CN116212053B

CN116212053B - Application of EAAT1/SLC1A3 inhibitor in preparation of medicines for treating liver cancer

Info

Publication number: CN116212053B
Application number: CN202310400412.3A
Authority: CN
Inventors: 闫居明; 邵斯旻; 胡静; 居晓曼; 袁东晨; 孙国伟
Original assignee: Xuzhou Medical University
Current assignee: Xuzhou Medical University
Priority date: 2023-04-14
Filing date: 2023-04-14
Publication date: 2023-10-17
Anticipated expiration: 2043-04-14
Also published as: CN116212053A

Abstract

The invention discloses an application of EAAT1/SLC1A3 inhibitor in preparing a medicine for treating liver cancer, wherein the EAAT1/SLC1A3 inhibitor is used as a new target point for treating liver cancer. The invention uses the inhibitor UCPH-101 of the specific targeting EAAT1/SLC1A3 and constructs a specific gene knockout system of the targeting SLC1A3, so that the expression of SLC1A3 in liver cancer cells is reduced or the function is blocked, the influence of SLC1A3 function blocking or gene knockout on the proliferation capacity of liver cancer cells is further evaluated, and the EAAT1/SLC1A3 is expected to be a new target point of liver cancer treatment, and the EAAT1/SLC1A3 inhibitor has the potential of being used as a liver cancer treatment drug.

Description

Application of EAAT1/SLC1A3 inhibitor in preparation of medicines for treating liver cancer

Technical Field

The invention belongs to the field of biological medicine, and in particular relates to an excitatory amino acid transporter 1 (EAAT 1)/solute carrier family 1member 3 (SLC 1A 3) inhibitor UCPH-101 and application of a targeted SLC1A 3gene in liver cancer treatment medicines.

Background

Liver cancer is one of the most common malignant tumors in the world, and the global incidence rate tends to rise year by year. The data show that about 39 tens of thousands of people die from liver cancer in China in 2020, and the death number is the second place of malignant tumor death in China. At present, early surgical excision is the most main and effective treatment means for liver cancer, but most patients often have subjective symptoms or medical diagnosis in late disease states, and delay the optimal treatment period, so that the prognosis survival rate of the patients is poor and the overall treatment effect is not ideal. In addition, although some progress has been made in therapeutic methods such as radiotherapy, interventional therapy and liver transplantation, the overall efficacy of the above-described methods has been unsatisfactory due to the side effects of radiotherapy and chemotherapy and the limitations of problems such as liver supply scarcity.

Tumor molecular targeted therapy is an important means for clinical tumor treatment as a novel therapy. The therapy takes the marker molecules of tumor cells as therapeutic targets, and the effective blocking agent is used for interfering each link of the canceration of the cells, such as inhibiting the proliferation of the tumor cells, interfering the cell cycle, inducing the differentiation of the cells, inhibiting the metastasis of the tumor cells, inducing the apoptosis of the tumor cells, inhibiting the generation of new blood vessels of the tumor and the like, so as to achieve the purpose of treating the tumor. Therefore, compared with the traditional tumor treatment means, the method has better accuracy, can selectively kill tumor cells, has low or no damage to normal tissues, has small side effect and is not easy to generate drug resistance. However, the bottleneck problem of the current treatment method is that the molecular targeting drugs for molecular targeting therapy are very limited, and the key reason is that the number of effective molecular targets is insufficient, so that a new specific molecular target needs to be searched.

Solute carrier family 1member 3 (the solute carrier family 1member 3gene,SLC1A3), commonly referred to as the aspartate transporter of glutamate/apartate tansporter, GLAST, also referred to as the excitatory amino acid transporter 1 (excitatory amino acid transporter 1, eaat 1), is an important excitatory amino acid transporter, expressed in various tissues and organs of animals, and has a major function of being responsible for the transport of glutamate and aspartate within and outside the cell membrane, and has important regulatory effects on learning, memory, central nervous system diseases and growth and development. SLC1A3 has recently been shown to be involved in tumor metabolism and tumor progression, and the data indicate that the SLC1A3 is abnormally expressed in various cancer tissues and can be used as a tumor marker of glioblastoma, chondrosarcoma, colorectal cancer, gastric cancer and the like, and is a potential tumor therapeutic molecular target.

