CN113355325A

CN113355325A - Preparation method and application of humanized ACE2 gene modified mouse embryonic stem cell model

Info

Publication number: CN113355325A
Application number: CN202110245653.6A
Authority: CN
Inventors: 陈捷凯; 孙骄杨; 吴光明; 吴凯昕; 匡俊企; 全雄志; 郭琳
Original assignee: Guangzhou Institute of Biomedicine and Health of CAS
Current assignee: Guangzhou Institute of Biomedicine and Health of CAS
Priority date: 2020-03-06
Filing date: 2021-03-05
Publication date: 2021-09-07
Anticipated expiration: 2041-03-05
Also published as: CN113355325B

Abstract

The invention relates to the field of biomedicine, in particular to a preparation method and application of a humanized ACE2 gene modified mouse embryonic stem cell model. The invention provides a sgRNA fragment sequence. The targeting vector containing the sgRNA fragment sequence can specifically target ACE2 gene, and can be used for preparing humanized ACE2 gene modified mouse embryonic stem cell models. The sgRNA fragment sequence of the invention has good target specificity and high efficiency of cutting target genes.

Description

Preparation method and application of humanized ACE2 gene modified mouse embryonic stem cell model

Technical Field

The invention relates to the field of biomedicine, in particular to a preparation method and application of a humanized ACE2 gene modified mouse embryonic stem cell model.

Background

Although 2019-nCoV is infected on cell models such as Vero E6 cells and the like for drug screening at the present stage, the unicity of the cell models is far from being compared with the advantages of animal models.

The experimental animal disease model is an indispensable research tool for researching the etiology and pathogenesis of human diseases, developing prevention and treatment technologies and treating medicines. Common experimental animals include mice, rats, guinea pigs, hamster (hamster), rabbits, dogs, monkeys, pigs, and fish, among others. However, there are still many differences in the gene and protein sequences between human and animal, and many human proteins are unable to bind to the homologous proteins of animals to produce biological activity, resulting in many clinical trials with results that are inconsistent with those of animal experiments.

With the continuous development and maturity of genetic engineering technology, human cells or genes are used to replace or replace endogenous homologous cells or genes of animals so as to establish a biological system or disease model closer to human beings and establish a humanized experimental animal model (humanized animal model1), which has provided an important tool for new clinical treatment methods or means. The gene humanized animal model is a Seiyin-big U-shaped yoyo model which is closer to human normal or mutation system and can be established in an animal body by utilizing a genetic manipulation technology to replace the similar genes of animals with human normal or mutation genes. The large-size animal has important application value, for example, the cell humanized mouse CN 107815468A 2/28 page model can be improved and promoted through gene humanization, and more importantly, the protein with human functions can be expressed or partially expressed in the animal body due to the existence of human gene segments, so that the clinical experimental difference of human and animal is greatly reduced, and the possibility of drug screening at the animal level is provided.

The 2019-nCoV, like SARS coronavirus, uses Angiotensin-converting enzyme 2 (ACE 2) as a key target for infecting human, wherein the 2019-nCoV can infect various mammals such as monkey, pig, rabbit, ferret, orangutan, etc. except mouse and rat besides human. For the drug screening of the 2019-nCoV infected by monkey, pig, rabbit and the like as animal models, the growth cycle is long, the size is large, the large-scale operation is difficult, and the mouse model which is relatively easy to operate on a large scale is not easy to be infected by the 2019-nCoV.

Disclosure of Invention

Because of the difference in gene sequence between human ACE2 and murine ACE2, there are reports in the literature: after virus infection, the human ACE2 has stronger sensitivity to SARS-CoV and more obvious pathological symptoms than the mouse ACE 2. Better animal models are urgently needed in the current clinical research.

Transgenic mice of hACE2 have been shown to infect 2019-nCoV and develop the characteristic pathogenic characteristics of lung tissue (https:// www.biorxiv.org/content/10.1101/2020.02.07.939389v3# disqus _ thread). However, the transgenic hACE2 mouse is a mouse model of systemically over-expressing hACE2 and cannot simulate the space-time tissue expression characteristics of ACE2, the humanized ACE2 mouse model is a mouse model of originally specifically expressing hACE2 at ACE2 sites, can simulate the expression characteristics of originally mACE2, has tissue specificity and more rigorously simulates the pathogenesis of human infection 2019-nCoV.

Therefore, the 2019-nCoV susceptible mouse humanized ACE2 animal model is prepared in a large scale by a method of expressing humanized ACE2 at the mouse Ace2 locus, and the application of drug screening, disease research and the like on the 2019-nCoV is realized.

One of the objectives of the present invention is to provide a specific nucleic acid fragment sequence.

Another object of the invention is to provide a sgRNA sequence specifically targeting ACE2 gene.

The invention also aims to provide a specific targeting vector targeting the ACE2 gene.

The invention also aims to provide an ACE2 gene humanized cell strain.

The invention also aims to provide a construction method of the ACE2 gene humanized cell strain.

The invention also aims to provide an ACE2 gene humanized cell strain.

Another object of the present invention is to provide a method for constructing a genetically humanized animal.

Still another object of the present invention is to provide a mouse embryonic stem cell model modified by humanized ACE2 gene.

In one aspect, the invention provides a nucleic acid fragment sequence shown as SEQ ID NO. 1 or SEQ ID NO. 2. The nucleic acid fragment sequence disclosed by the invention has better targeting specificity and better target gene cutting efficiency.

In some embodiments, the synthetic sequence is as set forth in SEQ ID NO:1 are respectively shown as SEQ ID NO. 4 and SEQ ID NO. 5. In some embodiments, the synthetic sequence is as set forth in SEQ ID NO:2 are respectively shown as SEQ ID NO. 6 and SEQ ID NO. 7.

In some embodiments, the nucleic acid is a sgRNA.

In some embodiments, the sgRNA fragment sequence targets a gene that is the animal ACE2 gene for site-directed cleavage of the ACE2 gene.

In some embodiments, the sgRNA fragment sequences are used to construct humanized animal models.

In some embodiments, the cleavage point of the sgRNA fragment sequence is located at exon1 of ACE2 gene of the animal.

In some embodiments, the cleavage point target is within 140bp of the 5' UTR of the animal ACE2 gene.

In some embodiments, the animal is a mammal.

In some embodiments, the mammal is a rodent.

In some embodiments, the rodent is a mouse.

In another aspect, the invention provides a targeting vector comprising a 5 'homology arm, a fragment of the human ACE2 gene, and a 3' homology arm; the targeting vector targets an animal ACE2 gene, and the animal ACE2 gene contains a cutting point corresponding to the sequence of the sgRNA fragment of

claim

1 or 2. The 5' homology arm is a 5' homology arm that is homologous to a 5' target sequence at the genomic locus of interest.

In some embodiments, the targeting vector is used to promote expression of a human gene of interest using an animal gene promoter after inserting the CDS sequence of a human ACE2 gene into the promoter and 5' UTR region sequences of an animal gene.

In some embodiments, the targeting vector further comprises a3 'homology arm, the 3' homology arm being a3 'homology arm homologous to a 3' target sequence at the genomic locus of interest.

In some embodiments, the 5 'homology arm sequence is set forth in SEQ ID NO 13 and the 3' homology arm sequence is set forth in SEQ ID NO 14.

In some embodiments, the CDS sequence of the ACE2 gene is shown in SEQ ID NO 10.

In some embodiments, the targeting vector further comprises the SV40 polyA sequence as set forth in SEQ ID NO. 12, the SV40 polyA sequence being located after the CDS sequence.

In some embodiments, the targeting vector further comprises the screening marker PGK-Puro.

In some embodiments, the animal is a mammal.

In some embodiments, the animal is a mouse.

In some embodiments, the targeting vector further comprises a pX330 vector.

In another aspect, the invention provides a DNA molecule encoding the sgRNA fragment sequence.

In another aspect, the invention provides a cell comprising the sgRNA fragment sequence or the targeting vector or the DNA molecule.

On the other hand, the invention provides application of the sgRNA fragment sequence in preparation of a gene humanized cell strain or a humanized animal model.

In some embodiments, the gene is ACE 2.

In some embodiments, the animal is a mammal.

In some embodiments, the animal is a rodent.

In some embodiments, the animal is a mouse.

In another aspect, the invention provides a method for constructing a humanized animal cell line, wherein the sgRNA fragment sequence is used in the method.

In some embodiments, the method comprises introducing a human gene of interest into an animal cell such that the gene of interest expresses the CDS of the full-length human gene of interest in situ within the animal cell.

In some embodiments, the gene of interest is ACE 2.

In some embodiments, the animal is a mammal.

In some embodiments, the animal is a rodent.

In some embodiments, the animal is a mouse.

In some embodiments, the cell is an embryonic stem cell.

In some embodiments, the methods use gene editing techniques for the construction of humanized animal cell models.

In some embodiments, the gene editing techniques include embryonic stem cell-based DNA homologous recombination techniques, CRISPR/Cas9 techniques.

In some embodiments, the gene editing technology is based on CRISPR/Cas9 gene editing technology for construction of ACE2 humanized animals.

In some embodiments, the construction method comprises the steps of: (1) constructing the targeting vector of claim 3; (2) introducing the constructed targeting vector and the vector connected with the sgRNA into an animal-derived embryonic stem cell; (3) and (3) culturing the embryonic stem cells in the step (2) into clones to obtain the embryonic stem cells.

In some embodiments, the animal is a mammal.

In some embodiments, the mammal is a rodent.

In some embodiments, the rodent is a mouse.

In another aspect, the invention provides an ACE2 gene humanized cell strain prepared by the method.

In some embodiments, the cell line is a humanized mouse embryonic stem cell, and the cell line can express the full-length ACE2 protein of a human after being specifically differentiated or prepared into a mouse model, and simultaneously reduce or eliminate the expression of the endogenous ACE2 protein.

In another aspect, the present invention provides a method for constructing a gene humanized animal model, comprising injecting the animal cell into an animal body.

In some embodiments, the method of constructing the humanized animal model comprises forming the animal cell into an individual animal by tetraploid compensation or blastocyst injection.

In another aspect, the present invention provides a humanized mouse obtained by a method for constructing a gene-humanized animal model, or a tissue, a body fluid, a cell, a disrupted product or an extract thereof of a descendant thereof.

The method successfully obtains the humanized ACE2 gene modified mouse.

In some embodiments, the humanized ACE2 genetically engineered mice express human ACE2 at the RNA level and are tissue specific.

In some embodiments, the humanized ACE2 genetically engineered mice express human ACE2 at the protein level and are tissue specific.

In some embodiments, the present studies show that mice genetically engineered with humanized ACE2 obtained using the methods of the present invention are susceptible to SARS-CoV-2. Therefore, mice susceptible to 2019-nCoV are successfully obtained, and a good animal model can be well provided for drug screening or other researches of 2019-nCoV. Has good practical significance.

In still another aspect, the invention provides the use of the humanized animal model or its progeny derived from the construction method in the manufacture of human antibodies, or as a model system for pharmacological, immunological, microbiological and medical research, or in the production and use of animal experimental disease models, for pathogenic research and/or for the development of new diagnostic and/or therapeutic strategies, or in screening, verifying, evaluating or studying ACE2 gene function, ACE2 antibodies, drugs against ACE2 targets, pharmacodynamic studies.

Drawings

FIG. 1 is a pX330 plasmid map.

FIG. 2 is a diagram showing the sequencing result of the construction of pX330-sgRNA 1.

FIG. 3 is a diagram showing the sequencing result of the construction of pX330-sgRNA 2.

FIG. 4 shows the result of verifying the cleavage efficiency of pX330-sgRNA 1-3.

FIG. 5 is a diagram showing the sequencing result of the construction of pX330-sgRNA 3.

Figure 6 is a schematic of a targeting strategy for humanized ACE 2.

FIG. 7 shows the sequencing results of the humanized ACE2 targeting vector.

FIG. 8 is a PCR identification chart of the three-fragment ligation in comparative example 1.

FIG. 9 is a PCR identification of humanized ACE2 mouse embryonic stem cell genotype.

FIG. 10 is a graph showing the results of PCR identification of the genotype of humanized ACE2 mouse embryonic stem cells after deletion of PGK-Puro.

FIG. 11 is a schematic diagram of the humanized ACE2 gene.

FIG. 12 shows a humanized ACE2 gene engineered mouse obtained by the present invention.

Figure 13 shows humanized ACE2 genetically engineered mice express human ACE2 at the RNA level and are tissue specific.

The tissue immunofluorescence results of fig. 14 show that human ACE2 is specifically expressed on protein in mouse tissues engineered with humanized ACE2 gene.

FIG. 15 shows that the humanized ACE2 gene engineered mice of the present invention are susceptible to SARS-CoV-2.

Detailed Description

The technical solutions of the present invention are further illustrated by the following specific examples, which do not represent limitations to the scope of the present invention. Insubstantial modifications and adaptations of the present invention by others of the concepts fall within the scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same definitions as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the preferred methods and materials being described in the detailed description.

As used herein, "a" and "an" refer to the definitions of grammatical indefinite articles, meaning "a", "an" or "a plurality" of "or" a plurality "(i.e.," at least one "). For example, "an element" means one or more of the elements.

"CDS" is an abbreviation for Coding sequence, "Coding sequence" refers to any nucleotide sequence used to encode a polypeptide product of a gene. In contrast, the term "non-coding sequence" refers to any nucleotide sequence that does not encode a polypeptide product of a gene.

The term "fragment" will be understood to refer to a nucleotide sequence that is shorter in length than the reference nucleic acid and comprises in common the same nucleotide sequence as the reference nucleic acid. Such nucleic acid fragments according to the invention can, if appropriate, be comprised in a larger polynucleotide, which fragments are constituents of the larger polynucleotide. Such fragments include, or alternatively consist of, oligonucleotides having a length in the range of at least 6, 8, 9, 10, 12, 15, 18, 20, 21, 22, 23, 24, 25, 30, 39, 40, 42, 45, 48, 50, 51, 54, 57, 60, 63, 66, 70, 75, 78, 80, 90, 100, 105, 120, 135, 150, 200, 300, 500, 720, 900, 1000, or 1500 consecutive nucleotides of a nucleic acid of the invention.

In this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements; i.e. open definition.

"corresponding" means that (a) a polynucleotide has a nucleotide sequence that is substantially identical or complementary to all or part of a reference nucleotide sequence, or a polynucleotide encodes an amino acid sequence that is identical to an amino acid sequence in a peptide or protein; or (b) a peptide or polypeptide having an amino acid sequence which is substantially identical to the amino acid sequence in a reference peptide or protein.

The term "downstream" refers to a nucleotide sequence located 3' of a reference nucleotide sequence. In particular, the downstream nucleotide sequence is generally related to the sequence following the transcription start point. For example, the translation initiation codon of a gene is located downstream of the transcription initiation site.

