO.3

Example 2

Constructing an IiWRKY34 gene suppression expression vector pCAMBIA-1300-WRKY34, which comprises the following steps:

the target fragment amplification primers were designed according to the vector construction method, and as shown in Table 2, the target fragments were amplified using Isatis tinctoria cDNA as a template, and the amplification products were recovered using 0.8% agarose gel electrophoresis and a DNA gel recovery kit.

And carrying out double enzyme digestion, recovery and connection on the amplified and recovered fragments and the p1300 vector by using corresponding restriction enzymes and buffer solutions thereof. Nco I and Kpn I are the first group, Xba I and Sal I are the second group. Firstly, a first group of restriction endonucleases are used for carrying out enzyme digestion on an amplified and recovered fragment and a p1300 vector, a 0.8% agarose gel electrophoresis and DNA gel recovery kit is used for recovering an enzyme digestion product, and T4 ligase is used for carrying out ligation. Transforming the ligation product into a Trans-T1 (Escherichia coli DH5 alpha) competence, coating an LB-Kan solid culture medium, culturing at 37 ℃ for 12-16 h, then picking out a single colony, and extracting a plasmid by using a small plasmid extraction kit to obtain a vector p1300 a; the amplified fragments recovered were subjected to a second set of double digestion with vector p1300a and ligated using T4 ligase. The ligation products were transformed into E.coli competence, plated and incubated at constant temperature.

Single colonies were picked and identified by PCR using universal primers (JDPDK-1F/JDPDK-R) using a 10. mu.L amplification system, under the amplification conditions: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 55 ℃ for 30s, and 68 ℃ for 30 s; 7min at 68 ℃; the target fragment was approximately 527bp in length at a constant temperature of 4 ℃. Sequencing the single colony strain with positive identification, storing the strain with the correct sequencing connection at-80 ℃ for later use, and the schematic diagram of the vector pCAMBIA-1300-WRKY34 is shown in figure 2.

TABLE 2 construction of vector pCAMBIA-1300-WRKY34 primer

Primer name	Sequence of	Numbering
			pCAMBIA-1300-WRKY34-F	ccatgggtcgacttgtgctccaagctgt	SEQ ID NO.4
pCAMBIA-1300-WRKY34-R	ggtacctctagaacagctgctgctaatg	SEQ ID NO.5

Example 3

Constructing a recombinant woad hairy root material, and grouping the materials according to the following steps:

agrobacterium induced hairy roots with vector pHB-flag-WRKY34 are gene over-expression groups and named as OVX groups; the hairy root induced by only agrobacterium with carrier pHB-flag is a gene over-expression control group and named as PHB group; the hairy root induced by agrobacterium C58C1 with carrier pCAMBIA-1300-WRKY34 is a gene inhibition group and is named as RNAi group; the agrobacterium-induced hairy root with the vector p1300 only is a gene suppression control group and is named as a p1300 group; hairy roots induced using agrobacterium C58C1 without any vector were wild-type, named WT group, which was not screened using Hyg.

The recombinant Isatis tinctoria hairy root material was constructed as follows:

the positive plasmid vector is transferred into agrobacterium tumefaciens C58C1 strains by the OVX group and the RNAi group, the PHB group and the p1300 group are transferred into empty vectors, the WT group is not transferred into the vectors, C58C1 strains with the plasmid vectors are taken for activation, and 20 mL-40 mL YEB-Kan-Rif liquid culture medium is used for expanding culture until OD600 is approximately equal to 0.6; centrifuging at 4 deg.C and 5000rpm for 15min, discarding supernatant, resuspending thallus with equal volume of 1/2MS liquid culture medium, and culturing at 28 deg.C with constant temperature shaking table at 80rpm for 30 min.

