CN108888620B

CN108888620B - Novel application of compound KNK437

Info

Publication number: CN108888620B
Application number: CN201810563617.2A
Authority: CN
Inventors: 梁莉; 杨少珊; 胡金龙; 任小莉; 丁彦青
Original assignee: Southern Medical University
Current assignee: Southern Medical University
Priority date: 2018-06-04
Filing date: 2018-06-04
Publication date: 2021-05-18
Anticipated expiration: 2038-06-04
Also published as: CN108888620A

Abstract

The invention provides application of a compound KNK437 in preparation of a medicine for preventing and treating colorectal cancer. The invention constructs a colorectal cancer DNAJA1 overexpression cell strain, adopts a compound KNK437 for drug treatment, and detects the influence of the KNK437 on the in-vitro proliferation activity, the subcutaneous tumor formation capability and the spleen subcapsular injection liver transfer capability of colorectal cancer Mock cells and DNAJA1 overexpression cells, thereby providing a basis for the application of the KNK437 in the preparation of drugs for preventing and treating metastatic colorectal cancer. The compound KNK437 has the capability of obviously inhibiting the in vitro proliferation and subcutaneous tumor formation of colorectal cancer cells and the liver metastasis of spleen subcapsular injection, has no obvious toxic or side effect, and can be used for preparing the medicine for effectively inhibiting the proliferation and metastasis of colorectal cancer.

Description

Novel application of compound KNK437

Technical Field

The invention relates to a new application of a compound medicament, in particular to an application of a compound KNK437 in preparation of a medicament for preventing and treating digestive system tumors.

Background

With the improvement of living standard and the change of eating habit, the incidence rate of malignant tumor of digestive system is increased year by year and is in a trend of youthful. Colorectal cancer (CRC) is a common malignant tumor of the digestive system in our country. Metastasis is the leading cause of death in colorectal cancer patients, and distant metastasis has occurred in about 20% of colorectal cancer patients at the time of diagnosis, seriously threatening the life health of people. The protein assembly, secretion, transportation, protein degradation and transcription factor regulation in the cell are closely related to the proliferation, invasion, differentiation and metastasis of tumor cells. At present, the molecular mechanism of the occurrence and development of rectal cancer is not yet elucidated.

Heat Shock Protein (HSPs) family members are a class of protein polypeptides that can be classified according to molecular weight into HSP90, HSP70, HSP60, HSP40, and small HSP 27. The HSP40 family, also known as DNAJ family, is a molecular chaperone family under the heat shock protein family, and the DNAJ family members share a common feature in their structure, namely, a highly conserved amino acid-terminal J domain, a glycine/alanine rich domain, 4 CxxCxGxG zinc finger repeat domains, and a C-terminal substrate binding domain. The J domain is a marker domain of the DNAJ protein, which contains conserved histidine, proline and aspartic acid residues. DNAJA1 is one of the DNAJ family members, the J domain of which mediates the interaction of DNAJA1 with HSP70 to recruit substrates and modulate ATP hydrolytic activity. DNAJA1 is primarily responsible for regulating protein assembly, disassembly, and protein transport, but the role in colorectal cancer is not clear.

The compound KNK437 is a pan HSPs inhibitor, is low in toxicity, and is capable of inhibiting the synthesis of HSP40, HSP72 and HSP 105. The compound KNK437 was found to be capable of inhibiting the mRNA level of HSP70 and dose-dependently inhibiting cellular thermosensitivity. However, at present, the therapeutic effect of the compound KNK437 on the proliferation and metastasis of tumors in the digestive system is not reported.

Disclosure of Invention

In view of the above problems, one of the objects of the present invention is to provide a novel pharmaceutical use of the compound KNK 437.

In order to achieve the purpose, the invention provides the following technical scheme:

the application of the compound KNK437 in preparing medicines for preventing and treating digestive system tumors.

The structure of the compound KNK437 is shown as the formula (I):

in some of these embodiments, the tumor of the digestive system is colorectal cancer.

In some of these embodiments, the colorectal cancer is a type of cancer cell in which DNAJA1 is overexpressed.

Another object of the present invention is to provide an application, the specific technical solution is as follows:

the application of the compound KNK437 in preparing medicines for preventing and treating digestive system tumor metastasis diseases or tumors.

In some of these embodiments, the medicament is a medicament for preventing and treating a metastatic disease of colorectal cancer or a tumor.