The term "upstream" refers to a nucleotide sequence located 5' to a reference nucleotide sequence. In particular, upstream nucleotides generally relate to sequences located 5' to a coding sequence or transcription initiation point. For example, most promoters are located upstream of the transcription start site.

"promoter" refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. Generally, the coding sequence is located 3' to the promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even include synthetic DNA fragments. It will be appreciated by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". Promoters that cause a gene to be expressed in a particular cell type are commonly referred to as "cell-specific promoters" or "tissue-specific promoters". Promoters that cause a gene to be expressed at a particular developmental or cellular differentiation stage are commonly referred to as "developmental-specific promoters" or "cell differentiation-specific promoters". A promoter that is induced and causes a gene to be expressed after exposing the cell to an agent, biomolecule, chemical, ligand, light or the like that induces the promoter or treating the cell with such an agent is generally referred to as an "inducible promoter" or a "regulated promoter". It will also be appreciated that, because in most cases the exact boundaries of the regulatory sequences are not yet fully defined, DNA fragments of different lengths may have the same promoter activity.

The term "5 'UTR" or "5' non-coding sequence" or "5 'untranslated region (UTR)" refers to a DNA sequence located upstream (5') of a coding sequence.

The terms "restriction endonuclease" and "restriction enzyme" refer to enzymes that bind to and cleave a specific nucleotide sequence within double-stranded DNA.

The term "vector" means a nucleic acid molecule capable of transferring a nucleic acid molecule to which it has been linked. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are capable of being integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. In addition, certain vectors are capable of directing the expression of genes to which they are operatively linked.

Some vectors the present invention referred to as "recombinant expression vectors" (or simply "expression vectors") refers to vectors, plasmids, or vehicles designed to enable expression of an inserted nucleic acid sequence upon transformation into a host. In general, expression vectors used in recombinant DNA techniques are often in the form of plasmids. The terms "plasmid" and "vector" are used interchangeably herein, as plasmids are the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.

The term "plasmid" refers to extra-chromosomal elements that often carry genes that are not part of the central metabolism of the cell, and are often in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, bacteriophage or nucleotide sequences from any source, linear, circular or supercoiled, single-or double-stranded DNA or RNA, many of which have been ligated or recombined into a unique construct capable of introducing into a cell a promoter fragment and DNA sequence for a selected gene product and appropriate 3' untranslated sequence.

A "targeting vector" or "targeting vector" is a DNA construct containing sequences "homologous" to endogenous chromosomal nucleic acid sequences that are contiguous with the desired genetic modification. The flanking homologous sequences (referred to as "homology arms") direct the targeting vector to a specific chromosomal location in the genome by virtue of the homology that exists between the homology arms and the corresponding endogenous sequence, and the desired genetic modification is introduced by a process referred to as "homologous recombination". "targeting vectors" and "targeting vectors" may sometimes be used in common. Targeting vectors are employed to introduce an insert nucleic acid into a target locus of a rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse, or hamster nucleic acid. The targeting vector comprises the insert nucleic acid and further comprises a 5 'homology arm and a 3' homology arm, which flank the insert nucleic acid. The homology arms flanking the inserted nucleic acid correspond to regions within the target locus of rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse, or hamster nucleic acid. For ease of reference, the corresponding homologous genomic region within the target genomic locus is referred to herein as the "target site". For example, the targeting vector may comprise a first insert nucleic acid flanked by first and second homology arms that are complementary to first and second target sites. Thus, the targeting vector thereby facilitates integration of the insert nucleic acid into the target locus of a rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse, or hamster nucleic acid via a homologous recombination event that occurs between the homology arms and complementary target sites within the genome of the cell.

In one embodiment, the target locus of the rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse, or hamster nucleic acid comprises a first nucleic acid sequence complementary to the 5 'homology arm and a second nucleic acid sequence complementary to the 3' homology arm.

The vector may be introduced into the desired host cell by methods known in the art, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosomal fusion), use of a gene gun or DNA vector transporter (see, e.g., Wu et al, 1992, J.biol.chem.267: 963-967; Wu and Wu,1988, J.biol.chem.263: 14621-14624; and Hartmut et al, Canadian patent application 2,012,311 filed 3.15.1990).

The term "transfection" refers to the uptake of exogenous or heterologous RNA or DNA by a cell. When foreign or heterologous RNA or DN has been introduced into a cell, the cell is "transfected" with such RNA or DNA. When the transfected RNA or DNA affects a phenotypic change, the cell is "transformed" by the exogenous or heterologous RNA or DNA. The transforming RNA or DNA may be integrated (covalently linked into) the chromosomal DNA that makes up the genome of the cell.

The term "homology" or "homologous" refers to sequences, e.g., nucleotide or amino acid sequences, having at least about 75% nucleotides or amino acids, at least about 80% nucleotides or amino acids, at least about 90-95% nucleotides or amino acids, e.g., greater than 97% nucleotides or amino acids, that are identical when optimally aligned and compared. Those skilled in the art will appreciate that for optimal gene targeting, the targeting construct should contain an arm that is homologous to the endogenous DNA sequence (i.e., a "homology arm"); thus, homologous recombination can occur between the targeting construct and the endogenous sequence being targeted.

As used herein, the homology arms and target sites (i.e., homologous genomic regions) are complementary to each other when the two regions share a sufficient level of sequence identity with each other, thereby serving as substrates for the homologous recombination reaction. "homology" refers to the identity or consensus identity of a DNA sequence to the corresponding or "complementary" sequence. The sequence identity between a given target site and the corresponding homology arm found on the targeting vector may be any degree of sequence identity that allows homologous recombination to occur. For example, the homology arm (or fragment thereof) of the targeting vector may share sequence identity with the target site (or fragment thereof) in an amount of at least 51%, 53%, 57%, 60%, 65%, 70%, 75%, 80%, 83%, 85%, 87%, 89%, 91%, 93%, 95%, 97%, 98%, 99% or 100% sequence identity, such that the sequences undergo homologous recombination. Furthermore, the complementary region of homology between the homology arm and the complementary target site can be of any length sufficient to facilitate homologous recombination at the cleaved recognition site. The homology arms thus have sufficient homology to the corresponding target sites within the genome of the cell for homologous recombination to occur. For ease of reference, homology arms are referred to herein as 5 'homology arms and 3' homology arms. The term relates to the relative positions of the homology arms and the inserted nucleic acid in the targeting vector.

In some embodiments, the homology arms of the targeting vector can have any length sufficient to facilitate a homologous recombination event with the corresponding target site, including, for example, at least 5-10kb, 5-15kb, 10-20kb, 20-30kb, 30-40kb, 40-50kb, 50-60kb, 60-70kb, 70-80kb, 80-90kb, 90-100kb, 100-110kb, 110-120kb, 120-130kb, 130-140kb, 140-150kb, 150-160kb, 160-170kb, 170-180kb, 180-190kb, 190-200kb or longer. As outlined in further detail below, targeting vectors may employ targeting arms of greater length. In a particular embodiment the sum of the 5 'homology arm and the 3' homology arm is at least 10kb or the sum of the 5 'homology arm and the 3' homology arm is at least about 16kb to about 100kb or about 30kb to about 100kb, and in other embodiments the sum of the 5 'homology arm and the 3' homology arm of ACE2 is about 10kb to about 150kb, about 10kb to about 100kb, about 10kb to about 75kb, about 20kb to about 150kb, about 20kb to about 100kb, about 20kb to about 75kb, about 30kb to about 150kb, about 30kb to about 100kb, about 30kb to about 75kb, about 40kb to about 150kb, about 40kb to about 100kb, about 40kb to about 75kb, about 50kb to about 150kb, about 50kb to about 100kb, or about 50kb to about 75kb, about 10kb to about 30kb, About 20kb to about 40kb, about 40kb to about 60kb, about 60kb to about 80kb, about 80kb to about 100kb, about 100kb to about 120kb, or about 120kb to about 150 kb.

Certain embodiments herein relate to humanized gene editing mammals whose genomes include polyribonucleic acid encoding the full length ACE2 protein of humans. For example, the polyribonucleotide is operably linked to a promoter polyribonucleotide. In some embodiments, the humanized gene editing mammal does not express all or part of the polyribonucleotide encoding the endogenous ACE2 protein of the humanized gene editing mammal, and the polyribonucleotide encoding the human ACE2 protein comprises a modification of the human ACE2 protein gene.

In some embodiments, the cell is a pluripotent cell, a non-pluripotent cell, a mammalian cell, a human cell, a non-human mammalian cell, a rodent cell, a mouse cell, a hamster cell, a non-human pluripotent cell, a rodent pluripotent cell, or a fibroblast or lung cell.

In some of the above methods, the cell is a primary cell or an immortalized cell. In some of the above methods, the rodent pluripotent cells are mouse or rat Embryonic Stem (ES) cells.

In some of the above methods, the animal cell or the human cell is a primary cell or an immortalized cell.

In some of the above methods, the animal cell or the human cell is a pluripotent cell. In some of the above methods, the animal pluripotent cells are mouse Embryonic Stem (ES) cells. In some of the above methods, the human pluripotent cell is a human Embryonic Stem (ES) cell, a human adult stem cell, a developmentally restricted human progenitor cell, or a human Induced Pluripotent Stem (iPS) cell.

In some embodiments, certain embodiments herein provide humanized gene-edited cells, particularly also isolated human and non-human totipotent or pluripotent stem cells, particularly mouse embryonic stem cells, capable of maintaining pluripotency following one or more in vitro continuous genetic modifications and capable of transmitting the targeted genetic modification to progeny via germline.

The term "embryonic stem cell" or "ES cell" as used herein includes any embryo-derived totipotent or pluripotent cell capable of promoting the development of an embryo upon introduction into the embryo. The term "pluripotent cell" as used herein includes undifferentiated cells that have the ability to develop into more than one type of differentiated cell. The term "non-pluripotent cell" includes cells that are not pluripotent cells.

In some of the above methods, the targeted gene editing simultaneously comprises deletion of an endogenous nucleic acid sequence at the genomic locus of interest or insertion of the nucleic acid at the genomic locus of interest.

In some embodiments, the genetic modification or gene editing comprises two or more modifications independently performed on a cell (e.g., a eukaryotic cell, a non-rat eukaryotic cell, a mammalian cell, a somatic cell, a non-human mammalian cell, a pluripotent cell, a non-human pluripotent cell, a human ES cell, a human adult stem cell, a developmentally-restricted human progenitor cell, a human iPS cell, a human cell, a rodent cell, a non-rat rodent cell, a rat cell, a mouse cell, a hamster cell, a fibroblast, or a Chinese Hamster Ovary (CHO) cell). The first modification may be achieved by electroporation or any other method known in the art. Subsequently, a second modification of the same cell genome is performed using a suitable second nucleic acid construct. The third modification may be achieved by second electroporation or any other method known in the art. In various embodiments, following the first genetic modification and the second genetic modification of the same cell, successive modifications (one genetic modification followed by another) such as a third genetic modification, a fourth genetic modification, a fifth genetic modification, a sixth genetic modification, and so forth may be achieved using, for example, sequential electroporation or any other suitable method known in the art (sequentially).

In some embodiments, the invention is a targeting vector homologous recombination method for gene editing, and insertion of exogenous nucleic acids into an endogenous genome.

In some embodiments, the insert nucleic acid comprises an insert or replacement of a eukaryotic, non-rat eukaryotic, mammalian, human, or non-human mammalian nucleic acid sequence with a homologous or orthologous human nucleic acid sequence.

In some embodiments, the given inserted polynucleotide may be from any organism, including, for example, a rodent, a non-rat rodent, a rat, a mouse, a hamster, a mammal, a non-human mammal, a eukaryote, a non-rat eukaryote, a human, an agricultural animal, or a domestic animal.

In particular embodiments, the insert nucleic acid may comprise a nucleic acid from rat, which may comprise a fragment of genomic DNA, a CDNA, a regulatory region, or any portion or combination thereof. In other embodiments, the insert nucleic acid may comprise a nucleic acid from a eukaryote, a non-rat eukaryote, a mammal, a human, a non-human mammal, a rodent, a non-rat rodent, a human, a rat, a mouse, a hamster, a rabbit, a pig, a cow, a deer, a sheep, a goat, a chicken, a cat, a dog, a leucovorin, a primate (e.g., marmoset, rhesus), a domestic or agricultural mammal, or any other organism of interest. As outlined in more detail herein, the inserted nucleic acids employed in the various methods and compositions can result in "humanization" of a target locus of interest.

In one embodiment, the genetic modification is the addition of a nucleic acid sequence. In one embodiment, the insert nucleic acid comprises a genetic modification in a coding sequence. In one embodiment, the genetic modification comprises a deletion mutation of the coding sequence. In one embodiment, the genetic modification comprises a fusion of two endogenous coding sequences. In one embodiment, the insert nucleic acid comprises an insert homologous or orthologous human nucleic acid sequence or replaces a eukaryotic, non-rat eukaryotic, mammalian, human or non-human mammalian nucleic acid sequence with it. In one embodiment, the insert nucleic acid comprises an insertion of or replacement of a mouse DNA sequence with a homologous or orthologous human nucleic acid sequence in the coding region of an endogenous mouse gene comprising the corresponding mouse DNA sequence. In one embodiment, the insert nucleic acid comprises an insertion of or replacement of a mouse DNA sequence with a homologous or orthologous human nucleic acid sequence in the coding region of an endogenous mouse gene comprising the corresponding mouse DNA sequence. In one embodiment, the hACE2 sequence is inserted at the EXON1 CDS start ATG site next to mache 2, using a targeting vector, against the mouse Ace2 site.

In one embodiment, the nucleic acid sequence of the targeting vector may comprise a genetically modified polynucleotide that when integrated into the genome will produce a region of the mammalian, human or non-human mammalian ACE2 locus, wherein the genetic modification at the ACE2 locus results in a decrease in ACE2 activity, an increase in ACE2 activity or an adjustment in ACE2 activity. In one embodiment, the ACE2 producing gene is completely replaced.

In one embodiment, the insert nucleic acid may comprise regulatory elements including, for example, promoters, enhancers, or transcriptions.

In some embodiments, the corresponding replacement region for a given inserted polynucleotide and/or mammalian, human cell, or non-human mammalian locus may be a coding region, an intron, an exon, an untranslated region, a regulatory region, a promoter, or an enhancer, or any combination thereof.

Provided herein are methods that allow for targeted integration of one or more polynucleotides of interest into a target locus, as outlined above, introduction of sequences, and the gene-editing cells produced thereby. "introduced" to present the sequence to the cell (polypeptide or polynucleotide) in a manner that allows the sequence to enter the interior of the cell.