Although there are studies that EAAT1/SLC1A3 is remarkably highly expressed in various cancer tissues and can be used as a potential tumor treatment target, the targeted SLC1A3 inhibits the expression of mRNA and protein levels thereof in hepatocellular carcinoma and the therapeutic effect of UCPH-101 inhibitor on liver cancer is not reported at present.

Disclosure of Invention

The invention aims at solving the problems in the prior art and provides an application of an EAAT1/SLC1A3 inhibitor in preparing medicines for treating liver cancer.

One of the purposes of the invention is to provide EAAT1/SLC1A3 as a new target point for treating liver cancer, and the application of the EAAT1/SLC1A3 inhibitor in preparing medicaments for treating liver cancer. The medicament may include the active ingredient of the inhibitor and a pharmaceutically acceptable carrier, e.g., a solvent, a recombinant carrier, etc. The EAAT1/SLC1A3 inhibitor is a substance for inhibiting the expression of EAAT1/SLC1A3, and comprises a chemical drug, a polypeptide/protein or a gene drug for inhibiting the expression of EAAT1/SLC1A 3.

The invention provides a new application of UCPH-101 as an EAAT1/SLC1A3 inhibitor, which is used for preparing a medicine for treating liver cancer and can act on liver cancer cells which highly express SLC1A3 genes.

UCPH-101 is a non-competitive inhibitor of human excitatory amino acid transporter 1 (EAAT 1), IC in vitro experiments ₅₀ A value of 0.66. Mu.M, a molecular weight of 422.48, molecular formula C ₂₇ H ₂₂ N ₂ O ₃ CAS number 1118460-77-7, has the following structural formula:

the invention further aims to provide a CRISPR/Cas9 gene knockout system targeting SLC1A3, wherein the CRISPR/Cas9 gene editing system has any one or two sgRNA sequences shown in SEQ ID NO 1-2, and the CRISPR/Cas9 gene editing system is used for treating liver cancer by effectively inhibiting the expression level of SLA1A3 in liver cancer cells.

Drawings

FIG. 1 is a graph showing the difference in the expression level of mRNA of SLC1A3 in cancer tissue (Primary Tumor) and paracancerous tissue (Normal) of a patient with hepatocellular carcinoma.

FIGS. 2a and 2b are schematic diagrams showing mRNA expression level and protein expression level of SLC1A3, respectively, in human hepatoma cells.

FIGS. 3a and 3b show the effect of the EAAT1/SLC1A3 inhibitor UCPH-101 on the proliferation potency of HepG2 and Huh7 cells, respectively, at different treatment concentrations.

FIG. 4 is a backbone diagram of the pX458 vector.

FIGS. 5a and 5b are schematic diagrams showing the mRNA expression level and the protein expression level of SLC1A3 from HepG2 SLC1A3 KO cells, respectively.

FIG. 6 is a graph showing the effect of gene level inhibition of SLC1A3 expression on HepG2 cell proliferation potency.

FIGS. 7a and 7b show the effect of gene level inhibition of SLC1A3 expression on the clonality of HepG2 cell colonies.

Detailed Description

The invention is further described in connection with the following embodiments in order to make the technical means, the creation features, the achievement of the purpose and the effect of the invention easy to understand.

UALCAN is an interface-friendly interactive cancer transcriptome data analysis platform that is built on the basis of PERL-CGI and high quality graphics using Java and CSS language, providing users with convenient access to published cancer transcriptome data (TCGA, MET500, CPTAC and CBTTC databases), providing additional information about selected genes and Targets according to HPRD, geneCards, pubmed, targetScan, human Protein Atlas, DRUGBANK, open Targets and GTEx.