Taking the aseptic seedling of the woad as the material, the length of which is about 40 to 60 days, as 1cm²Placing the left and right leaf discs on 1/2MS solid culture medium, and placing in a constant temperature incubator at 25 deg.C overnight; immersing the leaf disc into the activated agrobacterium culture solution, and dip-dyeing for 10min at the constant temperature of 28 ℃ and the rotation speed of a shaking table of 90 rpm; clamping the leaf disc by using a forceps, removing redundant bacteria liquid on the leaf disc, placing the leaf disc on 1/2MS solid culture medium with the right side facing upwards, and culturing in a constant-temperature incubator at 25 ℃ for 2 days in the dark; the leaf discs were transferred to 1/2MS-Cef (250mg/L, 500. mu.L/200 mL) solid medium and dark culture was continued, and hairy roots could grow on the wound edges of the leaf discs for about 2 weeks. When the hairy roots grow to about 3-5 cm, the hairy roots are cut off and inoculated to a new 1/2MS-Cef-Hyg solid screening culture medium for culture. In the process of growing the hairy roots, carrying out gradient resistance reduction treatment on the used culture medium, replacing the culture medium about once every 2 weeks, reducing the dosage of Cef from 500 mu L/200mL to 0, and automatically adjusting the concentration of antibiotics according to the actual condition; at the same time, the concentration of Hyg was increased in the medium in a gradient manner, and the amount of Hyg (10mg/L) was increased from 0 to 40. mu.L/200 mL. Transferring the hairy root sample after the antibiotic adjustment to 1/2MS-Hyg liquid culture medium for amplification culture, and replacing fresh culture medium every 2-4 weeks for about 45 days.

Extracting genome DNA from fresh hairy root material at-20 deg.C with plant DNA extraction kit, and storing the extracted DNA sample at-20 deg.C. And (3) identifying the DNA sample by using the identification primer. In addition, since all hairy root material has rolB or rolC gene and the vector used has hygromycin resistance gene hpt, identification of both genes was performed simultaneously. Quickly freezing a part of the positive material by using liquid nitrogen at a speed of 100 mg/part, and storing at-80 ℃ for later use; drying the other part at 40 deg.C until the weight is not changed, grinding with ball mill, and storing in shade.

Taking fresh hairy root material to extract total RNA, detecting the RNA content by using nanodrop, carrying out quantitative reverse transcription to obtain cDNA, carrying out real-time quantitative PCR by taking the cDNA as a template to detect the expression condition of IiWRKY34 gene, wherein the used primers are shown in Table 3, and the identification result of the woolly isatis root is shown in figure 3 and figure 4, wherein a lane 1 of the figure 3 and figure 4 is marker, a lane 2 is positive control, and a lane 3 is blank control; FIG. 3, Lane 4 is empty carrier PHB, Lanes 5-11 are hairy root material with IiWRKY34 gene over-expression, sequentially OVX-1, OVX-2, OVX-3, OVX-4, OVX-5, OVX-6, OVX-7, OVX-8 and OVX-9; FIG. 4 shows an empty vector p1300 in lane 4, and the hairy root material of IiWRKY34 gene expression-inhibiting genes in lanes 5-11, which are RNAi-3, RNAi-4, RNAi-5, RNAi-6, RNAi-7, RNAi-8 and RNAi-2 in this order.

TABLE 3 PCR identification primers

Primer name	Sequence of	Numbering
			qPCR-WRKY34-F	gttaacaagagcaatatggccg	SEQ ID NO.6
qPCR-WRKY34-R	cccttgagactttctccttcacaa	SEQ ID NO.7
			Actin-F	atcctccgtcttgaccttgat	SEQ ID NO.8
Actin-R	tttcccgttctgctgttgtg	SEQ ID NO.9

The expression condition of the IiWRKY34 gene in each hairy root strain is shown in FIG. 5, and as can be seen from FIG. 5, the expression quantity of the IiWRKY34 gene is obviously reduced in an IiWRKY34 gene suppression expression material obtained by using an RNA interference technology; in contrast, the expression level of the gene in the obtained material for inducing over-expression of the IiWRKY34 gene is obviously increased.

Example 4

The IiWRKY34 gene has the regulation effect on lariciresinol:

extracting lariciresinol in hairy roots: precisely weighing the powder of each group of hairy roots, and adding the powder into the solution according to the proportion (100mg/10mL methanol); performing ultrasonic treatment for 30min or 15min for 2 times; taking 1mL of extract liquid in a centrifuge tube, and centrifuging for 10min at the maximum rotation speed; taking 700 mu L of supernatant, putting the supernatant into a new centrifugal tube, and volatilizing the solution by using a low-temperature concentrator; adding methanol with the same volume as the methanol, shaking and redissolving; centrifuging at the maximum rotation speed for 10 min; transfer 200. mu.L of supernatant to a vial for injection.

As shown in fig. 6, when the content of lariciresinol was measured in each group of hairy root material, it was found that the content of lariciresinol in the OVX group was significantly increased, and the content of lariciresinol was 5.6 times that of the wild type; the content of the lariciresinol in the RNAi group is obviously reduced by about 80 percent.