Any cell from any organism can be used in the methods provided herein. In particular embodiments, the cell is from a eukaryote, a non-rat eukaryote, a mammal, a non-human mammal, a human, a rodent, a non-rat rodent, a rat, a mouse, or a hamster. In particular embodiments, the cell is a eukaryotic cell, a non-rat eukaryotic cell, a pluripotent cell, a non-human mammalian cell, a human pluripotent cell, a human ES cell, a human adult stem cell, a developmentally restricted human progenitor cell, a human induced pluripotent cell (iPS) cell, a mammalian cell, a human cell, a fibroblast, a rodent cell, a non-rat rodent cell, a rat cell, a mouse ES cell, a hamster cell, or a CHO cell.

In some embodiments, the cells employed in the methods have a DNA construct stably incorporated into their locus. "stably incorporated" or "stably introduced" refers to the introduction of a polynucleotide into a cell, whereby the nucleotide sequence is integrated into the genome of the cell and is capable of being inherited by its progeny.

In one embodiment, introducing one or more polynucleotides into a cell is mediated by electroporation, intracytoplasmic injection, viral infection, adenovirus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or via nucleofection (tm).

In one embodiment, the expression construct is introduced with the introduced nucleic acid.

In one embodiment, introducing the one or more polynucleotides into the cell may be performed multiple times over a period of time. In one embodiment, introducing the one or more polynucleotides into the cell may be performed at least two times over a period of time, at least three times over a period of time, at least four times over a period of time, at least five times over a period of time, at least six times over a period of time, at least seven times over a period of time, at least eight times over a period of time, at least nine times over a period of time, at least ten times over a period of time, at least twelve times over a period of time, at least thirteen times over a period of time, at least fourteen times over a period of time, at least fifteen times over a period of time, at least sixteen times over a period of time, at least seventeen times over a period of time, at least nineteen times over a period of time, or at least twenty times over a period of time.

In one embodiment, the targeting vector (containing the introduction nucleic acid) is introduced into the cell concurrently with the expression vector (containing the sgRNA).

In one embodiment, there is further provided a method for making a humanized non-human animal comprising: (a) modifying the genome of a pluripotent cell with a targeting vector comprising an insert nucleic acid comprising a human nucleic acid sequence to form a donor cell; (b) introducing the donor cell into a host embryo; and (c) inoculating the host embryo in a surrogate mother, wherein the surrogate mother produces progeny comprising the human nucleic acid sequence. In one embodiment, the donor cell is introduced into a host embryo at the blastocyst stage or at the pre-morula stage (i.e., 4-cell stage or 8-cell stage). In still further embodiments, the genetic modification can be transmitted via the germline.

In one particular embodiment, a method for making a humanized mouse is provided, the method comprising: (a) introducing a targeting vector containing an ACE2 gene fragment and an expression vector connected with sgRNA into a mouse embryonic cell to form a donor cell for gene editing; (b) introducing the donor cell into a mouse embryo; and (c) gestating the mouse embryo in a surrogate mother, wherein the surrogate mother generates progeny comprising the human ACE2 sequence.

Example 1 Ace2 Gene sgRNA1 and pX330-sgRNA plasmid construction

The sgRNA1 sequence was synthesized that recognized the target site.

sgRNA1 sequence (SEQ ID NO: 1): 5'-tactgctcagtccctcaccgagg-3'

Introducing BbsI enzyme cutting sites aiming at sgRNA sites to synthesize upstream and downstream annealing primers of the sgRNA for subsequent annealing experiments. The upstream and downstream single-stranded primer sequences for sgRNA1 were synthesized as follows:

upstream: 5'-caccgcttggcattttcctcggtga-3' (SEQ ID NO:4)

Downstream: 5'-aaactcaccgaggaaaatgccaagc-3' (SEQ ID NO:5)

The source of the pX330 plasmid: map of pX330 vector, see FIG. 1. The plasmid backbone was derived from vast-plasmid platform, cat # P0123.

The sgRNA annealing primers were annealed and then ligated to a pX330 plasmid (the plasmid was linearized with BbsI first), respectively, to obtain an expression vector pX330-sgRNA 1.

Specific ligation reaction systems are shown in table 1.

TABLE 1 ligation reaction System

sgRNA annealing product	1μL(0.5μM)
		pX330-sgRNA vector	1μL(20ng)
T4 DNA Ligase	1μL(5U)
		10×T4 DNA Ligase buffer	1μL
H₂O	Make up to 10 mu L

The reaction conditions are as follows: ligation was performed at 16 ℃ for more than 30min, transformed into 30. mu.L of TOP10 competent cells, 200. mu.L of plates plated for Amp resistance were plated, cultured at 37 ℃ for at least 12 hours, and 2 clones were selected and inoculated in LB medium (5mL) containing Amp resistance, and cultured at 37 ℃ with shaking at 250rpm for at least 12 hours.

Randomly selected clones were sent to a sequencing company for sequencing verification, the sequencing result is shown in fig. 2, and the correctly ligated expression vector pX330-sgRNA1 was selected for subsequent experiments.

Example 2 Ace2 Gene sgRNA2 and pX330-sgRNA2 plasmid construction

The sgRNA2 sequence was synthesized that recognized the target site.

sgRNA 2-sequence (SEQ ID NO: 2): 5'-cttggcattttcctcggtgaggg-3'

Introducing BbsI enzyme cutting sites aiming at sgRNA sites to synthesize upstream and downstream annealing primers of the sgRNA for subsequent annealing experiments. The upstream and downstream single-stranded primer sequences for sgRNA2 were synthesized as follows:

upstream: 5'-caccgtactgctcagtccctcaccg-3' (SEQ ID NO:6)

Downstream: 5'-aaaccggtgagggactgagcagtac-3' (SEQ ID NO:7)

The sgRNA annealing primers were annealed and then ligated to a pX330 plasmid (the plasmid was linearized with BbsI first), respectively, to obtain an expression vector pX330-sgRNA 2.

Specific ligation reaction systems are shown in table 2.

TABLE 2 ligation reaction System

sgRNA annealing product	1μL(0.5μM)
		pX330-sgRNA vector	1μL(20ng)
T4 DNA Ligase	1μL(5U)
		10×T4 DNA Ligase buffer	1μL
H₂O	Make up to 10 muL

Randomly selected clones were sent to a sequencing company for sequencing verification, the sequencing result is shown in fig. 3, and the correctly ligated expression vector pX330-sgRNA2 was selected for subsequent experiments.

Example 3 pX330-sgRNA cleavage efficiency identification

Mu.g of each of the pX330-sgRNA plasmids prepared in examples 1 and 2 was transfected into mouse embryonic stem cells by the method of Lipofectamine 3000 (Invitrogen, Cat. L3000001), and the specific transfection procedure was described in reference to Lipofectamine 3000 reagent. Two days after transfection, mouse embryonic stem cells were harvested and subjected to genome extraction using a cell genome extraction kit (Tiangen, DP 304-02). PCR upstream and downstream primers were then designed on both sides of the genomic cleavage site, and the extracted genome was subjected to PCR reaction using a Nodezak Phanta Max Super-Fidelity DNA Polymerase (SEQ ID NO:10)) with an upstream primer (5 arm-sgF: ggttttgatttggccataaaatgttagc (SEQ ID NO:10)) and a downstream primer (3 arm-sgR: attcccaggtccagtttcacctaag (SEQ ID NO: 11)). Then, the cleavage efficiency of pX330-sgRNA was verified by using T7 endonuclease I (T7E I) (Biolabs, M0302L), and in principle, T7 endonuclease I recognizes and cleaves incompletely paired DNA.

The specific operation steps of the T7 EI experiment are as follows:

the above-mentioned PCR products obtained by extracting genomes from cells transfected with each of pX330-sgRNA1 and pX330-sgRNA2 and amplifying the resultant products by 5arm-sgF +3arm-sgR were recovered (Tiangen, DP214-02), and 1. mu.g of the recovered PCR products were subjected to an annealing reaction as follows:

TABLE 3

PCR product	1μg
		Buffer
2	2μL
		H₂O	Make up to 20 mu L
Reaction conditions	Boiling in water bath for 10min, and naturally cooling

Then 1 mu L T7 endonuclease I was added to the annealed product to react at 37 ℃ for 30min, and then the gel was run directly for verification. The running results are shown in FIG. 4. The sgRNA1 and the sgRNA2 of example 1 and example 2 have stronger cleavage band brightness (the sgRNA1 can be cleaved into two bands of about 376bp and 581bp, and the sgRNA2 can be cleaved into two bands of about 371bp and 586 bp), and have higher cleavage efficiency.

Since the cleavage efficiency is mainly shown by the figure, in order to show the effect of the schemes of examples 1, 2, the cleavage efficiency of another sgRNA (designated as sgRNA3) is also listed in fig. 4.

The exemplified sgNRA 3 sequence (SEQ ID NO: 3): 5'-caagtgaactttgataagacagg-3'

The upstream and downstream single-stranded primer sequences for sgRNA3 were synthesized as follows:

upstream: 5'-caccgcaagtgaactttgataagac-3' (SEQ ID NO:8)

Downstream: 5'-aaacgtcttatcaaagttcacttgc-3' (SEQ ID NO:9)

The rest of the procedure was as in example 1. Randomly selecting clones, sending the clones to a sequencing company for sequencing verification, and selecting a correctly connected expression vector pX330-sgRNA3 for subsequent experiments, wherein the sequencing result is shown in FIG. 5.

Since the construction of other sgrnas and pX330-sgRNA plasmids is not the focus of the present embodiment, it is not repeated or listed herein.

EXAMPLE 4 targeting vector design

Human ACE2 Gene (Gene ID:59272) CDS protein coding sequence (based on the transcript having NCBI accession No. NM-001371415.1 → NP-001358344.1, the CDS sequence is shown as hACE2-CDS SEQ ID NO:12, and the protein sequence is shown as hACE2-protein SEQ ID NO:13) was inserted into the promoter and 5' UTR region sequence of murine ACE2, and murine ACE2 promoter was used to promote human ACE2 Gene expression. Meanwhile, the inserted human ACE2 CDS sequence is added with SV40 polyA sequence signal (SV40-polyA sequence is shown as SEQ ID NO:14) termination signal to enhance the transcription stop of human ACE2 mRNA.

The hACE2-CDS sequence is as follows (SEQ ID NO: 12):

atgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttag

the sequence of hACE2-protein is as follows (SEQ ID NO: 13):

SV40 polyA sequence (SEQ ID NO: 14):

aacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatctta

based on the sequence design, the inventors further designed the targeting scheme shown in FIG. 6 and a vector comprising a 5 'homology arm (5arm), a fragment of the human ACE2 gene, and a 3' homology arm (3 arm). Wherein the 5 'homology arm is the 125683-126652 nucleotide of NCBI accession No. AC091606.8 (the 5' homology arm sequence is shown in SEQ ID NO:15), and the 3 'homology arm is the 126796-127766 nucleotide of NCBI accession No. AC091606.8 (the 3' homology arm sequence is shown in SEQ ID NO: 16). Meanwhile, the PGK-puromycin heterogenous gene package is also inserted into a vector for screening, and a pair of homodromous frt sites (SEQ ID NO:18) are designed at two ends of an expression frame of puromycin resistance gene (PGK-puro, SEQ ID NO:17), so that the puromycin resistance gene can be removed by using FLP recombinase to solve the safety problem caused by transgenosis. The constructed vector was subjected to complete sequence verification. Prior to targeting, the vector was linearized by AgeI (targeting vector schematic and targeting strategy schematic are shown in fig. 6).

5' homology arm sequence (SEQ ID NO: 15):

ccctatggagtggagaagagtcttataattttttaaatgggcagagaaatgaatttatttttaatttttagagacagggtttctttgtatagctctagctgtctttgattggtagacaaagctgtcctcaaactcagagatcttccttcctttgtctcctgagtgctgggattaaaggcatggaccaccactgccctgccccattctctccattaattttaagtgaatgcttgcaaaagctcacttctttggtgaacagcttcctttacaaataagtacctttgccttcgtttttataggattcttaaaaagaaaaaaaagattcagccaggtggttgtggtgcacacctttaatcccagcagtcaggaggcagaggaaagcagatctcttgagtttgaggctagcctagtctacagagggagttccaggacagccaaggctacagagaggaactgtctaaaaacaccaagaaagagagaaaggagagagggagaggatggatagcttattgatagaattgtcagaaaaggctataagttccaatatgtgtcccatgatttctaagtctagccctttctgttatagtaaaatcatagtacaccctcctcctccagtgtatctttaacagcttttaaggaacatattaactaaatgtccaggttttgatttggccataaaatgttagcaaagctaaggttttctaggattaatgaataacatgtctttatttagtttacttaaaaaaatcattctaaaatatctgtttacatatctgtcctctccaggattaacttcatattggtccagcagcttgtttactgttctcttctgtttcttcttctgctttttttttcttctcttctcagtgcccaacccaagttcaaaggctgatgagagagaaaaactcatgaagagattttactctagggaaagttgctcagtggatgggatcttggcgcacggggaaag

3' homology arm sequence (SEQ ID NO: 16):

Gaattataatactaacattactgaagaaaatgcccaaaagatggtaagttcttgaggctacccagggggttattgattgcttcttaaagatcagaattactgcctataaaactggataaggaaatcatagagatctctcaagtgtgaggatgagtgactgcctctgtagctctgatcctagtctcccagatggctaaattcaattgaccttagagttcatctggaaaattgttatgaatgaattatttgcccagattccaaagatgagtgaaaatgtttaataaagttgccatcactattctcattatatttggtatgtaaagcattcatggaaatgttctaagtcgttattgagccaataattttctttagcttataatgccaacaggtctatccgagaactacaaatgacatattaactgaaaaatgcaactggggtttactgaaggcagcagcttagtaattaaggtaaccatggcttaggtgaaactggacctgggaattccttctttcattgacacagagctctgaggaatttccaaaggtcacagaagaaaagctataattaaactagtcccaaaaaatctcagcctactctgggaaagcagcatattttgtttgacaagtgcaaggacttagaacttttttttttctcactgatcctgaagtgccttttaagtatagttaagtggtggaaaattgagcaactatttaagaaaagactcttttttttcttcttccagcaatgctttccttcaaaacggtagcttcaaaacttcctgtcttttaaatgatcagggggctgtgtgtttaaattattgccattcatagaacagagtgggtctgaggatgcctgtttcctttgaaattctatgccccctcccagttttctaaaatttaagaaaccacagagactttgacaatgtagttgccaaatgagttgcttttaactgctctaatagtttggtctt

PGK-puro sequence (SEQ ID NO: 17):

Gggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatcccccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacctgcagcccaagctagcttaccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctga

frt sequence (SEQ ID NO: 18): gaagttcctattctctagaaagtataggaacttc

The vector construction process is as follows:

designing an upstream primer (5 arm-pcrF: tcgcacacattccacatccaccggtccctatggagtggagaagagtctta (SEQ ID NO:19)) for amplifying the bridged fragment of the 5' homologous arm and a downstream primer (5 arm-pcrR: gaaggagccaggaagagcttgacatctttccccgtgcgccaagatcc (SEQ ID NO:20)) matched with the upstream primer;

designing an upstream primer (hACE 2-F: ggatcttggcgcacggggaaagatgtcaagctcttcctggctccttc (SEQ ID NO:21)) for amplifying a bridged fragment of the CDS of human ACE2 and a downstream primer (hACE 2-R: cattataagctgcaataaacaagttctaaaaggaggtctgaacatcatc (SEQ ID NO:22)) matched with the upstream primer;

designing an upstream primer (SV 40-F: gatgatgttcagacctccttttagaacttgtttattgcagcttataatg (SEQ ID NO:23)) for amplifying a bypass fragment of SV40 polyA and a downstream primer (SV 40-R: AGAGAATAGGAACTTCGCACGCGTtaagatacattgatgagtttggac (SEQ ID NO:24)) matched with the upstream primer;

an upstream primer (3 arm-pcrF: tacgaagttatGtcgacgcGGCGCGCCgaattataatactaacattactg (SEQ ID NO:25)) and a downstream primer (3 arm-pcrR: tatgaccatgattacgccaagcttaagaccaaactattagagcagttaaaagc (SEQ ID NO:26)) matching thereto were designed to amplify the 3' homology arm fragment. The amplification template of the 5 'homologous arm and the 3' homologous arm is C57BL6/J mouse genome, and the amplification template of human ACE2 is human lung cell cDNA. PCR reaction system (using Novozan Phanta Max Super-Fidelity DNA Polymerase) and conditions are shown in Table 4:

TABLE 4 PCR reaction System (50. mu.L)

Thus, the 5' homologous arm of the product fragment obtained by PCR amplification, human ACE2 CDS and SV40 polyA are subjected to PCR by using a bridging PCR (overlap PCR) method in combination with a Touch down PCR method to form a continuous fragment 5arm-hACE-SV 40; and recovering the 3 'homologous arm obtained by PCR amplification and directly using the recovered 3' homologous arm to construct a homologous recombination targeting vector, wherein the construction process comprises the following steps:

1. carrying out AgeI + MluI double enzyme digestion on the 5arm-hACE-SV40 fragment; and performing AscI and HindIII double enzyme digestion on the 3' homologous arm fragment, and then respectively connecting the fragment by an enzyme digestion connection method to obtain the targeting vector. 2. The obtained positive targeting vector is subjected to sequencing identification after enzyme digestion identification, and the sequencing company verifies that the sequence is correct (as shown in figure 7), so that the humanized ACE2 targeting vector is successfully obtained, and the sequence is as follows:

the entire targeting vector sequence (SEQ ID NO: 27):

tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgtaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggtccctatggagtggagaagagtcttataattttttaaatgggcagagaaatgaatttatttttaatttttagagacagggtttctttgtatagctctagctgtctttgattggtagacaaagctgtcctcaaactcagagatcttccttcctttgtctcctgagtgctgggattaaaggcatggaccaccactgccctgccccattctctccattaattttaagtgaatgcttgcaaaagctcacttctttggtgaacagcttcctttacaaataagtacctttgccttcgtttttataggattcttaaaaagaaaaaaaagattcagccaggtggttgtggtgcacacctttaatcccagcagtcaggaggcagaggaaagcagatctcttgagtttgaggctagcctagtctacagagggagttccaggacagccaaggctacagagaggaactgtctaaaaacaccaagaaagagagaaaggagagagggagaggatggatagcttattgatagaattgtcagaaaaggctataagttccaatatgtgtcccatgatttctaagtctagccctttctgttatagtaaaatcatagtacaccctcctcctccagtgtatctttaacagcttttaaggaacatattaactaaatgtccaggttttgatttggccataaaatgttagcaaagctaaggttttctaggattaatgaataacatgtctttatttagtttacttaaaaaaatcattctaaaatatctgtttacatatctgtcctctccaggattaacttcatattggtccagcagcttgtttactgttctcttctgtttcttcttctgctttttttttcttctcttctcagtgcccaacccaagttcaaaggctgatgagagagaaaaactcatgaagagattttactctagggaaagttgctcagtggatgggatcttggcgcacggggaaagatgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcgtgcgaagttcctattctctagaaagtataggaacttcatcgataccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatcccccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacctgcagcccaagctagcttaccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaggtacctctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatcgatgaagttcctattctctagaaagtataggaacttctaacctcccgggtgacagataacttcgtataatgtatgctatacgaagttatgtcgacgcggcgcgccgaattataatactaacattactgaagaaaatgcccaaaagatggtaagttcttgaggctacccagggggttattgattgcttcttaaagatcagaattactgcctataaaactggataaggaaatcatagagatctctcaagtgtgaggatgagtgactgcctctgtagctctgatcctagtctcccagatggctaaattcaattgaccttagagttcatctggaaaattgttatgaatgaattatttgcccagattccaaagatgagtgaaaatgtttaataaagttgccatcactattctcattatatttggtatgtaaagcattcatggaaatgttctaagtcgttattgagccaataattttctttagcttataatgccaacaggtctatccgagaactacaaatgacatattaactgaaaaatgcaactggggtttactgaaggcagcagcttagtaattaaggtaaccatggcttaggtgaaactggacctgggaattccttctttcattgacacagagctctgaggaatttccaaaggtcacagaagaaaagctataattaaactagtcccaaaaaatctcagcctactctgggaaagcagcatattttgtttgacaagtgcaaggacttagaacttttttttttctcactgatcctgaagtgccttttaagtatagttaagtggtggaaaattgagcaactatttaagaaaagactcttttttttcttcttccagcaatgctttccttcaaaacggtagcttcaaaacttcctgtcttttaaatgatcagggggctgtgtgtttaaattattgccattcatagaacagagtgggtctgaggatgcctgtttcctttgaaattctatgccccctcccagttttctaaaatttaagaaaccacagagactttgacaatgtagttgccaaatgagttgcttttaactgctctaatagtttggtcttaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtc

comparative example 1

The product fragment 5' homology arm obtained by PCR amplification, human ACE2 CDS, SV40 polyA, was PCR-converted into a continuous fragment 5arm-hACE-SV40 by the bridge-grafting PCR (overlap PCR) method, the PCR reaction conditions are shown in Table 5, and the other conditions were the same as in example 4.

TABLE 5 PCR reaction System (50. mu.L)

As a result, as shown in FIG. 8, the 3-segment ligated fragment could not be amplified.

Example 5 acquisition of humanized ACE2 mouse embryonic Stem cells

In one embodiment, humanized ACE2 mouse embryonic stem cells were obtained as follows:

recovering C57BL6/J mouse embryonic stem cells (the embryonic stem cells are derived from an established embryonic stem cell line) from a liquid nitrogen frozen cell bank, and particularly using the mouse embryonic stem cells with the passage number within p10 to culture and grow for 3 days in a 6cm culture dish.

By using the Nucleofector in a matching way^TMIIs/2b electric rotating instrument and Mouse ES Cell

Kit (Lonza, VPH-1001) mouse embryonic stem cell electrotransformation Kit, using A023 program, about 2X 10⁶Individual cells were electroporated and the electroporation process was performed in 100 μ L of electroporation buffer containing 3 μ g of linearized targeting vector and 1 μ g of pX330-sgRNA 1. The transfected cells were seeded into wells of 3 6-well plates and then recovered for 36 hours. After recovery, 1. mu.g/mL puromycin (Merck) was added to the cell culture medium.

After 3-4 days of selection, puromycin resistant mouse embryonic stem cell clones were picked and cultured in 96-well plates by aspirating single clones using glass draw needles. The following day the single clones were trypsinized and cultured in two aliquots, one of which cells was separately lysed in 10 μ L of NP40 lysis buffer at 56 ℃ for 60 minutes followed by 95 ℃ for 10 minutes.

The method comprises the following specific steps of mouse embryonic stem cell culture: feeder cells were prepared one day in advance, plated on different well plates as needed, and cultured overnight to form a monolayer. Wherein the feeder layer feeder cells are mouse embryonic fibroblasts prepared by mitomycin C (MMC) method treatment. Culturing with mES culture medium containing LIF and 2i (chicken 99021 and pD0325901inhibitor), replacing fresh culture medium every day, adding culture medium according to cell growth, generally passing through one generation for 3 days, digesting with 0.25% pancreatin during passage, and planting at a density of about 30 ten thousand on 6cm dish and 10 ten thousand on 6-well plate.

The mES + LIF +2i culture medium consists of: knockout DMEM (1X, gibco) + 15% FBS (FRONT BIOMEDICAL,0.22 μ M Millipore filter filtration) + GlutaMAX (100X, gibco) + NEAA (100X, gibco) + P/S (P:50units, S:50mg/ml, Hyclone) + β -mercaptoethanol (gibco, used at a concentration of 0.1mM) + LIF (1000units/ml, Millipore) + CHIR99021(GSK3 β inhibitor, used at a concentration of 3 μ M) + PD0325901(MEK inhibitor, used at a concentration of 1 μ M).

The composition of the NP40 lysate is: 10mL TE (20mM Tris pH8.0, 150mM NaCl, 2mM EDTA) + 0.5% NP40+ 10. mu.L proteinase K (10 mg/mL).

The method is characterized in that pX330-sgRNA1 is replaced by pX330-sgRNA2 or pX330-sgRNA3, and other steps are the same as the steps of pX330-sgRNA 1.

The targeting effect of pX330-sgRNA1, pX330-sgRNA2 and pX330-sgRNA3 in combination with targeting vectors is shown in Table 6.

TABLE 6 targeting effect of sgRNA1-3 with targeting vector (number of surviving clones)

pX330-sgRNA1	pX330-sgRNA2	pX330-sgRNA3
			231	187	43

Example 6 genotyping of humanized ACE2 mouse embryonic Stem cells

The cell lysate obtained last in example 5 was used as a template for genotyping PCR screening. PCR screening was performed by using Phanta Max Super-Fidelity DNA Polymerase reagent (Novosey Co.) according to the manufacturer's instructions. PCR analysis was used to target HDR with 5 'and 3' homology arms inserted into the mouse Ace2 site. Since the ACE2 gene is located on the X chromosome, the mouse embryonic stem cells used are XY males, so no biallelic targeting occurs.

The upstream of the directional insert primer was identified as being located within puromycin resistance (Puro-F: aacctccccttctacgagc (SEQ ID NO:28)), and the downstream of the primer paired with it was located outside the 3' homology arm (3 arm-outR: tacagccaggatctggatgtcagc (SEQ ID NO: 29)). If the insertion position of the recombinant vector is correct, a band with the length of 1504bp should appear. At the moment, the mouse embryonic stem cell Ace2 site genome sequence is replaced by SEQ ID NO: 30:

ccctatggagtggagaagagtcttataattttttaaatgggcagagaaatgaatttatttttaatttttagagacagggtttctttgtatagctctagctgtctttgattggtagacaaagctgtcctcaaactcagagatcttccttcctttgtctcctgagtgctgggattaaaggcatggaccaccactgccctgccccattctctccattaattttaagtgaatgcttgcaaaagctcacttctttggtgaacagcttcctttacaaataagtacctttgccttcgtttttataggattcttaaaaagaaaaaaaagattcagccaggtggttgtggtgcacacctttaatcccagcagtcaggaggcagaggaaagcagatctcttgagtttgaggctagcctagtctacagagggagttccaggacagccaaggctacagagaggaactgtctaaaaacaccaagaaagagagaaaggagagagggagaggatggatagcttattgatagaattgtcagaaaaggctataagttccaatatgtgtcccatgatttctaagtctagccctttctgttatagtaaaatcatagtacaccctcctcctccagtgtatctttaacagcttttaaggaacatattaactaaatgtccaggttttgatttggccataaaatgttagcaaagctaaggttttctaggattaatgaataacatgtctttatttagtttacttaaaaaaatcattctaaaatatctgtttacatatctgtcctctccaggattaacttcatattggtccagcagcttgtttactgttctcttctgtttcttcttctgctttttttttcttctcttctcagtgcccaacccaagttcaaaggctgatgagagagaaaaactcatgaagagattttactctagggaaagttgctcagtggatgggatcttggcgcacggggaaagatgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcgtgcgaagttcctattctctagaaagtataggaacttcatcgataccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatcccccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacctgcagcccaagctagcttaccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaggtacctctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatcgatgaagttcctattctctagaaagtataggaacttctaacctcccgggtgacagataacttcgtataatgtatgctatacgaagttatgtcgacgcggcgcgccgaattataatactaacattactgaagaaaatgcccaaaagatggtaagttcttgaggctacccagggggttattgattgcttcttaaagatcagaattactgcctataaaactggataaggaaatcatagagatctctcaagtgtgaggatgagtgactgcctctgtagctctgatcctagtctcccagatggctaaattcaattgaccttagagttcatctggaaaattgttatgaatgaattatttgcccagattccaaagatgagtgaaaatgtttaataaagttgccatcactattctcattatatttggtatgtaaagcattcatggaaatgttctaagtcgttattgagccaataattttctttagcttataatgccaacaggtctatccgagaactacaaatgacatattaactgaaaaatgcaactggggtttactgaaggcagcagcttagtaattaaggtaaccatggcttaggtgaaactggacctgggaattccttctttcattgacacagagctctgaggaatttccaaaggtcacagaagaaaagctataattaaactagtcccaaaaaatctcagcctactctgggaaagcagcatattttgtttgacaagtgcaaggacttagaacttttttttttctcactgatcctgaagtgccttttaagtatagttaagtggtggaaaattgagcaactatttaagaaaagactcttttttttcttcttccagcaatgctttccttcaaaacggtagcttcaaaacttcctgtcttttaaatgatcagggggctgtgtgtttaaattattgccattcatagaacagagtgggtctgaggatgcctgtttcctttgaaattctatgccccctcccagttttctaaaatttaagaaaccacagagactttgacaatgtagttgccaaatgagttgcttttaactgctctaatagtttggtctt(seq id no:30)

the PCR identification result is shown in figure 9, and 14 clones are identified together, wherein the marked asterisk is a positive clone, and the PCR products are matched with each other through the sequencing result. The mouse embryonic stem cell clone with positive PCR result is a successfully edited humanized mouse embryonic stem cell model, but a PGK-Puro screening mark is also reserved, and because two ends of the PGK-Puro have a pair of frt sites in the same direction, the FLP recombinase can be used for removing, thereby solving the safety problem caused by transgenosis.