As shown in FIG. 1, the analysis by the UALCAN data analysis platform shows that the mRNA expression level (Transcript per million) of SLC1A3 in cancer tissues (Primary Tumor) of a hepatocellular carcinoma patient is obviously higher than that of Normal healthy human liver tissues or paracancerous tissues (Normal) of the hepatocellular carcinoma patient, namely, the expression of SLC1A3 in human hepatocellular carcinoma tissues or cells is up-regulated. This suggests that intervention in the expression of the SLC1A 3gene may be a new approach to liver cancer treatment.

In order to verify the assumption, the invention uses an inhibitor UCPH-101 specifically targeting EAAT1/SLC1A3 and constructs a specific gene knockout system targeting SLC1A3, so that the expression of SLC1A3 in liver cancer cells is reduced or the function is blocked, and the influence of SLC1A3 function blocking or gene knockout on the proliferation capacity of liver cancer cells is further evaluated.

In the present invention, the terms EAAT1 (excitatory amino acid transporter) and SLC1A3 (the solute carrier family 1 mm ber 3 gene) refer to the SLC1A 3gene or EAAT1 protein, or a homologue thereof, or a variant form having its biological activity, preferably the human SLC1A 3gene (gene ID in NCBI: 6507).

The experimental methods used in the following examples are all conventional methods unless otherwise specified; the reagents, materials, etc. used in the examples described below are commercially available unless otherwise specified.

The SLC1A3 inhibitor comprises a nucleic acid inhibitor, an antagonist, a down regulator, a blocker and the like, namely, the inhibitor can down regulate the expression level of SLC1A3 and inhibit the activity or function of a glutamic acid aspartic acid transporter (GLAST) or a perphenate amino acid transporter 1 (EAAT 1). Can be a compound, a chemical small molecule, a biological molecule. The biomolecules may be nucleic acid-level (including DNA, RNA) or protein-level.

In addition, the present invention includes means for targeted inhibition or down-regulation of gene expression by targeted gene editing using gene editing, which means and agents may also be used in the present invention to prepare SLC1A3 inhibitors.

Example 1

Culturing, amplifying and passaging liver cancer cells

HepG2 and Hep3B, huh7 of the human liver cancer cell line were selected and grown in DMEM medium.

The DMEM medium contains penicillin (100U/ml), streptomycin (100 mg/ml) and 10% Fetal Bovine Serum (FBS).

The cells were incubated at 37℃with 5% CO ₂ Culturing in a cell culture box.

Example 2

Detection of mRNA expression of SLC1A3 in human hepatoma cell

(1) Extraction of total RNA of liver cancer cells

When the human liver cancer cell lines HepG2 and Hep3B, huh7 are cultured in a 6cm culture dish to 80-90% fusion degree, the human liver cancer cell lines are washed for 2 times by PBS, 1mL of Trizol reagent is added to lyse cells, and the cells are transferred to an enzyme-free EP tube; adding 200 mu L of chloroform into an enzyme-free EP tube, fully vibrating and uniformly mixing for 15s, standing at room temperature for 5min, and then placing in a 4 ℃ ultracentrifuge for 15min at 12000 rpm; transferring the upper layer water phase containing RNA into a new enzyme-free EP tube, making corresponding mark, adding 500 μl isopropanol, shaking on a shaker, mixing well, and centrifuging at 12000rpm for 10min at 4deg.C; completely removing the supernatant, precipitating to obtain RNA, adding 1mL of 75% ethanol prepared in advance, mixing well on a shaker, and centrifuging at 7500rpm for 5min at 4 ℃ in an ultracentrifuge; completely removing the supernatant, air-drying the precipitate, adding 20 mu L of enzyme-free water, measuring the concentration and purity of RNA, labeling, and storing in an ultralow temperature refrigerator at-80 ℃.