In some of these embodiments, the colorectal cancer metastasis is liver metastasis of colorectal cancer.

In some embodiments, the medicament further comprises an anti-tumor compound in combination with the compound KNK 437.

In some of these embodiments, the anti-tumor compound is fluorouracil.

The invention also aims to provide a medicament for preventing and treating digestive system tumors, which has the following specific technical scheme:

a medicine for preventing and treating digestive system tumor contains compound KNK437 as active ingredient.

In some of these embodiments, the active ingredient further comprises fluorouracil.

Based on the technical scheme, the invention has the following beneficial effects:

the invention constructs a digestive system tumor colorectal cancer DNAJA1 overexpression cell strain, adopts a compound KNK437 to carry out drug treatment, and detects the influence of the KNK437 on the in-vitro proliferation activity, the subcutaneous tumor forming capability and the spleen subcapsular injection liver transfer capability of a colorectal cancer Mock cell and a DNAJA1 overexpression cell, thereby providing a basis for the application of the KNK437 to the preparation of drugs for preventing and treating metastatic colorectal cancer. The compound KNK437 has the capability of obviously inhibiting the in vitro proliferation and subcutaneous tumor formation of colorectal cancer cells and the liver metastasis of spleen subcapsular injection, has no obvious toxic or side effect, and can be used for preparing the medicine for effectively inhibiting the proliferation and metastasis of colorectal cancer.

The compound KNK437 can be combined with other antitumor drugs, has a remarkable colorectal cancer cell inhibition effect, and is one of hot approaches in drug research and development.

Drawings

FIG. 1 is the QPCR test result of detecting the expression level of DNAJA1 and the inhibition of the expression level of compound KNK437 in the overexpression model of DNAJA1 in colorectal cancer cells;

FIG. 2 is a Western blot experiment for detecting the expression level of DNAJA1 in an overexpression model of DNAJA1 in colorectal cancer cells and the inhibition result of a compound KNK437 on the expression level;

FIG. 3 is a CCK-8 cell proliferation experiment for detecting the in vitro proliferation capacity of the constructed colorectal cancer cells and the inhibition effect of a compound KNK437 on the in vitro proliferation capacity;

FIG. 4 is a subcutaneous tumor formation experiment for detecting the subcutaneous tumor formation ability of the constructed colorectal cancer and rectal cancer cell in nude mice, and the inhibition effect of the compound KNK437 on the subcutaneous tumor formation ability of the nude mice;

FIG. 5 shows that spleen subconjunctival injection liver metastasis experiments detect the liver metastasis capability of nude mice of colorectal cancer cells and the inhibition effect of a compound KNK437 on the liver metastasis capability of the nude mice.

Detailed Description

The invention provides a new medicine application of a compound KNK 437. The present invention may be embodied in many different forms and is not limited to the embodiments described herein. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various reagents used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The compound KNK437 used in the examples of the present invention was purchased from Selleck corporation and has cas number: s7750. The structural formula is as follows:

EXAMPLE 1 construction of SW480/DNAJA1 and DAJA1 and HCT116/DNAJA1 overexpressing cell strains

1. Cell culture: the cells were first revived in a 37 ℃ water bath and then inoculated into cell culture flasks. Cell culture 1640 medium containing 10% fetal bovine serum (FBS, Gibco, australia) was used. The conditions of the incubator are 37 ℃ and 5% CO₂。

2. Construction of DNAJA1 overexpression cell line: on the first day, SW480 and HCT116 cells were plated in 24-well plates, and the number of cells was about 2X 10⁴Adding complete culture medium 600 μ l/well, standing at 37 deg.C and 5% CO₂The incubator was overnight. The next day, 1ml of Enhance solution and 2. mu.l of polybrene solution were added to each well, 20. mu.l of Mock empty control or DNAJA 1-overexpressed lentivirus supernatant was added to SW480 and HCT116 cells, and the mixture was placed at 37 ℃ and 5% CO₂And (3) removing the original culture medium in the incubator for 8-12h on the third day, adding an RPMI 1640 complete culture medium, continuously incubating for 72h, observing the fluorescence condition of the cells under a mirror on the sixth day, carrying out amplification culture, extracting RNA and holoprotein, and detecting the expression of DNAJA1 by using fluorescence quantitative PCR and Western blot.