The deletion method of the PGK-Puro screening marker is as follows:

continuously culturing the mouse embryonic stem cells with positive PCR result to a 6cm plate, and using a Nucleofector in a matching way^TMIIs/2b electric rotating instrument and Mouse ES Cell

Kit (Lonza, VPH-1001) mouse embryonic stem cell electrotransformation Kit, using A023 program, about 2X 10⁶The cells were electroporated and the electroporation process was performed in 100. mu.L of electroporation buffer containing pPGK-FLPo plasmid (Addgene, 13793). The transfected cells are planted in the holes of 6 12-hole plates, after 3 days, mouse embryonic stem cells are selected and cloned into a 96-hole plate for culture in a mode of drawing single clones by a glass pull needle, the single clone digestion and passage are divided into two parts on the next day, one part is screened by puromycin, and the other part is normally cultured. If the PGK-Puro resistance selection marker is successfully deleted, the cells after puromycin selection do not tolerate death. Puromycin-intolerant corresponding clones can be identified by genomic genotype PCR using an upstream primer (hACE 2-F: tgatagtggttggcattgt (SEQ ID NO:31)) and a downstream primer (3 arm-outR: tacagccaggatctggatgtcagc (SEQ ID NO: 29)). If the PGK-Puro screening marker is successfully deleted, the length of the PCR product is 1532bp, and the length of the PCR product before the PGK-Puro is deleted is 2863 bp. The genotype identification result is shown in FIG. 9, the place of the running glue strip at 1500bp is the clone after the PGK-puro is successfully deleted, and the place of the strip at 3000bp is the clone before deletion. The clones corresponding to the puromycin intolerance were the mouse embryonic stem cells that were finally successfully edited to target humanized ACE2, i.e., the mouse embryonic stem cells were finally obtained as shown in FIG. 10The humanized ACE2 gene is shown. The genomic sequence of the Ace2 site of the mouse embryonic stem cell is replaced by SEQ ID NO:32 after the final deletion of PGK-puro, as shown below:

ccctatggagtggagaagagtcttataattttttaaatgggcagagaaatgaatttatttttaatttttagagacagggtttctttgtatagctctagctgtctttgattggtagacaaagctgtcctcaaactcagagatcttccttcctttgtctcctgagtgctgggattaaaggcatggaccaccactgccctgccccattctctccattaattttaagtgaatgcttgcaaaagctcacttctttggtgaacagcttcctttacaaataagtacctttgccttcgtttttataggattcttaaaaagaaaaaaaagattcagccaggtggttgtggtgcacacctttaatcccagcagtcaggaggcagaggaaagcagatctcttgagtttgaggctagcctagtctacagagggagttccaggacagccaaggctacagagaggaactgtctaaaaacaccaagaaagagagaaaggagagagggagaggatggatagcttattgatagaattgtcagaaaaggctataagttccaatatgtgtcccatgatttctaagtctagccctttctgttatagtaaaatcatagtacaccctcctcctccagtgtatctttaacagcttttaaggaacatattaactaaatgtccaggttttgatttggccataaaatgttagcaaagctaaggttttctaggattaatgaataacatgtctttatttagtttacttaaaaaaatcattctaaaatatctgtttacatatctgtcctctccaggattaacttcatattggtccagcagcttgtttactgttctcttctgtttcttcttctgctttttttttcttctcttctcagtgcccaacccaagttcaaaggctgatgagagagaaaaactcatgaagagattttactctagggaaagttgctcagtggatgggatcttggcgcacggggaaagatgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcgtgcgaagttcctattctctagaaagtataggaacttctaacctcccgggtgacagataacttcgtataatgtatgctatacgaagttatgtcgacgcggcgcgccgaattataatactaacattactgaagaaaatgcccaaaagatggtaagttcttgaggctacccagggggttattgattgcttcttaaagatcagaattactgcctataaaactggataaggaaatcatagagatctctcaagtgtgaggatgagtgactgcctctgtagctctgatcctagtctcccagatggctaaattcaattgaccttagagttcatctggaaaattgttatgaatgaattatttgcccagattccaaagatgagtgaaaatgtttaataaagttgccatcactattctcattatatttggtatgtaaagcattcatggaaatgttctaagtcgttattgagccaataattttctttagcttataatgccaacaggtctatccgagaactacaaatgacatattaactgaaaaatgcaactggggtttactgaaggcagcagcttagtaattaaggtaaccatggcttaggtgaaactggacctgggaattccttctttcattgacacagagctctgaggaatttccaaaggtcacagaagaaaagctataattaaactagtcccaaaaaatctcagcctactctgggaaagcagcatattttgtttgacaagtgcaaggacttagaacttttttttttctcactgatcctgaagtgccttttaagtatagttaagtggtggaaaattgagcaactatttaagaaaagactcttttttttcttcttccagcaatgctttccttcaaaacggtagcttcaaaacttcctgtcttttaaatgatcagggggctgtgtgtttaaattattgccattcatagaacagagtgggtctgaggatgcctgtttcctttgaaattctatgccccctcccagttttctaaaatttaagaaaccacagagactttgacaatgtagttgccaaatgagttgcttttaactgctctaatagtttggtctt(seq id no:32)

example 7 formation of humanized ACE2 Gene engineered mice

1. 7.5 units PMSG were intraperitoneally injected into 4-10 week-old B6C3F1 female mice, hCG was injected 48 hours later and caged with CD1 male mice, female mice were examined the next morning for vaginal emboli and female mice with vaginal emboli were picked up, and the corresponding time of fertilization was recorded for the female mice.

2. The pregnant mouse was euthanized by cervical dislocation on the following day, the abdomen of the mouse was sterilized with 70% alcohol, the skin and muscle layer of the abdomen were cut with forceps and ophthalmic scissors, and the abdominal cavity was opened. Grasping the upper part of a uterine horn with forceps, making a small opening in the membrane near the fallopian tube with scissors, cutting the junction of the fallopian tube and ovary, transferring the fallopian tube and the attached uterus into a 35mm petri dish, fixing the orifice end of the fallopian tube with forceps, gently inserting the orifice with a washing needle filled with M2 culture solution (Hogan, B. (1994); Manipulating the mouse embryo: a Laboratory manual,2nd edn (Cold Spring Harbor, NY, Cold Spring Harbor Laboratory), washing the fallopian tube with 0.1mL of M2 culture solution, collecting the washed embryo with the transferred fallopian tube and washing 3 times with M2, and collecting the E1.5 mouse 2-cell embryo.

3. The collected mouse embryos were placed in a container containing 0.1mM MgSO4,0.1mM CaCl₂And 0.3% bovine serum albumin in 0.3M mannitol (Sigma-Aldrich Inc., St. Louis, Mo.) using a Cellfusion CF-150/B electrofusion apparatus and a 250-um fusion tank (BLS Ltd., Budapest, Hungary) for 60V 50 microsecond direct currentElectrofusion to obtain 4 ploid embryo; put into KSOM medium (Summers, M.C., McGinnis, L.K., Lawitts, J.A., Raffin, M., and Biggers, J.D (2000). IVF of mouse ovum supplemented with mouse amino acids. Hum repeat 15, 1791. supplement 1801) after culturing in CO2 incubator for 24 hours, clear zone was removed with acidic Taiwan liquid (Sigma-Aldrich, T1788), and aggregation with embryonic stem cells (i.e., humanized 2 mouse embryonic stem cells prepared in this application) to form chimeric embryos (Nagy, A., Rossant, J., Nagy, R., Abramow-New, W.and R., Roder, J.C. supplement (1993) supplement cell-culture of scientific cell-8490. native culture 8428. S. Sa-8428).

4. In CO₂Culturing in an incubator overnight, transplanting to the uterus of a pseudopregnant mouse with E2.5 days, performing laparotomy after eutrophy of a pseudopregnant mouse by cervical dislocation after 17 days, putting a living and breathing newborn mouse into a milk-substituting mouse cage, and weaning after 21 days to obtain a transgenic mouse completely derived from embryonic stem cells, namely a humanized ACE2 gene modified mouse (figure 12).

The corresponding media formulations are shown in table 7.

TABLE 7 culture Medium formulation

Example 8 verification of hACE2 expression in humanized ACE2 Gene engineered mice

Samples of small intestine, lung and kidney from one wild type mouse and one humanized ACE2 genetically modified mouse (prepared in example 7) were taken for RNA extraction and qPCR to verify hACE2 gene expression. Tissue samples were lysed by adding Trizol reagent. Adding 200 mul chloroform into each milliliter of Trizol lysate, violently shaking, standing until layering, repeating the operation for 3 times, centrifuging for 15min at 4 ℃ and 14000rpm, taking 400 mul of supernatant into precooled 400 mul isopropanol, reversing, uniformly mixing, standing for 5min on ice, centrifuging for 10min at 4 ℃ and 14000pm, and allowing white precipitate to be seen at the bottom of an EP tube, wherein the white precipitate is RNA.

Removing supernatant, adding precooled 70% ethanol solution, washing once, centrifuging, removing ethanol, drying RNA until colorless and transparent, adding a proper amount of RNase-free H2O according to the amount of precipitate, and carrying out water bath at 60 ℃ until complete dissolution. Mu.l of each was diluted 50-fold with 10mM Tris-HCl (pH 7.5) and H2O to determine the purity and concentration, and the OD260/280 was preferably about 2.0. The extracted RNA is stored at-80 ℃ and can be stored for a long time.

2. mu.g of RNA was inverted and shown in Table 8. The cDNA sample obtained by inversion is diluted 30 times and then is further used for fluorescent quantitative PCR detection of gene expression, hACE2 is used for detecting qPCR primers as follows (hACE 2-qF: GGTCTTCAGTGCTCTCAG (SEQ ID NO: 33); hACE 2-qR: GCATTCTTGTGGATTATCTGG (SEQ ID NO:34)), and the humanized ACE2 gene modified mouse can be seen to express human ACE2 at the RNA level and has tissue specificity (FIG. 13).

TABLE 8

In addition, small intestine, lung and testis tissues of a mouse modified by humanized ACE2 gene are taken to carry out immunofluorescence cathepsin level verification on the expression condition of human ACE 2. Mouse tissues were fixed in 4% PFA overnight at 4 ℃. The following day, tissues were rinsed 3 times in PBS and cryoprotected overnight in 30% sucrose in PBS at 4 ℃. Tissues were then incubated in 30% sucrose/PBS and o.c.t. at 1: 1 mixture for 2-4 hours. The embedding medium was frozen (Sakura, cat # 4583). Next, the tissue was transferred from the sucrose/OCT mixture into a cryogenic mold and filled with o.c.t. The embedded tissue was frozen on dry ice and then stored at-80 ℃ until cryostat section. Frozen organoid tissues were cut into 20 μm sections using a cryostat and collected on superfrost Ultra Plus slides. Sections were dried overnight and then used for immunofluorescence. 4% PFA was post-fixed directly on the slide for 10min at room temperature, then washed 3X10 times in PBS. The tissue region was outlined using a hydrophobic PAP pen. Blocking was performed with 5% BSA/0.3% TX100 in PBS with 0.05% sodium azide and incubation at room temperature for 30 min. The tissues were then incubated with anti-ACE 2 antibody (ET1611-58, Huabio) overnight at 4 ℃. After PBS washing, secondary antibodies (a11004, Invitrogen) were incubated for 1 hour, followed by DAPI for 2 minutes. Finally, when the cover glass was mounted on a slide glass for observation, it was found from the results of tissue immunofluorescence that human ACE2 was specifically expressed at the protein expression level in the tissue of humanized ACE2 genetically engineered mice (fig. 14).

Example 9 SARS-CoV-2 infection humanized ACE2 Gene modified mice

Humanized ACE2 genetically modified mice were inhaled 30 μ l DMEM containing 2X 10 by nasal drip⁶TCID₅₀SARS-CoV-2 with virus load, and 30. mu.l DMEM was added dropwise to the control group. The lung, airway and small intestine tissues of the infected mice were lysed with Trizol at D1, D3, D5, D6, D7 and D9, respectively, and RNA extraction and fluorescent quantitative PCR were performed to detect the SARS-CoV-2 virus titer, the RNA extraction method was the same as that of the above-described hACE2 expression detection example. The extracted tissue RNA will be used

Probe One-step qRT-PCR Kit (Toyobo) Kit detects the nucleoprotein N gene of SARS-CoV-2. The primers used for the fluorescent quantitative PCR detection were as follows: a forward primer: 5'-GGGGAACTTCTCCTGCTAGAAT-3' (SEQ ID NO: 35); 5'-CAGACATTTTGCTCTCAAGCTG-3' (SEQ ID NO:36) and the TaqMan probe sequence is 5 '-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3' (SEQ ID NO:37), and the result shows that the lung, the airway and the small intestine reach the peak at the viral load of D1 and D3 after the humanized ACE2 gene modified mouse is infected by SARS-CoV-2, and then the peak is reduced, which shows that the humanized ACE2 gene modified mouse is susceptible to SARS-CoV-2 (figure 15), but the virus is not detected in the control group mouse. The broken line in fig. 15 represents the average value.