(2) Reverse transcription into cDNA

The procedure was performed in accordance with instructions using the HiScript Q RT SuperMix for qPCR (+gDNA wind) kit from Norpraise, which was divided into two steps: the first step of removing genomic DNA from the total RNA obtained by the first step, taking 1. Mu.g of the total RNA, 4 XgDNA wind Mix 4. Mu.L, RNase-free ddH ₂ O was added to 16. Mu.L. The reaction solution is placed in a PCR instrument and incubated for 2min at 42 ℃. In the second step, reverse transcription reaction is carried out, 4 mu L of 5 xqRT Supermix II is directly added into the reaction solution, the reaction solution is placed in a PCR instrument for incubation at 50 ℃ for 15min and for incubation at 85 ℃ for 2min, and reverse transcriptase is inactivated, so that cDNA is obtained.

(3) qPCR analysis of mRNA expression level of SLC1A3 in human liver cancer cell

The reaction system of the kit ChamQ SYBR qPCR Master Mix of Norpran company is as follows: 2X ChamQ SYBR Qpcr Master Mix. Mu.L, SLC1A3 forward primer (5'-AGCAGGGAGTCCGTAAACG-3') 0.4. Mu.L, lncRNA-SLC1A3 reverse primer (5 '-AGCATTCCGAAACAGGTAACTTT') 0.4. Mu.L, cDNA 2. Mu.L, ddH ₂ O7.2. Mu.L, total volume 20. Mu.L.

The forward primer of the reference gene beta-action is as follows: 5'-CTGGAACGGTGAAGGTGACA-3', the reverse primer is: 5'-AAGGGACTTCCTGTAACAACGCA-3'.

The reaction conditions were as follows: pre-denaturation at 95℃for 30 s; denaturation at 95℃for 5s, annealing at 60℃for 30s and extension, 45 cycles. Melting curve analysis: values were obtained 1 time at 95℃for 15s and 60-95℃every 5 ℃.

Meanwhile, the internal reference beta-action gene is used as a calibration, the LightCycler 480System is used for qRT-PCR and data collection, and 2-delta Ct is used for data analysis. Finally, the mRNA expression level of SLC1A3 in the human liver cancer cell lines HepG2 and Hep3B, huh7 is calculated.

As a result, as shown in FIG. 2a, SLC1A3 was expressed in both HepG2 and Hep3B, huh7.

Example 3

Detection of protein expression condition of SLC1A3 in human hepatoma cell

(1) Extraction of liver cancer cell membrane protein

When the human liver cancer cell lines HepG2 and Hep3B, huh7 are cultured to 80-90% fusion degree in a 6cm culture dish, washing for 2 times by using PBS, collecting cells in an EP tube with the volume of 1.5mL, adding a proper amount of a membrane protein extracting solution GPCR buffer and a protein phosphatase inhibitor mixture, rotating and mixing for 1 hour at the temperature of 4 ℃, centrifuging for 10 minutes at the temperature of 12000rpm at the temperature of 4 ℃, discarding the precipitate, transferring each group of supernatants into the EP tube with the marked number, and continuously inserting the supernatants into ice to prevent protein degradation; the protein concentration of each group of cells is measured by using a Biyundian BCA protein concentration measuring kit, and after the protein concentration of each group of cells is adjusted to be consistent, a protein sample and a 5×loading buffer are mixed according to a ratio of 4:1, the protein sample can be frozen at the temperature of minus 20 ℃ and stored for standby or directly subjected to immunoblotting (Western blot) detection.

(2) Polyacrylamide gel electrophoresis (SDS-PAGE electrophoresis) of proteins

Preparing SDS-PAGE gel with separation gel concentration of 8%, placing the gel into an electrophoresis tank, adding 1 XSDS electrophoresis buffer solution, adding 20 μl of each group of protein sample into gel hole, and adding 5 μl of protein Marker into the other hole for marking the size of protein molecule. Then, electrophoresis was performed with a constant concentration gel pressure of 80V and a separation gel pressure of 120V, and the electrophoresis time was determined according to the size of the desired protein molecule.