Example 5

The IiWRKY34 gene has the following effects on the regulation of the biomass of deciduous hairy roots:

referring to the results in FIG. 7, the hairy root material of each group is stably grown with the prolonged culture time, but the IiWRKY34 gene suppression expression group (RNAi) material is obviously found to be reduced by about 70% compared with the wild type blank control group (WT) and the empty vector control group (p 1300); the material biomass of the IiWRKY34 gene over-expression group (OVX) is obviously higher than that of the WT (about 3.7 times) and the empty vector control group (pHB); also the hairy root material biomass conditions presented in the erlenmeyer flasks shown in figures 8 and 9, are consistent with this result.

Example 6

The IiWRKY34 gene has a regulation effect on the lignification of deciduous hairy root materials:

taking a fresh hairy root sample, carrying out safranine fast green staining, making a paraffin section, and observing the tissue form of the cross section of the paraffin section; and (4) removing a fresh hairy root sample, carrying out phloroglucinol dyeing, and observing the dyeing condition. The results are shown in FIGS. 10 and 11: as a result of comparison of safranine fast green staining and phloroglucinol-concentrated hydrochloric acid staining, the lignification degree of the hairy root material of the IiWRKY34 gene suppression expression group (RNAi group) is found to be lower than that of the comparison group (the cross section is schematically shown to have less stained cell walls, and the material color is relatively lighter after phloroglucinol-concentrated hydrochloric acid staining); the lignification degree of the hairy root material of the IiWRKY34 gene over-expression group (OVX group) is far higher than that of the control group (the cross section is schematically shown to be stained with more red cell walls, and the material is relatively darker after phloroglucinol-concentrated hydrochloric acid staining).

From examples 4 to 6, it can be seen that the biomass of the material with IiWRKY34 gene expression inhibition is obviously reduced, the lignification degree is reduced, and the content of the lariciresin is also obviously reduced compared with the WT group; in contrast, the content of biomass, lignification degree and lariciresinol in the material with over-expression of the IiWRKY34 gene is obviously increased. This shows that the function of the IiWRKY34 gene in Isatis tinctoria is closely related to the growth and development of Isatis tinctoria, the expression level of the IWRKY34 gene can obviously influence the biomass of roots and the lignification degree of tissue cells in the roots, and the IWRKY34 gene is possibly involved in the formation process of lignans in the roots.

Example 7

Taking materials of different organ tissues of wild isatis tinctoria plants in flowering period, quickly freezing the materials by liquid nitrogen, and storing the materials at-80 ℃ for later use. Taking frozen material, extracting total RNA, detecting RNA concentration, and performing reverse transcription to obtain cDNA. The cDNA sample is used as a template to detect the expression condition of the IiWRKY34 gene.

The real-time quantitative PCR method is used for detecting the expression conditions of IiWRKY34 genes of different organ tissues of wild Isatis tinctoria plants in flowering period, and the expression conditions are shown in figure 12. The expression level of the IiWRKY34 gene in flowers is low, the expression level in roots, stems and leaves is relatively high, the expression level in leaves is relatively low, but the difference is not large, and the data of each group is not significantly different from the data in roots by using one-way anova.

Example 8

Wild type aseptic Isatis tinctoria seedlings of about 40 days are used as the experimental material for the stress resistance.

Artificially making a stress: drought conditions (PEG 2.5%), high salt environment (NaCl 200mM), other inducing factors (ASA, 100. mu.M; MeJA, 100. mu.M) were simulated and sprayed onto the leaves, with equal amounts of water for the control.

Collecting leaves 1h, 3h, 6h and 12h after spraying, quickly freezing with liquid nitrogen, and storing at-80 deg.C for use. Taking frozen material, extracting total RNA, detecting RNA concentration, and performing reverse transcription to obtain cDNA. The cDNA sample is used as a template to detect the expression condition of the IiWRKY34 gene.

The results of stress simulation experiments using aseptic Isatis Tinctoria seedlings as the material for investigation are shown in FIGS. 13 to 16: although the expression of the IiWRKY34 gene is different under different simulated stress conditions and at different treatment time points, the expression level of the IiWRKY34 gene is increased under all the treatment conditions. Under simulated drought conditions, the increase was significant around 6 hours (7.67 times for the 0 hour group) and decreased at 12 hours; in a high-concentration salt environment, the expression level is increased at 6 hours (24 times of the 0 hour group); in contrast, in the Salicylic Acid (SA) and methyl jasmonic acid (MeJA) induced group, the expression level of the IiWRKY34 gene increased at 1 hour (16.65-fold and 27.7-fold respectively in the 0 hour group), decreased at 3 hours (61.18% and 81.62% respectively in comparison with the 1 hour group), and increased at 6 hours (3.12-fold and 5.68-fold respectively in the 3 hour group).