Sequence listing

<110> Guangzhou biomedical and health research institute of Chinese academy of sciences

<150> 202010152182.X

<151> 2020-03-06

<160> 37

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Natural sequence

<220>

<223> sgRNA1 sequence

<400> 1

tactgctcag tccctcaccg agg 23

<210> 2

<211> 23

<212> DNA

<213> Natural sequence

<220>

<223> sgRNA2 sequence

<400> 2

cttggcattt tcctcggtga ggg 23

<210> 3

<211> 23

<212> DNA

<213> Natural sequence

<220>

<223> sgNRA 3 sequence

<400> 3

caagtgaact ttgataagac agg 23

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthesis of upstream Single-stranded primer sequence of sgRNA1

<400> 4

caccgcttgg cattttcctc ggtga 25

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthesis of downstream Single-stranded primer sequence of sgRNA1

<400> 5

aaactcaccg aggaaaatgc caagc 25

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthesis of upstream Single-stranded primer sequence of sgRNA2

<400> 6

caccgtactg ctcagtccct caccg 25

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthesis of downstream Single-stranded primer sequence of sgRNA2

<400> 7

aaaccggtga gggactgagc agtac 25

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthesis of upstream Single-stranded primer sequence of sgRNA3

<400> 8

caccgcaagt gaactttgat aagac 25

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthesis of downstream Single-stranded primer sequence of sgRNA3

<400> 9

aaacgtctta tcaaagttca cttgc 25

<210> 10

<211> 28

<212> DNA

<213> Natural sequence

<220>

<223> 5arm-sgF

<400> 10

ggttttgatt tggccataaa atgttagc 28

<210> 11

<211> 25

<212> DNA

<213> Natural sequence

<220>

<223> 3arm-sgR

<400> 11

attcccaggt ccagtttcac ctaag 25

<210> 12

<211> 2418

<212> DNA

<213> Natural sequence

<220>

<223> hACE2-CDS sequence

<400> 12

atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc tcagtccacc 60

attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga agacctgttc 120

tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga gaatgtccaa 180

aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc cacacttgcc 240

caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct gcaggctctt 300

cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa cacaattcta 360

aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa tccacaagaa 420

tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga ctacaatgag 480

aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag gccattatat 540

gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga ggactatggg 600

gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta cagccgcggc 660

cagttgattg aagatgtgga acataccttt gaagagatta aaccattata tgaacatctt 720

catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag tccaattgga 780

tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa tctgtactct 840

ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat ggtggaccag 900

gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc tgttggtctt 960

cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg aaatgttcag 1020

aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag gatccttatg 1080

tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg gcatatccag 1140

tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa tgaaggattc 1200

catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca tttaaaatcc 1260

attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa cttcctgctc 1320

aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga gaagtggagg 1380

tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg gtgggagatg 1440

aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata ctgtgacccc 1500

gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac aaggaccctt 1560

taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg ccctctgcac 1620

aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat gctgaggctt 1680

ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa gaacatgaat 1740

gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga ccagaacaag 1800

aattcttttg tgggatggag taccgactgg agtccatatg cagaccaaag catcaaagtg 1860

aggataagcc taaaatcagc tcttggagat aaagcatatg aatggaacga caatgaaatg 1920

tacctgttcc gatcatctgt tgcatatgct atgaggcagt actttttaaa agtaaaaaat 1980

cagatgattc tttttgggga ggaggatgtg cgagtggcta atttgaaacc aagaatctcc 2040

tttaatttct ttgtcactgc acctaaaaat gtgtctgata tcattcctag aactgaagtt 2100

gaaaaggcca tcaggatgtc ccggagccgt atcaatgatg ctttccgtct gaatgacaac 2160

agcctagagt ttctggggat acagccaaca cttggacctc ctaaccagcc ccctgtttcc 2220

atatggctga ttgtttttgg agttgtgatg ggagtgatag tggttggcat tgtcatcctg 2280

atcttcactg ggatcagaga tcggaagaag aaaaataaag caagaagtgg agaaaatcct 2340

tatgcctcca tcgatattag caaaggagaa aataatccag gattccaaaa cactgatgat 2400

gttcagacct ccttttag 2418

<210> 14

<211> 805

<212> PRT

<213> Natural sequence

<220>

<223> hACE2-protein sequence

<400> 14

Met Ser Ser Ser Ser Trp Leu Leu Leu Ser Leu Val Ala Val Thr Ala

1 5 10 15

Ala Gln Ser Thr Ile Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe

20 25 30

Asn His Glu Ala Glu Asp Leu Phe Tyr Gln Ser Ser Leu Ala Ser Trp

35 40 45

Asn Tyr Asn Thr Asn Ile Thr Glu Glu Asn Val Gln Asn Met Asn Asn

50 55 60

Ala Gly Asp Lys Trp Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala

65 70 75 80

Gln Met Tyr Pro Leu Gln Glu Ile Gln Asn Leu Thr Val Lys Leu Gln

85 90 95

Leu Gln Ala Leu Gln Gln Asn Gly Ser Ser Val Leu Ser Glu Asp Lys

100 105 110

Ser Lys Arg Leu Asn Thr Ile Leu Asn Thr Met Ser Thr Ile Tyr Ser

115 120 125

Thr Gly Lys Val Cys Asn Pro Asp Asn Pro Gln Glu Cys Leu Leu Leu

130 135 140

Glu Pro Gly Leu Asn Glu Ile Met Ala Asn Ser Leu Asp Tyr Asn Glu

145 150 155 160

Arg Leu Trp Ala Trp Glu Ser Trp Arg Ser Glu Val Gly Lys Gln Leu

165 170 175

Arg Pro Leu Tyr Glu Glu Tyr Val Val Leu Lys Asn Glu Met Ala Arg

180 185 190

Ala Asn His Tyr Glu Asp Tyr Gly Asp Tyr Trp Arg Gly Asp Tyr Glu

195 200 205

Val Asn Gly Val Asp Gly Tyr Asp Tyr Ser Arg Gly Gln Leu Ile Glu

210 215 220

Asp Val Glu His Thr Phe Glu Glu Ile Lys Pro Leu Tyr Glu His Leu

225 230 235 240

His Ala Tyr Val Arg Ala Lys Leu Met Asn Ala Tyr Pro Ser Tyr Ile

245 250 255

Ser Pro Ile Gly Cys Leu Pro Ala His Leu Leu Gly Asp Met Trp Gly

260 265 270

Arg Phe Trp Thr Asn Leu Tyr Ser Leu Thr Val Pro Phe Gly Gln Lys

275 280 285

Pro Asn Ile Asp Val Thr Asp Ala Met Val Asp Gln Ala Trp Asp Ala

290 295 300

Gln Arg Ile Phe Lys Glu Ala Glu Lys Phe Phe Val Ser Val Gly Leu

305 310 315 320

Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp Pro

325 330 335

Gly Asn Val Gln Lys Ala Val Cys His Pro Thr Ala Trp Asp Leu Gly

340 345 350

Lys Gly Asp Phe Arg Ile Leu Met Cys Thr Lys Val Thr Met Asp Asp

355 360 365

Phe Leu Thr Ala His His Glu Met Gly His Ile Gln Tyr Asp Met Ala

370 375 380

Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly Phe

385 390 395 400

His Glu Ala Val Gly Glu Ile Met Ser Leu Ser Ala Ala Thr Pro Lys

405 410 415

His Leu Lys Ser Ile Gly Leu Leu Ser Pro Asp Phe Gln Glu Asp Asn

420 425 430

Glu Thr Glu Ile Asn Phe Leu Leu Lys Gln Ala Leu Thr Ile Val Gly

435 440 445

Thr Leu Pro Phe Thr Tyr Met Leu Glu Lys Trp Arg Trp Met Val Phe

450 455 460

Lys Gly Glu Ile Pro Lys Asp Gln Trp Met Lys Lys Trp Trp Glu Met

465 470 475 480

Lys Arg Glu Ile Val Gly Val Val Glu Pro Val Pro His Asp Glu Thr

485 490 495

Tyr Cys Asp Pro Ala Ser Leu Phe His Val Ser Asn Asp Tyr Ser Phe

500 505 510

Ile Arg Tyr Tyr Thr Arg Thr Leu Tyr Gln Phe Gln Phe Gln Glu Ala

515 520 525

Leu Cys Gln Ala Ala Lys His Glu Gly Pro Leu His Lys Cys Asp Ile

530 535 540

Ser Asn Ser Thr Glu Ala Gly Gln Lys Leu Phe Asn Met Leu Arg Leu

545 550 555 560

Gly Lys Ser Glu Pro Trp Thr Leu Ala Leu Glu Asn Val Val Gly Ala

565 570 575

Lys Asn Met Asn Val Arg Pro Leu Leu Asn Tyr Phe Glu Pro Leu Phe

580 585 590

Thr Trp Leu Lys Asp Gln Asn Lys Asn Ser Phe Val Gly Trp Ser Thr

595 600 605

Asp Trp Ser Pro Tyr Ala Asp Gln Ser Ile Lys Val Arg Ile Ser Leu

610 615 620

Lys Ser Ala Leu Gly Asp Lys Ala Tyr Glu Trp Asn Asp Asn Glu Met

625 630 635 640

Tyr Leu Phe Arg Ser Ser Val Ala Tyr Ala Met Arg Gln Tyr Phe Leu

645 650 655

Lys Val Lys Asn Gln Met Ile Leu Phe Gly Glu Glu Asp Val Arg Val

660 665 670

Ala Asn Leu Lys Pro Arg Ile Ser Phe Asn Phe Phe Val Thr Ala Pro

675 680 685

Lys Asn Val Ser Asp Ile Ile Pro Arg Thr Glu Val Glu Lys Ala Ile

690 695 700

Arg Met Ser Arg Ser Arg Ile Asn Asp Ala Phe Arg Leu Asn Asp Asn

705 710 715 720

Ser Leu Glu Phe Leu Gly Ile Gln Pro Thr Leu Gly Pro Pro Asn Gln

725 730 735

Pro Pro Val Ser Ile Trp Leu Ile Val Phe Gly Val Val Met Gly Val

740 745 750

Ile Val Val Gly Ile Val Ile Leu Ile Phe Thr Gly Ile Arg Asp Arg

755 760 765

Lys Lys Lys Asn Lys Ala Arg Ser Gly Glu Asn Pro Tyr Ala Ser Ile

770 775 780

Asp Ile Ser Lys Gly Glu Asn Asn Pro Gly Phe Gln Asn Thr Asp Asp

785 790 795 800

Val Gln Thr Ser Phe

805

<210> 15

<211> 122

<212> DNA

<213> Natural sequence

<220>

<223> SV40 polyA sequence

<400> 15

aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60

aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120

ta 122

<210> 16

<211> 970

<212> DNA

<213> Natural sequence

<220>

<223> 5' homology arm sequence

<400> 16

ccctatggag tggagaagag tcttataatt ttttaaatgg gcagagaaat gaatttattt 60

ttaattttta gagacagggt ttctttgtat agctctagct gtctttgatt ggtagacaaa 120

gctgtcctca aactcagaga tcttccttcc tttgtctcct gagtgctggg attaaaggca 180

tggaccacca ctgccctgcc ccattctctc cattaatttt aagtgaatgc ttgcaaaagc 240

tcacttcttt ggtgaacagc ttcctttaca aataagtacc tttgccttcg tttttatagg 300

attcttaaaa agaaaaaaaa gattcagcca ggtggttgtg gtgcacacct ttaatcccag 360

cagtcaggag gcagaggaaa gcagatctct tgagtttgag gctagcctag tctacagagg 420

gagttccagg acagccaagg ctacagagag gaactgtcta aaaacaccaa gaaagagaga 480

aaggagagag ggagaggatg gatagcttat tgatagaatt gtcagaaaag gctataagtt 540

ccaatatgtg tcccatgatt tctaagtcta gccctttctg ttatagtaaa atcatagtac 600

accctcctcc tccagtgtat ctttaacagc ttttaaggaa catattaact aaatgtccag 660

gttttgattt ggccataaaa tgttagcaaa gctaaggttt tctaggatta atgaataaca 720

tgtctttatt tagtttactt aaaaaaatca ttctaaaata tctgtttaca tatctgtcct 780

ctccaggatt aacttcatat tggtccagca gcttgtttac tgttctcttc tgtttcttct 840

tctgcttttt ttttcttctc ttctcagtgc ccaacccaag ttcaaaggct gatgagagag 900

aaaaactcat gaagagattt tactctaggg aaagttgctc agtggatggg atcttggcgc 960

acggggaaag 970

<210> 17

<211> 971

<212> DNA

<213> Natural sequence

<220>

<223> 3' homology arm sequence

<400> 17

gaattataat actaacatta ctgaagaaaa tgcccaaaag atggtaagtt cttgaggcta 60

cccagggggt tattgattgc ttcttaaaga tcagaattac tgcctataaa actggataag 120

gaaatcatag agatctctca agtgtgagga tgagtgactg cctctgtagc tctgatccta 180

gtctcccaga tggctaaatt caattgacct tagagttcat ctggaaaatt gttatgaatg 240

aattatttgc ccagattcca aagatgagtg aaaatgttta ataaagttgc catcactatt 300

ctcattatat ttggtatgta aagcattcat ggaaatgttc taagtcgtta ttgagccaat 360

aattttcttt agcttataat gccaacaggt ctatccgaga actacaaatg acatattaac 420

tgaaaaatgc aactggggtt tactgaaggc agcagcttag taattaaggt aaccatggct 480

taggtgaaac tggacctggg aattccttct ttcattgaca cagagctctg aggaatttcc 540

aaaggtcaca gaagaaaagc tataattaaa ctagtcccaa aaaatctcag cctactctgg 600

gaaagcagca tattttgttt gacaagtgca aggacttaga actttttttt ttctcactga 660

tcctgaagtg ccttttaagt atagttaagt ggtggaaaat tgagcaacta tttaagaaaa 720

gactcttttt tttcttcttc cagcaatgct ttccttcaaa acggtagctt caaaacttcc 780

tgtcttttaa atgatcaggg ggctgtgtgt ttaaattatt gccattcata gaacagagtg 840

ggtctgagga tgcctgtttc ctttgaaatt ctatgccccc tcccagtttt ctaaaattta 900

agaaaccaca gagactttga caatgtagtt gccaaatgag ttgcttttaa ctgctctaat 960

agtttggtct t 971

<210> 18

<211> 1124

<212> DNA

<213> Natural sequence

<220>

<223> PGK-puro sequence

<400> 18

gggtagggga ggcgcttttc ccaaggcagt ctggagcatg cgctttagca gccccgctgg 60

gcacttggcg ctacacaagt ggcctctggc ctcgcacaca ttccacatcc cccggtaggc 120

gccaaccggc tccgttcttt ggtggcccct tcgcgccacc ttctactcct cccctagtca 180

ggaagttccc ccccgccccg cagctcgcgt cgtgcaggac gtgacaaatg gaagtagcac 240

gtctcactag tctcgtgcag atggacagca ccgctgagca atggaagcgg gtaggccttt 300

ggggcagcgg ccaatagcag ctttgctcct tcgctttctg ggctcagagg ctgggaaggg 360

gtgggtccgg gggcgggctc aggggcgggc tcaggggcgg ggcgggcgcc cgaaggtcct 420

ccggaggccc ggcattctgc acgcttcaaa agcgcacgtc tgccgcgctg ttctcctctt 480

cctcatctcc gggcctttcg acctgcagcc caagctagct taccatgacc gagtacaagc 540

ccacggtgcg cctcgccacc cgcgacgacg tccccagggc cgtacgcacc ctcgccgccg 600

cgttcgccga ctaccccgcc acgcgccaca ccgtcgatcc ggaccgccac atcgagcggg 660

tcaccgagct gcaagaactc ttcctcacgc gcgtcgggct cgacatcggc aaggtgtggg 720

tcgcggacga cggcgccgcg gtggcggtct ggaccacgcc ggagagcgtc gaagcggggg 780

cggtgttcgc cgagatcggc ccgcgcatgg ccgagttgag cggttcccgg ctggccgcgc 840

agcaacagat ggaaggcctc ctggcgccgc accggcccaa ggagcccgcg tggttcctgg 900

ccaccgtcgg cgtctcgccc gaccaccagg gcaagggtct gggcagcgcc gtcgtgctcc 960

ccggagtgga ggcggccgag cgcgccgggg tgcccgcctt cctggagacc tccgcgcccc 1020

gcaacctccc cttctacgag cggctcggct tcaccgtcac cgccgacgtc gaggtgcccg 1080

aaggaccgcg cacctggtgc atgacccgca agcccggtgc ctga 1124

<210> 18

<211> 34

<212> DNA

<213> Natural sequence

<220>

<223> Frt sequence

<400> 18

gaagttccta ttctctagaa agtataggaa cttc 34

<210> 19

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> 5arm-pcrF

<400> 19

tcgcacacat tccacatcca ccggtcccta tggagtggag aagagtctta 50

<210> 20

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> 5arm-pcrR

<400> 20

gaaggagcca ggaagagctt gacatctttc cccgtgcgcc aagatcc 47

<210> 21

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> hACE2-F

<400> 21

ggatcttggc gcacggggaa agatgtcaag ctcttcctgg ctccttc 47

<210> 22

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> hACE2-R

<400> 22

cattataagc tgcaataaac aagttctaaa aggaggtctg aacatcatc 49

<210> 23

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> SV40-F

<400> 23

gatgatgttc agacctcctt ttagaacttg tttattgcag cttataatg 49

<210> 24

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> SV40-R

<400> 24

agagaatagg aacttcgcac gcgttaagat acattgatga gtttggac 48

<210> 25

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> 3arm-pcrF

<400> 25

tacgaagtta tgtcgacgcg gcgcgccgaa ttataatact aacattactg 50

<210> 26

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> 3arm-pcrR

<400> 26

tatgaccatg attacgccaa gcttaagacc aaactattag agcagttaaa agc 53

<210> 27

<211> 8470

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> targeting vector sequence

<400> 27

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgta ccgggtaggg gaggcgcttt tcccaaggca gtctggagca tgcgctttag 240