(3) Transfer printing

And cutting a PVDF film with proper size according to the size of the glue, and soaking the PVDF film in absolute methanol for 3min for activation. Pouring the 1X transfer printing liquid into a clean transfer printing groove, and simultaneously placing the sponge used for transfer printing and the sheared filter paper into the transfer printing liquid for soaking. Removing electrophoresis frame, taking out SDS-PAGE protein gel from glass plate, assembling transfer clamp according to the sequence of sponge-2 layers of filter paper-albumin gel-PVDF film-2 layers of filter paper-sponge (clamping plate negative electrode to positive electrode), ensuring no bubble between every two layers, preventing incomplete combination of PVDF film and protein gel, mounting the transfer structure on transfer frame according to the color corresponding to positive electrode and negative electrode, simultaneously placing ice block, placing into wet transfer tank, filling transfer buffer solution into transfer tank, covering cover, and placing the whole device into foam ice box with ice block. Constant current 250mA, transfer 3 hours.

(4) 5% skim milk seal

Preparing 5% milk by TBST, putting the milk into a washed incubation box, taking out the transferred PVDF film, cutting the upper left corner of the front surface of the PVDF film to a proper size of the incubation box, and soaking the PVDF film in the 5% milk; then slowly shaking on a shaking table, and sealing for 2 hours at room temperature, and then incubating with the primary antibody.

(5) Incubation of primary antibody and secondary antibody

Taking SLC1A3 and an internal reference antibody, referring to the concentration of a specification, diluting the primary antibody with 5% milk according to a proper proportion, and uniformly mixing; the membrane is put into incubation, and incubated overnight at 4 ℃ in a refrigerator; taking out PVDF membrane the next day, recovering primary antibody to-20deg.C, storing in refrigerator, and repeatedly washing the membrane with TBST for 3 times each for 10min; preparing HRP coupling secondary antibody with proper concentration by using 5% milk, adding the secondary antibody into an incubation box containing a PVDF film, and incubating for 1 hour at room temperature; recovering the secondary antibody, storing in a refrigerator at-20deg.C, and repeatedly washing the membrane with TBST for 3 times each for 10min.

(6) ECL chemiluminescence

The Biosharp ECL chemiluminescent substrate kit was used as per solution a: liquid B equals 1:1 preparing a proper amount of ECL luminous solution, dripping the ECL luminous solution on the front surface of a PVDF film, then putting the PVDF film into a Bio-Rad ChemiDoc Touch series full-automatic chemiluminescence imaging system, and detecting the protein expression condition of SLC1A3 in each group of human hepatoma cells.

As a result, the SLC1A3 protein of HepG2 and Hep3B, huh7 cells showed high expression on average as shown in FIG. 2 b.

Hep3B cells have opposite trend of mRNA and protein levels, and HepG2 and Huh7 cells with high mRNA and protein levels are selected for subsequent research.

Example 4

UCPH-101 treated liver cancer cell proliferation experiment

Liver cancer cell lines HepG2, huh7 were routinely cultured in DMEM medium containing 10% fetal bovine serum. HepG2, huh7 were digested with pancreatin, washed 2 times with 2ml PBS, and counted accurately. 1000 cells/100. Mu.l/well were plated in 96-well plates and incubated overnight. After the number of cell attachment, UCPH-101 was treated with various concentrations of UCPH-101 including 0. Mu.M, 10. Mu.M, 30. Mu.M, 50. Mu.M for 24 hours, 48 hours and 72 hours. At each time point of detection, the original medium was removed from each group, 100. Mu.l of CCK 8-containing medium was added, and incubated at 37℃for 2 hours, and absorbance at 450nm (OD) was measured with a microplate reader

450nm)。

FIGS. 3a and 3b are graphs showing the effect of the EAAT1/SLC1A3 inhibitor UCPH-101 on the proliferation potency of hepatoma cells HepG2 and Huh7, respectively, and FIGS. 3a and 3b show that the EAAT1/SLC1A3 inhibitor UCPH-101 can effectively inhibit the proliferation potency of hepatoma cells.