3. QPCR assay for expression of DNAJA 1: (1) extracting total RNA of cells, sucking out a culture medium in a culture bottle, washing the culture medium for 2 times by using precooled PBS, adding 1ml of TRIZOL, fully and uniformly blowing, transferring the liquid into a 1.5ml EP tube, adding 200 mul of trichloromethane, then violently shaking for 15s to purify the RNA, standing and layering, centrifuging for 5min at 12000rpm at 4 ℃, carefully sucking a supernatant, transferring the supernatant into a new EP tube, adding isopropanol with the same volume, gently and uniformly mixing, standing for 10min at room temperature, centrifuging for 10min at 4 ℃, 12000rpm, discarding the supernatant, adding 1ml of 75% ethanol prepared by DEPC water into the EP tube, washing the obtained precipitate, centrifuging for 5min at 4 ℃, 12000rpm, discarding the supernatant, air drying, adding an appropriate amount of DEPC to dissolve the precipitate, measuring the concentration of the RNA and the A260/280 value by using an ultraviolet spectrophotometer, and freezing the RNA at-80 ℃ for later use.

(2) The reverse transcription reaction was performed in a 10. mu.l system by adding 2. mu.l of reverse transcription buffer, 0.5. mu.l of reverse transcriptase, 0.5. mu.l of OligodTprimer (50. mu.M), 0.5. mu.l of Random6mers (100. mu.M), 500ng of RNA, ddH using RNase₂And (3) supplementing the oxygen to 10 mu l, preparing the mixed solution, centrifuging to remove bubbles, reacting for 15min at 37 ℃ on a PCR instrument, performing fire-extinguishing enzyme at 85 ℃ for 5s to obtain cDNA, and placing at-20 ℃ for later use.

(3) The cDNA obtained above was dissolved on ice in a fluorescent quantitative PCR reaction GAPDH upstream primer 5 ' ACAGCCCGCAGGATCAGGAAA3 ' (seq.id No.1), downstream primer 5 ' AACACGCTTCACGGGCACTC3 ' (seq.id No.2), DNAJA1 upstream primer 5 ' CCTTCATTTGGATTCTTATCAGG3 ' (seq.id No.3), downstream primer 5 ' GAGCCAAAACCACCACCTGC3 ' (seq.id No.4), and prepared using TAKARA's qPCR kit according to the following system: SYBR 10. mu.l, forward primer 0.4. mu.l, reverse primer 0.4. mu.l, ROX DYEII 0.4. mu.l, cDNA 2. mu.l, DEPC water 6.8. mu.l.

The qPCR reaction conditions were: pre-denaturation at 95 ℃ for 10min, 15sec at 95 ℃, 30sec at 60 ℃, 34sec at 72 ℃ for 40 cycles. As a result, the relative expression amounts of the respective genes in the respective samples were calculated by CT value method. The relative expression quantity of the gene is calculated according to a 2-delta Ct formula by the data.

The results are shown in FIG. 1, and FIG. 1A shows the expression of DNAJA1 in constructed SW480/Mock, SW480/DNAJA1, SW480/DNAJA1/KNK437 cells detected by QPCR assay. The figure shows that the expression level of DNAJA1 in the constructed SW480/DNAJA1 cell is obviously higher than that of the SW480/Mock cell, and the compound KNK437 can obviously reduce the expression level of DNAJA1 in the SW480/DNAJA1 cell. FIG. 1B shows the expression of DNAJA1 in the constructed HCT116/Mock, HCT116/DNAJA1, HCT116/DNAJA1/KNK437 cells detected by QPCR assay. The figure shows that the expression level of DNAJA1 in the constructed HCT116/DNAJA1 cell is obviously higher than that of the HCT116/Mock cell, and the compound KNK437 can obviously reduce the expression level of DNAJA1 in the HCT116/DNAJA cell.

4. Western blot: collecting Mock and DNAJA1 over-expression cells treated with KNK437 for different periods of time, extracting total Protein with whole Protein extraction Kit (Friedel biological Co., Ltd. Hangzhou), quantifying Protein with BCA Protein Assay Kit from Bio-Rad, boiling for denaturation.

SDS-PAGE electrophoresis: the constant voltage of the concentrated gel is 100V, the constant voltage of the separation gel is 120V, and the target protein can run out.

Film transfer: the Tenon micro electro transfer system 200MA performs film transfer.

And (3) sealing: 5% skim milk was incubated for 1h at room temperature.