cagccccgct gggcacttgg cgctacacaa gtggcctctg gcctcgcaca cattccacat 300

ccaccggtcc ctatggagtg gagaagagtc ttataatttt ttaaatgggc agagaaatga 360

atttattttt aatttttaga gacagggttt ctttgtatag ctctagctgt ctttgattgg 420

tagacaaagc tgtcctcaaa ctcagagatc ttccttcctt tgtctcctga gtgctgggat 480

taaaggcatg gaccaccact gccctgcccc attctctcca ttaattttaa gtgaatgctt 540

gcaaaagctc acttctttgg tgaacagctt cctttacaaa taagtacctt tgccttcgtt 600

tttataggat tcttaaaaag aaaaaaaaga ttcagccagg tggttgtggt gcacaccttt 660

aatcccagca gtcaggaggc agaggaaagc agatctcttg agtttgaggc tagcctagtc 720

tacagaggga gttccaggac agccaaggct acagagagga actgtctaaa aacaccaaga 780

aagagagaaa ggagagaggg agaggatgga tagcttattg atagaattgt cagaaaaggc 840

tataagttcc aatatgtgtc ccatgatttc taagtctagc cctttctgtt atagtaaaat 900

catagtacac cctcctcctc cagtgtatct ttaacagctt ttaaggaaca tattaactaa 960

atgtccaggt tttgatttgg ccataaaatg ttagcaaagc taaggttttc taggattaat 1020

gaataacatg tctttattta gtttacttaa aaaaatcatt ctaaaatatc tgtttacata 1080

tctgtcctct ccaggattaa cttcatattg gtccagcagc ttgtttactg ttctcttctg 1140

tttcttcttc tgcttttttt ttcttctctt ctcagtgccc aacccaagtt caaaggctga 1200

tgagagagaa aaactcatga agagatttta ctctagggaa agttgctcag tggatgggat 1260

cttggcgcac ggggaaagat gtcaagctct tcctggctcc ttctcagcct tgttgctgta 1320

actgctgctc agtccaccat tgaggaacag gccaagacat ttttggacaa gtttaaccac 1380

gaagccgaag acctgttcta tcaaagttca cttgcttctt ggaattataa caccaatatt 1440

actgaagaga atgtccaaaa catgaataat gctggggaca aatggtctgc ctttttaaag 1500

gaacagtcca cacttgccca aatgtatcca ctacaagaaa ttcagaatct cacagtcaag 1560

cttcagctgc aggctcttca gcaaaatggg tcttcagtgc tctcagaaga caagagcaaa 1620

cggttgaaca caattctaaa tacaatgagc accatctaca gtactggaaa agtttgtaac 1680

ccagataatc cacaagaatg cttattactt gaaccaggtt tgaatgaaat aatggcaaac 1740

agtttagact acaatgagag gctctgggct tgggaaagct ggagatctga ggtcggcaag 1800

cagctgaggc cattatatga agagtatgtg gtcttgaaaa atgagatggc aagagcaaat 1860

cattatgagg actatgggga ttattggaga ggagactatg aagtaaatgg ggtagatggc 1920

tatgactaca gccgcggcca gttgattgaa gatgtggaac atacctttga agagattaaa 1980

ccattatatg aacatcttca tgcctatgtg agggcaaagt tgatgaatgc ctatccttcc 2040

tatatcagtc caattggatg cctccctgct catttgcttg gtgatatgtg gggtagattt 2100

tggacaaatc tgtactcttt gacagttccc tttggacaga aaccaaacat agatgttact 2160

gatgcaatgg tggaccaggc ctgggatgca cagagaatat tcaaggaggc cgagaagttc 2220

tttgtatctg ttggtcttcc taatatgact caaggattct gggaaaattc catgctaacg 2280

gacccaggaa atgttcagaa agcagtctgc catcccacag cttgggacct ggggaagggc 2340

gacttcagga tccttatgtg cacaaaggtg acaatggacg acttcctgac agctcatcat 2400

gagatggggc atatccagta tgatatggca tatgctgcac aaccttttct gctaagaaat 2460

ggagctaatg aaggattcca tgaagctgtt ggggaaatca tgtcactttc tgcagccaca 2520

cctaagcatt taaaatccat tggtcttctg tcacccgatt ttcaagaaga caatgaaaca 2580

gaaataaact tcctgctcaa acaagcactc acgattgttg ggactctgcc atttacttac 2640

atgttagaga agtggaggtg gatggtcttt aaaggggaaa ttcccaaaga ccagtggatg 2700

aaaaagtggt gggagatgaa gcgagagata gttggggtgg tggaacctgt gccccatgat 2760

gaaacatact gtgaccccgc atctctgttc catgtttcta atgattactc attcattcga 2820

tattacacaa ggacccttta ccaattccag tttcaagaag cactttgtca agcagctaaa 2880

catgaaggcc ctctgcacaa atgtgacatc tcaaactcta cagaagctgg acagaaactg 2940

ttcaatatgc tgaggcttgg aaaatcagaa ccctggaccc tagcattgga aaatgttgta 3000

ggagcaaaga acatgaatgt aaggccactg ctcaactact ttgagccctt atttacctgg 3060

ctgaaagacc agaacaagaa ttcttttgtg ggatggagta ccgactggag tccatatgca 3120

gaccaaagca tcaaagtgag gataagccta aaatcagctc ttggagataa agcatatgaa 3180

tggaacgaca atgaaatgta cctgttccga tcatctgttg catatgctat gaggcagtac 3240

tttttaaaag taaaaaatca gatgattctt tttggggagg aggatgtgcg agtggctaat 3300

ttgaaaccaa gaatctcctt taatttcttt gtcactgcac ctaaaaatgt gtctgatatc 3360

attcctagaa ctgaagttga aaaggccatc aggatgtccc ggagccgtat caatgatgct 3420

ttccgtctga atgacaacag cctagagttt ctggggatac agccaacact tggacctcct 3480

aaccagcccc ctgtttccat atggctgatt gtttttggag ttgtgatggg agtgatagtg 3540

gttggcattg tcatcctgat cttcactggg atcagagatc ggaagaagaa aaataaagca 3600

agaagtggag aaaatcctta tgcctccatc gatattagca aaggagaaaa taatccagga 3660

ttccaaaaca ctgatgatgt tcagacctcc ttttagaact tgtttattgc agcttataat 3720

ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat 3780

tctagttgtg gtttgtccaa actcatcaat gtatcttaac gcgtgcgaag ttcctattct 3840

ctagaaagta taggaacttc atcgataccg ggtaggggag gcgcttttcc caaggcagtc 3900

tggagcatgc gctttagcag ccccgctggg cacttggcgc tacacaagtg gcctctggcc 3960

tcgcacacat tccacatccc ccggtaggcg ccaaccggct ccgttctttg gtggcccctt 4020

cgcgccacct tctactcctc ccctagtcag gaagttcccc cccgccccgc agctcgcgtc 4080

gtgcaggacg tgacaaatgg aagtagcacg tctcactagt ctcgtgcaga tggacagcac 4140

cgctgagcaa tggaagcggg taggcctttg gggcagcggc caatagcagc tttgctcctt 4200

cgctttctgg gctcagaggc tgggaagggg tgggtccggg ggcgggctca ggggcgggct 4260

caggggcggg gcgggcgccc gaaggtcctc cggaggcccg gcattctgca cgcttcaaaa 4320

gcgcacgtct gccgcgctgt tctcctcttc ctcatctccg ggcctttcga cctgcagccc 4380

aagctagctt accatgaccg agtacaagcc cacggtgcgc ctcgccaccc gcgacgacgt 4440

ccccagggcc gtacgcaccc tcgccgccgc gttcgccgac taccccgcca cgcgccacac 4500

cgtcgatccg gaccgccaca tcgagcgggt caccgagctg caagaactct tcctcacgcg 4560

cgtcgggctc gacatcggca aggtgtgggt cgcggacgac ggcgccgcgg tggcggtctg 4620

gaccacgccg gagagcgtcg aagcgggggc ggtgttcgcc gagatcggcc cgcgcatggc 4680

cgagttgagc ggttcccggc tggccgcgca gcaacagatg gaaggcctcc tggcgccgca 4740

ccggcccaag gagcccgcgt ggttcctggc caccgtcggc gtctcgcccg accaccaggg 4800

caagggtctg ggcagcgccg tcgtgctccc cggagtggag gcggccgagc gcgccggggt 4860

gcccgccttc ctggagacct ccgcgccccg caacctcccc ttctacgagc ggctcggctt 4920

caccgtcacc gccgacgtcg aggtgcccga aggaccgcgc acctggtgca tgacccgcaa 4980

gcccggtgcc tgaggtacct ctcatgctgg agttcttcgc ccaccccaac ttgtttattg 5040

cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt 5100

tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat catcgatgaa 5160

gttcctattc tctagaaagt ataggaactt ctaacctccc gggtgacaga taacttcgta 5220

taatgtatgc tatacgaagt tatgtcgacg cggcgcgccg aattataata ctaacattac 5280

tgaagaaaat gcccaaaaga tggtaagttc ttgaggctac ccagggggtt attgattgct 5340

tcttaaagat cagaattact gcctataaaa ctggataagg aaatcataga gatctctcaa 5400

gtgtgaggat gagtgactgc ctctgtagct ctgatcctag tctcccagat ggctaaattc 5460

aattgacctt agagttcatc tggaaaattg ttatgaatga attatttgcc cagattccaa 5520

agatgagtga aaatgtttaa taaagttgcc atcactattc tcattatatt tggtatgtaa 5580

agcattcatg gaaatgttct aagtcgttat tgagccaata attttcttta gcttataatg 5640

ccaacaggtc tatccgagaa ctacaaatga catattaact gaaaaatgca actggggttt 5700

actgaaggca gcagcttagt aattaaggta accatggctt aggtgaaact ggacctggga 5760

attccttctt tcattgacac agagctctga ggaatttcca aaggtcacag aagaaaagct 5820

ataattaaac tagtcccaaa aaatctcagc ctactctggg aaagcagcat attttgtttg 5880

acaagtgcaa ggacttagaa cttttttttt tctcactgat cctgaagtgc cttttaagta 5940

tagttaagtg gtggaaaatt gagcaactat ttaagaaaag actctttttt ttcttcttcc 6000

agcaatgctt tccttcaaaa cggtagcttc aaaacttcct gtcttttaaa tgatcagggg 6060

gctgtgtgtt taaattattg ccattcatag aacagagtgg gtctgaggat gcctgtttcc 6120

tttgaaattc tatgccccct cccagttttc taaaatttaa gaaaccacag agactttgac 6180

aatgtagttg ccaaatgagt tgcttttaac tgctctaata gtttggtctt aagcttggcg 6240

taatcatggt catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac 6300

atacgagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca 6360

ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat 6420

taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc 6480

tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca 6540

aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 6600

aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 6660

ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 6720

acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt 6780

ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 6840

tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 6900

tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt 6960

gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 7020

agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 7080

tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 7140

agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt 7200

tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct 7260

acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 7320

tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa 7380

agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc 7440

tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact 7500

acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc 7560

tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt 7620

ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta 7680

agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg 7740

tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt 7800

acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc 7860

agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 7920

actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 7980

tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc 8040

gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 8100

ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac 8160

tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa 8220

aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 8280

tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 8340

tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 8400

gacgtctaag aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg 8460

ccctttcgtc 8470

<210> 28

<211> 19

<212> DNA

<213> Natural sequence

<220>

<223> Puro-F

<400> 28

aacctcccct tctacgagc 19

<210> 29

<211> 24

<212> DNA

<213> Natural sequence

<220>

<223> 3arm-outR

<400> 29

tacagccagg atctggatgt cagc 24

<210> 30

<211> 5922

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> mouse embryonic stem cell Ace2 locus genome replacement sequence