EXAMPLE 5,

CRISPR/Cas9 technology for knocking out expression of SLC1A 3gene in HepG2

In order to further exclude the off-target effect of the EAAT1/SLC1A3 inhibitor UCPH-101, the target SLC1A 3gene is verified to be capable of effectively inhibiting proliferation of liver cancer cells, and the CRISPR/Cas9 technology is adopted to knock out expression of the SLC1A 3gene in HepG2 cells.

(1) Sequence design of SLC1A 3gene sgRNA

Human SLC1A3 genomic sequence (accession NC_ 000005.10) was downloaded from NCBI website, knockdown target sites were designed using the website http:// crispr. Mit. Edu/first and third exons of the gene, and sgRNA target sequences were: GCACAAAAGCATTCCGAAAC (shown as SEQ ID NO. 1) and

GCGCTAGATAGTAAGGCATC (SEQ ID NO. 2), the corresponding fitting primer sequences (2 complementary DNA sequences corresponding to the 2 specific sequences shown in SEQ ID NO.1 and SEQ ID NO.2 are shown in SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6) are designed according to the position of the BbsI restriction enzyme nicking site in the pX458 plasmid. Single-stranded SEQ ID No.3 and SEQ ID No.4 are capable of annealing to form the complementary DNA sequence of double strand, SEQ ID No.5 and SEQ ID No.6 being identical. The correspondence between the specific sequence and the complementary DNA sequence is shown in Table 1. And finally, sending the designed sequence to a biological company for synthesis.

Correspondence between the specific sequences and the complementary DNA sequences shown in Table 1

(2) Construction of pX458 targeting vector

The pX458 vector backbone is shown in fig. 4.

Preparing an enzyme digestion system according to Table 2, placing the system in a water bath kettle at 37 ℃ for enzyme digestion for 4 hours after the preparation, performing 1% agarose gel electrophoresis after enzyme digestion, and recovering and purifying the enzyme digestion product containing the sticky end according to the Tiangen agarose gel DNA recovery kit.

TABLE 2 PX458 Table of the cleavage System

Preparing an Oligo annealing system according to the actual dosage of Table 3, placing the Oligo annealing system in a PCR instrument, denaturing for 5min at 95 ℃, taking out the annealing system, placing in a room temperature environment, and then cooling to room temperature, thus obtaining the annealed product double-stranded DNA molecule.

TABLE 3 Oligo annealing System Table

The ligation system of the annealed product and the digested pX458 plasmid was prepared and ligated overnight at 16℃according to the ligation system table of Table 4.

TABLE 4 connection System Table

Adding 10 mu L of the connection product into DH5 alpha escherichia coli competent cells, uniformly mixing, carrying out ice bath for 20min, carrying out heat shock conversion at 42 ℃ for 90s, carrying out ice bath for 3-5 min, adding 950 mu L of sterile LB culture medium (1% tryptone, 0.5% yeast extract and 1% sodium chloride) incubated at 37 ℃, carrying out shake culture for 1h at 37 ℃ and 180rpm/min, uniformly coating 100 mu L of bacterial liquid on ampicillin-resistant solid LB culture medium (containing 100 mu g/mL of ampicillin), and carrying out inversion culture for 12-16 h at 37 ℃ in an incubator overnight. The two ligation products were named pX458-SLC1A 3T 1 and pX458-SLC1A 3T 2, respectively.

Respectively picking up colonies of pX458-SLC1A 3T 1 and pX458-SLC1A 3T 2 on an LB plate, culturing in 1mL of liquid LB medium containing 100 mug/mL ampicillin, shaking at 180rpm until the medium is turbid, extracting plasmids, sending the plasmids to a company for sequencing, and using a universal primer U6-renylian of the sequencing company as a sequencing primer, wherein the sequence is as follows: 5'-ATGGACTATCATATGCTTACCGTA-3' (SEQ ID NO. 7).