Example 9

The use of an induced IiWRKY34 gene inhibited expression and over-expressed hairy root material.

Artificially making a stress: drought conditions (PEG 2.5%) were simulated, high salt environment (NaCl 75mM) was added to the medium, an equal amount of water was added to the control group, and hairy root material was collected for detection by dark culture for 3 days.

Taking fresh hairy root materials in the harvest period, diluting the ROS fluorescent probe by using 1/2MS liquid culture medium according to the proportion shown in the specification, incubating the hairy root materials, observing the hairy root materials for 1.5-2 h under a fluorescent microscope, and exciting the hairy root materials by green light to be red.

Precisely weighing hairy root sample powder, processing according to the method shown in the specification, detecting the absorbance of the material by using an enzyme-labeling instrument, and calculating the content of Proline (PRO) in the material.

Precisely weighing hairy root sample powder, processing according to a method shown in a specification, detecting the absorbance of the material by using an enzyme-labeling instrument, and calculating the total antioxidant capacity of the material.

The results of stress simulation experiments using hairy root material are shown in fig. 17 to 20. Although the growth state of the hairy roots over-expressing IiWRKY34 has no obvious difference compared with the untreated group under salt and drought treatment, when the IIWRKY34 is inhibited, the hairy roots show obvious premature senescence under the salt and drought treatment, and the IWRKY34 expression is closely related to salt and drought stress resistance (as shown in figure 17).

In the ROS detection experiment (FIG. 18), the weaker the fluorescence intensity, the stronger the stress resistance of the material. The fluorescence intensity of the material excessively expressing IiWRKY34 gene in the untreated control group and the drought treatment group and the salt treatment group is weaker than that of the control group, while the fluorescence intensity of the gene expression inhibition group is obviously enhanced in the drought treatment group and the salt treatment group.

In the test of total antioxidant capacity of hairy root material (fig. 19), TEAC was used as a reference for the antioxidant capacity of the material, and the higher the value, the stronger the antioxidant capacity. The graphs show that the total antioxidant capacity of IiWRKY34 gene over-expression materials in the untreated control group, the drought treatment group and the salt treatment group is greater than that of the wild control group (1.48 times, 2.48 times and 3.56 times respectively), and the total antioxidant capacity is significantly different; and the total antioxidant capacity of the material for inhibiting the expression of the IiWRKY34 gene is not changed or reduced obviously compared with that of a wild control group.

In the proline content assay (fig. 20), higher proline content and higher total antioxidant capacity indicate higher stress resistance. In the drought treatment group and the salt treatment group, the proline content of the IiWRKY34 gene overexpression material is greater than that of the wild control group WT (1.05 times and 1.25 times respectively), while the proline content of the IiWRKY34 gene suppression expression material is less than that of the wild control group WT (19.8 percent and 12.63 percent respectively). In conclusion, the IiWRKY34 gene is involved in the stress resistance of the isatis tinctoria plant.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Shanghai medical university

<120> application of IiWRKY34 in regulation and control of Isatis Indigotica lignan biosynthesis and stress tolerance reaction

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 909

<212> DNA

<213> Isatis tinctoria (Isatis indigotica Fortune)