Applying a first antibody: DNAJA1 rabbit polyclonal antibody (1:1000, Abcam), HSP70 rabbit polyclonal antibody (1:500, GAPDH mouse monoclonal antibody, 1:5000, Proteintech), 4 ℃ were incubated overnight.

Applying a second antibody: HRP-labeled anti-rabbit and anti-mouse secondary antibodies (1:10000, Friedel biol. Ltd. Hangzhou) were incubated at room temperature for 1 h.

The ECL hypersensitive chemiluminescence reagent (Nanjing Kai-based Biotech development Co., Ltd.) was used to detect the bands.

As a result, the DNAJA1 overexpression plasmid is transfected in SW480 cell, KNK437 medicine is added for treatment, and DNAJA1 expression is obviously reduced when the transfection and KNK437 treatment are carried out for more than 36h, while HSP70 expression is not reduced; after DNAJA1 was overexpressed in SW480 cells, expression of DNAJA1 was significantly reduced in the KNK 437-treated group, while expression of HSP70 was not significantly changed, compared to the Mock control group and DMSO group.

The results are shown in FIG. 2, and FIG. 2A is a Western blot experiment for detecting the expression of DNAJA1 and HSP70 in SW480/Mock and SW480/DNAJA1 cells of the constructed colorectal cancer treated by KNK437 at different times. The figure shows that when KNK437 is simultaneously added into the constructed SW480/DNAJA1 cell to stimulate for more than 36h, the expression of DNAJA1 is obviously reduced, but the expression of HSP70 is not reduced. FIG. 2B shows the expression of DNAJA1 and HSP70 in the constructed SW480/Mock and SW480/DNAJA1 cells of colorectal cancer detected by Western blot experiment with KNK 437. The figure shows that KNK437 can significantly inhibit the expression level of DNAJA1 in constructed SW480/DNAJA1 cells, while the expression of HSP70 has no significant change.

Example 2 KNK437 inhibition of the in vitro proliferative Capacity of colorectal cancer SW480, HCT116 cells

Selecting SW480 and HCT116 cells with good growth state to be plated, performing transient transfection on Mock and DNAA 1 overexpression plasmids, culturing a DNAA 1 overexpression group in a complete culture medium and a KNK 437-containing culture medium for 24h respectively in a group 2, washing the group 2 with PBS for 2 times, digesting and centrifuging, removing the culture medium, adding serum-free air culture for reselection, counting, adding the cells into a 96-well plate according to the number of 1000 cells in each well, diluting the cells to 100ul with the complete culture medium in each well, dividing each treatment group into 5 duplicate wells, and simultaneously setting a blank control group only adding the culture medium. After 24h of plate laying, determining each empty OD value by a CCK-8 method, washing out a culture medium from each hole, adding 100ul of mixed liquor prepared by a complete culture medium and a CCK-8 reagent according to a ratio of 9:1, incubating at 37 ℃ for 2h, detecting the OD value at 450nm by an enzyme-labeling instrument, zeroing by taking a blank control group as a reference to obtain the OD value showing the cell proliferation capacity, taking the average value of 5 multiple holes in each group, carrying out the next detection round at an interval of 24h, continuously measuring for 5 days, and drawing a cell proliferation curve.

As a result, the proliferation activity of the SW480/DNAJA1 group cells was significantly enhanced compared with that of the SW480/Mock group cells, while the proliferation activity of the SW480/DNAJA1 group cells was significantly reduced after KNK437 treatment, and the difference was statistically significant.

As shown in FIG. 3, FIG. 3A shows the in vitro proliferation ability of the constructed colorectal cancer cells SW480/Mock, SW480/DNAJA1, SW480/DNAJA1/KNK437 tested by the CCK-8 cell proliferation assay. The figure shows that the in vitro proliferation capacity of the constructed colorectal cancer SW480/DNAJA1 is obviously greater than that of SW480/Mock group cells, and the compound KNK437 can obviously inhibit the in vitro proliferation capacity of SW480/DNAJA1 cells. FIG. 3B shows that CCK-8 cell proliferation experiments detect the in vitro proliferation capacity of the constructed colorectal cancer HCT116/Mock, HCT116/DNAJA1 and HCT116/DNAJA1/KNK437 cells. The figure shows that the in vitro proliferation capacity of the constructed colorectal cancer HCT116/DNAJA1 is obviously greater than that of HCT116/Mock group cells, and the compound KNK437 can obviously inhibit the in vitro proliferation capacity of the HCT116/DNAJA1 cells.