Amplifying and culturing the pX458-SLC1A 3T 1 and pX458-SLC1A 3T 2 with correct sequence, extracting plasmids, and storing in a refrigerator at-20 ℃.

(2) Construction of HepG2 cell line for stably knocking out SLC1A 3Gene

HepG2 cells were cultured to 80-90% confluency, washed 2 times with PBS, then digested into single cells with 0.25% pancreatin, the pancreatin was aspirated, the digestion was stopped with DMEM medium, and then the cells were blown with a pipette added to DMEM medium and mixed well. Diluting cells to appropriate concentration according to cell concentration, sucking 10. Mu.L of diluted cell suspension, counting with a blood cell counting plate, adding 2×10 cells in a 6-well cell culture plate ⁵ Cells were plated onto six well plates at 5% CO ₂ Culturing in a cell culture incubator.

When cells were adherent and confluence reached 70-90%, pX458-SLC1A 3T 1 and pX458-SLC1A 3T 2 plasmids were transfected with Lipo2000 as per kit steps at 1:1 ratio mix transfection into HepG2 cells while simultaneously transfecting px458 plasmid as control, 37 ℃, 5% CO ₂ After culturing in an incubator for 48 hoursThe plasmid transfected cells were observed for Green Fluorescent Protein (GFP) expression.

When the number of GFP positive cells of the KO group and the control group is more than 60% -80%, washing each group of cells with precooled PBS for 2 times, then digesting the cells into single cells with 0.25% pancreatin, re-suspending the single cells in 200 mu L of culture medium, and passing through a 200-mesh cell screen to a sterile cell flow tube to prepare each group of single cell suspensions. FACS Aria iii sorting flow cytometer was set up according to instructions to the machine, appropriate voltage and target cell cycle gate were set up, all GFP positive cells of KO group and control group were sorted, and HepG2 SLC1A3 KO group and HepG2 KO NC group were named, respectively. The sorted cells were then re-inoculated into 48-well plates, observed for GFP expression at 24 hours after adherence, and sorted success was detected. And then expanding and culturing GFP positive cells of each group, and carrying out subsequent experiments after freezing and preserving the seeds.

Example 6

mRNA expression level detection of SLC1A3 in HepG2 SLC1A3 KO cells

When HepG2 SLC1A3 KO and KO NC cells were cultured to 80-90% confluency, total RNA of each group of cells was extracted, inverted into cDNA as in example 2, and mRNA expression levels of SLC1A3 in HepG2 SLC1A3 KO cells and KO NC control group cells were analyzed by qPCR.

As shown in fig. 5a, mRNA expression level of HepG2 SLC1A3 KO cells significantly decreased to 5% compared to KO NC control cells.

Example 7

mRNA expression level detection of SLC1A3 in HepG2 SLC1A3 KO cells

When HepG2 SLC1A3 KO and KO NC cells were cultured to 80-90% of fusion, cell membrane proteins of each group were extracted as in example 2, and protein expression levels of SLC1A3 in HepG2 SLC1A3 KO cells and KO NC control cells were detected by Western blot after protein concentration measurement and sample preparation.

As shown in FIG. 5b, the protein expression level of the HepG2 SLC1A3 KO cell was significantly down-regulated compared with the KO NC control cell, while the expression level of the reference protein beta-Actin protein was substantially consistent in both groups of cells.

And combining the result of the mRNA expression level to determine that the SLC1A 3gene in the HepG2 SLC1A3 KO cell is knocked out successfully, and the method can be used for subsequent experiments.