<400> 1

atggaccagt actcatcgtc tttggtcgat acttctttag atctcactat cggtgttact 60

cgtatgcgag ttgaagaaga ttccacgaca agtgcattgg tggacgaatt aaaccgagtg 120

agtgctgaga acaagaagct ctcggagatg ctaactttga tgtgtgagaa ctacaacgtc 180

ttgaggaaac agctgttgga atatgttaac aagagcaata tggccgagag agaacaaatt 240

agtcctccca agaaacgcaa atctccggcg agagatgacg caattagttc ggcggttatc 300

ggtggagtgt ccgagagtag ctctacggat caggatgatc agtatctgtg taagaagcag 360

agagaagaga ctgttgtgaa ggagaaagtc tcaagggttt attacaagac cgaagcttct 420

gacactaccc ttgttgtgaa agatgggtat caatggagga aatatggaca gaaagtgact 480

agagacaatc cctctccaag agcttacttc aaatgtgctt gtgctccaag ctgttctgtc 540

aaaaagaagg ttcagagaag tgtggaggat cagtccgtgt tggtagcgac ttatgagggt 600

gaacataacc atccaatgcc gtcgcaggtc gattcaaaca gtggcttaaa ccgttacatc 660

tctattggtg gtccggctgc accagcagct gcatccaacg gaagtcgtag cttggctgag 720

cctgtgacta ccgttgatct gactgaatcc aagagagtga cgagcccatc aagaatcgat 780

tttccagaag ttcagaaact tttggtggaa caaatggctt cttccttgac taaggatcct 840

aacttcacag cagcattagc agcagctgtt acgggtagat tgtatcaaca gaatcaaacc 900

gagaaatag 909

<210> 2

<211> 30

<212> DNA

<213> Artificial sequence

<400> 2

aatgatcaat ggaccagtac tcatcgtctt 30

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence

<400> 3

aaactagttt tctcggtttg attctgttga 30

<210> 4

<211> 28

<212> DNA

<213> Artificial sequence

<400> 4

ccatgggtcg acttgtgctc caagctgt 28

<210> 5

<211> 28

<212> DNA

<213> Artificial sequence

<400> 5

ggtacctcta gaacagctgc tgctaatg 28

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<400> 6

gttaacaaga gcaatatggc cg 22

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence

<400> 7

cccttgagac tttctccttc acaa 24

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence

<400> 8

atcctccgtc ttgaccttga t 21

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence

<400> 9

tttcccgttc tgctgttgtg 20

Claims

1.IiThe WRKY34 gene is applied to the regulation and control of the synthesis of isatis indigotica lignans;

the above-mentionedIiThe open reading frame of the WRKY34 gene is a sequence shown as SEQ ID NO. 1.

2. Use according to claim 1, wherein the lignans comprise lariciresinol.

3. Use according to claim 1, characterized in that saidIiThe WRKY34 gene also regulates at least one of biomass, lignification degree and stress resistance of isatis indigotica.

4. The use according to claim 3, wherein the stress resistance includes drought stress resistance and high salt environment stress resistance.

5. The biomaterial is characterized by being selected from one or more of the following (n1) - (n 4):

(n1) containing the compound as described in any one of claims 1 to 4IiAn expression cassette of WRKY34 gene;

(n2) containing the compound as described in any one of claims 1 to 4IiA vector of the WRKY34 gene, or a vector containing (n1) the expression cassette;

(n3) containing the compound as described in any one of claims 1 to 4IiA recombinant microorganism of the WRKY34 gene, a recombinant microorganism containing (n1) the expression cassette, or a recombinant microorganism containing (n2) the vector;

(n4) containing the compound as described in any one of claims 1 to 4IiA cell line of WRKY34 gene, a cell line containing (n1) the expression cassette, or a cell line containing (n2) the vector.

6. A marker related to an Isatis tinctoria trait, which is selected from the group consisting of (a 1): the method as set forth in any one of claims 1 to 4IiWRKY34 gene;

(a2) contains the followingIiA fusion gene of WRKY34 gene;

(a3) the method comprises the following steps (a1) Or (a2) transcribed RNA;

(a4) the method comprises the following steps (a1) A protein expressed in any one of (a) to (a 3);

the trait includes lignan synthesis ability of isatis indigotica.

7. The marker according to claim 6, wherein the trait further comprises at least one of biomass, lignification degree and stress resistance of lignans.

8. A kit for detecting an Isatis tinctoria trait, which is characterized by detecting the marker according to claim 6 or 7;

the kit comprises a kit for amplifying Isatis tinctoriaIiThe primer pair of the WRKY34 gene has a sequence shown as SEQ ID NO.6 and a sequence shown as SEQ ID NO. 7.

9. A method for controlling an Isatis tinctoria trait, the method comprising overexpressing or repressing the expression of an Isatis tinctoria gene as defined in any one of claims 1 to 4IiWRKY34 gene;

the isatis tinctoria property comprises at least one of (b1) - (b4), and (b1) the synthesis capacity of lignans; (b2) biomass; (b3) degree of lignification; and, (b4) stress resistance.

10. The method of claim 9, wherein said overexpression comprises driving using a strong promoterIiExpression of WRKY34 gene.

11. The method of claim 10, wherein the strong promoter uses 35S.

12. The method of claim 9, wherein said inhibiting expression comprises contactingIiAn inverted repeat expression vector of WRKY34 gene is transformed into Isatis tinctoria to silenceIiExpression of WRKY34 gene.