Example 3

Selecting colorectal cancer SW480/Mock and SW480/DNAJA1 cells with good growth states, respectively subculturing and expanding the cells, washing the cells by conventional PBS, digesting the cells by pancreatin, centrifuging the cells, then re-suspending the cells by PBS, subcutaneously injecting the SW480/Mock and SW480/DNAJA1 cells to the leg of a female nude mouse with the age of 4 weeks by using a 1ml injector, respectively carrying out intratumoral injection treatment by using a compound KNK437 of 20mg/kg/day and 100mg/kg/day when subcutaneous tumors are obviously visible after 1 week, and respectively recording the tumor volume and the final tumor weight.

The results are shown in FIG. 4, in which the subcutaneous tumorigenicity of nude mice of SW480/DNAJA1 group cells was significantly enhanced, and the tumor tissue masses were significantly larger in size and heavier in weight, compared to the SW480/Mock group cells; after the application of KNK437 to intratumoral injection treatment, the subcutaneous tumorigenicity capacity of nude mice of SW480/DNAJA1 group cells was significantly reduced, and the difference was statistically significant when the dose of the compound KNK437 was 20mg/kg/day and 100 mg/kg/day.

Example 4 KNK437 inhibition of spleen subconjunctival injection liver metastatic potential of colorectal cancer SW480 cells

Selecting good-growth-state colorectal cancer SW480/Mock and SW480/DNAJA1 cells, respectively subculturing and expanding, washing by conventional PBS, digesting the cells by pancreatin, centrifuging, then resuspending by PBS, counting, and then putting on ice for later use.

Injecting 4-week-old female nude mouse with 0.3% pentobarbital, anesthetizing, sterilizing in cell super clean bench, making abdominal incision, exposing spleen, and sucking 1 × 10 with insulin syringe⁵Injecting the cells under the splenic tunica of a nude mouse, pressing with a sterile cotton ball to stop bleeding after the injection is finished, suturing the wound, performing intraperitoneal injection drug therapy on the nude mouse 1 week after the operation, and dividing the nude mouse into 4 groups according to the types of drugs: SW480/Mock + DMSO group, SW 480/DNAA 1+ DMSO group, SW 480/DNAA 1+ fluorouracil (12.5mg/kg) group, SW 480/DNAA 1+ fluorouracil (12.5mg/kg) + KNK437(100mg/kg) group were injected 2 times per week, nude mice were sacrificed after 4 weeks of continuous administration, and liver tumor metastasis of nude mice in each group was examined.

FIG. 5 shows that spleen subconjunctival injection liver metastasis experiments detect the transfer capacity of nude mouse liver of constructed colorectal cancer cells SW480/Mock, SW480/DNAJA1 and SW480/DNAJA1/KNK 437. The figure shows that the liver transfer capacity of the constructed SW480/DNAJA1 is obviously greater than that of the SW480/Mock cell, and the compound KNK437 can obviously inhibit the liver transfer capacity of the SW480/DNAJA1 cell.

It is known that compared with SW480/Mock, the SW480/DNAJA1 group has obvious liver metastasis, and the compound KNK437 can be combined with fluorouracil and obviously inhibit colorectal cancer liver metastasis of nude mice.

The technical features of the above-mentioned embodiments can be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the following embodiments are not described, however, as long as there is no contradiction between the combinations of the technical features, the combinations should be considered as the scope of the present description.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> southern medical university

Novel application of <120> compound KNK437

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acagcccgca ggatcaggaa a 21

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aacacgcttc acgggcactc 20

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccttcatttg gattcttatc agg 23

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gagccaaaac caccacctgc 20

Claims

1. The application of the compound KNK437 in preparing a medicine for preventing and treating metastatic colorectal cancer; the colorectal cancer is a type of over-expression of DNAJA1 in cancer cells;

the cancer cells are SW480 cells or HCT116 cells.

2. The application of the compound KNK437 in preparing a medicine for preventing and treating diseases or tumors caused by metastatic colorectal cancer metastasis, wherein the colorectal cancer is a type of DNAJA1 overexpression in cancer cells, and the cancer cells are SW480 cells or HCT116 cells.

3. Use according to claim 2, wherein the colorectal cancer metastasis is liver metastasis of colorectal cancer.

4. The use according to claim 2, wherein said medicament further comprises an anti-neoplastic compound in combination with the compound KNK 437.

5. The use according to claim 4, wherein the anti-neoplastic compound is fluorouracil.