Example 8

Proliferation assay of HepG2 SLC1A3 KO cells

HepG2 SLC1A3 KO and KO NC cells were cultured to 80-90% confluency, washed 2 times with PBS, respectively, and then the cells were digested into single cells with 0.25% pancreatin, and single cell suspensions were prepared and counted accurately. 2000 cells/100. Mu.l/well were plated in 96-well plates, 6 duplicate wells were placed for each cell group, and cultured overnight. After the next day of cell attachment, the original medium was removed from each group at 3 time nodes of 24, 48 and 72 hours, 100. Mu.l of medium containing CCK8 was added, and the mixture was placed in a 5% CO2 incubator at 37℃for 2 hours, and after removal, the absorbance at 450nm (OD 450 nm) was measured by a microplate reader, and the absorbance values of each group were statistically analyzed.

Fig. 6 is a graph showing the effect of expression of SLC1A3 gene in HepG2 on HepG2 cell proliferation ability by knocking out using CRISPR/Cas9 technology, and it is understood from fig. 6 that inhibition of mRNA or protein level of SLC1A3 in human liver cancer cells is effective in inhibiting liver cancer cell proliferation.

Example 9

Cloning experiments of HepG2 SLC1A3 KO cells

Taking HepG2 SLC1A3 KO and KO NC cells in logarithmic growth phase, respectively washing the cells with PBS for 2 times, then digesting the cells into single cells with 0.25% pancreatin, sucking out the pancreatin, stopping digestion with a DMEM culture medium, and then adding the DMEM culture medium into a liquid transfer device to blow and mix the cells uniformly to prepare single cell suspension; after the two groups of cells are respectively counted, the cells are respectively inoculated into 6-hole cell culture plates for 1X 10 ³ 3 compound holes are respectively arranged on each cell, and after 3mL of culture medium is added, the cells are gently shaken to be uniformly dispersed; then the 6-well plate is placed at 37 ℃ and 5% CO ₂ Culturing in an incubator for 12-14 days, wherein frequent observation of the cell condition is taken, and when macroscopic cell clone appears in a 6-well plate, stopping cell culture; taking out 6-well plate, discarding supernatant of each group, carefully washing with PBS for 2 times, adding 2ml paraformaldehyde solution into each well to fix cells for 15-20 min, discarding the fixing solution, adding 2ml crystal violet staining solution for 20min, and recovering the junctionThe crystal violet staining solution is then washed off slowly with fine running water to remove excessive staining solution, and the solution is left at room temperature to dry a 6-hole plate; the 6-well plate was placed in a scanner for scanning and photographing, after which macroscopic cell clones in each set of multiplexed wells were counted and statistically analyzed.

As shown in fig. 7a and 7b, the HepG2 KO NC control group can form more clones than the HepG2 SLC1A3 KO group, and the numbers of the two groups of clones have significant differences, so that inhibition of the expression of the SLC1A3 gene in HepG2 cells can effectively inhibit the formation of cell clones.

In conclusion, the use of gene editing means to inhibit or down-regulate the expression of SLC1A3 in a targeted manner can also achieve a similar effect as the compound inhibitors, and such means and agents can also be used in the present invention to prepare SLC1A3 inhibitors.

In this specification, the invention has been described with reference to specific embodiments thereof. It will be apparent, however, that various modifications and changes may be made without departing from the spirit and scope of the invention. The specification and drawings are, accordingly, to be regarded in an illustrative rather than a restrictive sense.

Claims

Application of EAAT1/SLC1A3 inhibitor in preparing medicine for treating liver cancer is provided.
2. The use according to claim 1, wherein the EAAT1/SLC1A3 inhibitor is UCPH-101.
3. The use of claim 1, wherein the EAAT1/SLC1A3 inhibitor is a CRISPR/Cas9 gene editing system for knock-out of SLC1A3 for reducing EAAT1/SLC1A3 expression.
4. The use according to claim 3, wherein the sgRNA sequence in the CRISPR/Cas9 gene editing system is shown in SEQ ID NOs 1 to 2.
5. The use of claim 3, wherein said SLC1A3 is a human SLC1A3 gene.
6. The use according to any one of claims 1 to 5, wherein the medicament comprises an active ingredient which is an EAAT1/SLC1A3 inhibitor and a pharmaceutically acceptable carrier.