<400> 30

ccctatggag tggagaagag tcttataatt ttttaaatgg gcagagaaat gaatttattt 60

ttaattttta gagacagggt ttctttgtat agctctagct gtctttgatt ggtagacaaa 120

gctgtcctca aactcagaga tcttccttcc tttgtctcct gagtgctggg attaaaggca 180

tggaccacca ctgccctgcc ccattctctc cattaatttt aagtgaatgc ttgcaaaagc 240

tcacttcttt ggtgaacagc ttcctttaca aataagtacc tttgccttcg tttttatagg 300

attcttaaaa agaaaaaaaa gattcagcca ggtggttgtg gtgcacacct ttaatcccag 360

cagtcaggag gcagaggaaa gcagatctct tgagtttgag gctagcctag tctacagagg 420

gagttccagg acagccaagg ctacagagag gaactgtcta aaaacaccaa gaaagagaga 480

aaggagagag ggagaggatg gatagcttat tgatagaatt gtcagaaaag gctataagtt 540

ccaatatgtg tcccatgatt tctaagtcta gccctttctg ttatagtaaa atcatagtac 600

accctcctcc tccagtgtat ctttaacagc ttttaaggaa catattaact aaatgtccag 660

gttttgattt ggccataaaa tgttagcaaa gctaaggttt tctaggatta atgaataaca 720

tgtctttatt tagtttactt aaaaaaatca ttctaaaata tctgtttaca tatctgtcct 780

ctccaggatt aacttcatat tggtccagca gcttgtttac tgttctcttc tgtttcttct 840

tctgcttttt ttttcttctc ttctcagtgc ccaacccaag ttcaaaggct gatgagagag 900

aaaaactcat gaagagattt tactctaggg aaagttgctc agtggatggg atcttggcgc 960

acggggaaag atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc 1020

tcagtccacc attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga 1080

agacctgttc tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga 1140

gaatgtccaa aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc 1200

cacacttgcc caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct 1260

gcaggctctt cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa 1320

cacaattcta aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa 1380

tccacaagaa tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga 1440

ctacaatgag aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag 1500

gccattatat gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga 1560

ggactatggg gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta 1620

cagccgcggc cagttgattg aagatgtgga acataccttt gaagagatta aaccattata 1680

tgaacatctt catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag 1740

tccaattgga tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa 1800

tctgtactct ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat 1860

ggtggaccag gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc 1920

tgttggtctt cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg 1980

aaatgttcag aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag 2040

gatccttatg tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg 2100

gcatatccag tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa 2160

tgaaggattc catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca 2220

tttaaaatcc attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa 2280

cttcctgctc aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga 2340

gaagtggagg tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg 2400

gtgggagatg aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata 2460

ctgtgacccc gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac 2520

aaggaccctt taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg 2580

ccctctgcac aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat 2640

gctgaggctt ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa 2700

gaacatgaat gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga 2760

ccagaacaag aattcttttg tgggatggag taccgactgg agtccatatg cagaccaaag 2820

catcaaagtg aggataagcc taaaatcagc tcttggagat aaagcatatg aatggaacga 2880

caatgaaatg tacctgttcc gatcatctgt tgcatatgct atgaggcagt actttttaaa 2940

agtaaaaaat cagatgattc tttttgggga ggaggatgtg cgagtggcta atttgaaacc 3000

aagaatctcc tttaatttct ttgtcactgc acctaaaaat gtgtctgata tcattcctag 3060

aactgaagtt gaaaaggcca tcaggatgtc ccggagccgt atcaatgatg ctttccgtct 3120

gaatgacaac agcctagagt ttctggggat acagccaaca cttggacctc ctaaccagcc 3180

ccctgtttcc atatggctga ttgtttttgg agttgtgatg ggagtgatag tggttggcat 3240

tgtcatcctg atcttcactg ggatcagaga tcggaagaag aaaaataaag caagaagtgg 3300

agaaaatcct tatgcctcca tcgatattag caaaggagaa aataatccag gattccaaaa 3360

cactgatgat gttcagacct ccttttagaa cttgtttatt gcagcttata atggttacaa 3420

ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg 3480

tggtttgtcc aaactcatca atgtatctta acgcgtgcga agttcctatt ctctagaaag 3540

tataggaact tcatcgatac cgggtagggg aggcgctttt cccaaggcag tctggagcat 3600

gcgctttagc agccccgctg ggcacttggc gctacacaag tggcctctgg cctcgcacac 3660

attccacatc ccccggtagg cgccaaccgg ctccgttctt tggtggcccc ttcgcgccac 3720

cttctactcc tcccctagtc aggaagttcc cccccgcccc gcagctcgcg tcgtgcagga 3780

cgtgacaaat ggaagtagca cgtctcacta gtctcgtgca gatggacagc accgctgagc 3840

aatggaagcg ggtaggcctt tggggcagcg gccaatagca gctttgctcc ttcgctttct 3900

gggctcagag gctgggaagg ggtgggtccg ggggcgggct caggggcggg ctcaggggcg 3960

gggcgggcgc ccgaaggtcc tccggaggcc cggcattctg cacgcttcaa aagcgcacgt 4020

ctgccgcgct gttctcctct tcctcatctc cgggcctttc gacctgcagc ccaagctagc 4080

ttaccatgac cgagtacaag cccacggtgc gcctcgccac ccgcgacgac gtccccaggg 4140

ccgtacgcac cctcgccgcc gcgttcgccg actaccccgc cacgcgccac accgtcgatc 4200

cggaccgcca catcgagcgg gtcaccgagc tgcaagaact cttcctcacg cgcgtcgggc 4260

tcgacatcgg caaggtgtgg gtcgcggacg acggcgccgc ggtggcggtc tggaccacgc 4320

cggagagcgt cgaagcgggg gcggtgttcg ccgagatcgg cccgcgcatg gccgagttga 4380

gcggttcccg gctggccgcg cagcaacaga tggaaggcct cctggcgccg caccggccca 4440

aggagcccgc gtggttcctg gccaccgtcg gcgtctcgcc cgaccaccag ggcaagggtc 4500

tgggcagcgc cgtcgtgctc cccggagtgg aggcggccga gcgcgccggg gtgcccgcct 4560

tcctggagac ctccgcgccc cgcaacctcc ccttctacga gcggctcggc ttcaccgtca 4620

ccgccgacgt cgaggtgccc gaaggaccgc gcacctggtg catgacccgc aagcccggtg 4680

cctgaggtac ctctcatgct ggagttcttc gcccacccca acttgtttat tgcagcttat 4740

aatggttaca aataaagcaa tagcatcaca aatttcacaa ataaagcatt tttttcactg 4800

cattctagtt gtggtttgtc caaactcatc aatgtatctt atcatcgatg aagttcctat 4860

tctctagaaa gtataggaac ttctaacctc ccgggtgaca gataacttcg tataatgtat 4920

gctatacgaa gttatgtcga cgcggcgcgc cgaattataa tactaacatt actgaagaaa 4980

atgcccaaaa gatggtaagt tcttgaggct acccaggggg ttattgattg cttcttaaag 5040

atcagaatta ctgcctataa aactggataa ggaaatcata gagatctctc aagtgtgagg 5100

atgagtgact gcctctgtag ctctgatcct agtctcccag atggctaaat tcaattgacc 5160

ttagagttca tctggaaaat tgttatgaat gaattatttg cccagattcc aaagatgagt 5220

gaaaatgttt aataaagttg ccatcactat tctcattata tttggtatgt aaagcattca 5280

tggaaatgtt ctaagtcgtt attgagccaa taattttctt tagcttataa tgccaacagg 5340

tctatccgag aactacaaat gacatattaa ctgaaaaatg caactggggt ttactgaagg 5400

cagcagctta gtaattaagg taaccatggc ttaggtgaaa ctggacctgg gaattccttc 5460

tttcattgac acagagctct gaggaatttc caaaggtcac agaagaaaag ctataattaa 5520

actagtccca aaaaatctca gcctactctg ggaaagcagc atattttgtt tgacaagtgc 5580

aaggacttag aacttttttt tttctcactg atcctgaagt gccttttaag tatagttaag 5640

tggtggaaaa ttgagcaact atttaagaaa agactctttt ttttcttctt ccagcaatgc 5700

tttccttcaa aacggtagct tcaaaacttc ctgtctttta aatgatcagg gggctgtgtg 5760

tttaaattat tgccattcat agaacagagt gggtctgagg atgcctgttt cctttgaaat 5820

tctatgcccc ctcccagttt tctaaaattt aagaaaccac agagactttg acaatgtagt 5880

tgccaaatga gttgctttta actgctctaa tagtttggtc tt 5922

<210> 31

<211> 19

<212> DNA

<213> Natural sequence

<220>

<223> hACE2-F

<400> 31

tgatagtggt tggcattgt 19

<210> 32

<211> 4591

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> genome replacement sequence of Ace2 site of mouse embryonic stem cell after final deletion of PGK-puro

<400> 32

ccctatggag tggagaagag tcttataatt ttttaaatgg gcagagaaat gaatttattt 60

ttaattttta gagacagggt ttctttgtat agctctagct gtctttgatt ggtagacaaa 120

gctgtcctca aactcagaga tcttccttcc tttgtctcct gagtgctggg attaaaggca 180

tggaccacca ctgccctgcc ccattctctc cattaatttt aagtgaatgc ttgcaaaagc 240

tcacttcttt ggtgaacagc ttcctttaca aataagtacc tttgccttcg tttttatagg 300

attcttaaaa agaaaaaaaa gattcagcca ggtggttgtg gtgcacacct ttaatcccag 360

cagtcaggag gcagaggaaa gcagatctct tgagtttgag gctagcctag tctacagagg 420

gagttccagg acagccaagg ctacagagag gaactgtcta aaaacaccaa gaaagagaga 480

aaggagagag ggagaggatg gatagcttat tgatagaatt gtcagaaaag gctataagtt 540

ccaatatgtg tcccatgatt tctaagtcta gccctttctg ttatagtaaa atcatagtac 600

accctcctcc tccagtgtat ctttaacagc ttttaaggaa catattaact aaatgtccag 660

gttttgattt ggccataaaa tgttagcaaa gctaaggttt tctaggatta atgaataaca 720

tgtctttatt tagtttactt aaaaaaatca ttctaaaata tctgtttaca tatctgtcct 780

ctccaggatt aacttcatat tggtccagca gcttgtttac tgttctcttc tgtttcttct 840

tctgcttttt ttttcttctc ttctcagtgc ccaacccaag ttcaaaggct gatgagagag 900

aaaaactcat gaagagattt tactctaggg aaagttgctc agtggatggg atcttggcgc 960

acggggaaag atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc 1020

tcagtccacc attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga 1080

agacctgttc tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga 1140

gaatgtccaa aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc 1200

cacacttgcc caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct 1260

gcaggctctt cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa 1320

cacaattcta aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa 1380

tccacaagaa tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga 1440

ctacaatgag aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag 1500

gccattatat gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga 1560

ggactatggg gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta 1620

cagccgcggc cagttgattg aagatgtgga acataccttt gaagagatta aaccattata 1680

tgaacatctt catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag 1740

tccaattgga tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa 1800

tctgtactct ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat 1860

ggtggaccag gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc 1920

tgttggtctt cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg 1980

aaatgttcag aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag 2040

gatccttatg tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg 2100

gcatatccag tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa 2160

tgaaggattc catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca 2220

tttaaaatcc attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa 2280

cttcctgctc aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga 2340

gaagtggagg tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg 2400

gtgggagatg aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata 2460

ctgtgacccc gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac 2520

aaggaccctt taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg 2580

ccctctgcac aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat 2640

gctgaggctt ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa 2700

gaacatgaat gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga 2760

ccagaacaag aattcttttg tgggatggag taccgactgg agtccatatg cagaccaaag 2820

catcaaagtg aggataagcc taaaatcagc tcttggagat aaagcatatg aatggaacga 2880

caatgaaatg tacctgttcc gatcatctgt tgcatatgct atgaggcagt actttttaaa 2940

agtaaaaaat cagatgattc tttttgggga ggaggatgtg cgagtggcta atttgaaacc 3000

aagaatctcc tttaatttct ttgtcactgc acctaaaaat gtgtctgata tcattcctag 3060

aactgaagtt gaaaaggcca tcaggatgtc ccggagccgt atcaatgatg ctttccgtct 3120

gaatgacaac agcctagagt ttctggggat acagccaaca cttggacctc ctaaccagcc 3180

ccctgtttcc atatggctga ttgtttttgg agttgtgatg ggagtgatag tggttggcat 3240

tgtcatcctg atcttcactg ggatcagaga tcggaagaag aaaaataaag caagaagtgg 3300

agaaaatcct tatgcctcca tcgatattag caaaggagaa aataatccag gattccaaaa 3360

cactgatgat gttcagacct ccttttagaa cttgtttatt gcagcttata atggttacaa 3420

ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg 3480

tggtttgtcc aaactcatca atgtatctta acgcgtgcga agttcctatt ctctagaaag 3540

tataggaact tctaacctcc cgggtgacag ataacttcgt ataatgtatg ctatacgaag 3600

ttatgtcgac gcggcgcgcc gaattataat actaacatta ctgaagaaaa tgcccaaaag 3660

atggtaagtt cttgaggcta cccagggggt tattgattgc ttcttaaaga tcagaattac 3720

tgcctataaa actggataag gaaatcatag agatctctca agtgtgagga tgagtgactg 3780

cctctgtagc tctgatccta gtctcccaga tggctaaatt caattgacct tagagttcat 3840

ctggaaaatt gttatgaatg aattatttgc ccagattcca aagatgagtg aaaatgttta 3900

ataaagttgc catcactatt ctcattatat ttggtatgta aagcattcat ggaaatgttc 3960

taagtcgtta ttgagccaat aattttcttt agcttataat gccaacaggt ctatccgaga 4020

actacaaatg acatattaac tgaaaaatgc aactggggtt tactgaaggc agcagcttag 4080

taattaaggt aaccatggct taggtgaaac tggacctggg aattccttct ttcattgaca 4140

cagagctctg aggaatttcc aaaggtcaca gaagaaaagc tataattaaa ctagtcccaa 4200

aaaatctcag cctactctgg gaaagcagca tattttgttt gacaagtgca aggacttaga 4260

actttttttt ttctcactga tcctgaagtg ccttttaagt atagttaagt ggtggaaaat 4320

tgagcaacta tttaagaaaa gactcttttt tttcttcttc cagcaatgct ttccttcaaa 4380

acggtagctt caaaacttcc tgtcttttaa atgatcaggg ggctgtgtgt ttaaattatt 4440

gccattcata gaacagagtg ggtctgagga tgcctgtttc ctttgaaatt ctatgccccc 4500

tcccagtttt ctaaaattta agaaaccaca gagactttga caatgtagtt gccaaatgag 4560

ttgcttttaa ctgctctaat agtttggtct t 4591

<210> 33

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> hACE2-qF

<400> 33

ggtcttcagt gctctcag 18

<210> 34

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> hACE2-qR

<400> 34

gcattcttgt ggattatctg g 21

<210> 35

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Forward primer

<400> 35

ggggaacttc tcctgctaga at 22

<210> 36

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> reverse primer

<400> 36

cagacatttt gctctcaagc tg 22

<210> 37

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> TaqMan probe

<400> 37

ttgctgctgc ttgacagatt 20

Claims

1. A nucleic acid fragment sequence as set forth in SEQ ID NO:1 or SEQ ID NO:2, or a pharmaceutically acceptable salt thereof.

2. The nucleic acid fragment sequence of claim 1, wherein the upstream and downstream primer sequences for synthesizing the nucleic acid are shown in SEQ ID No. 4 and SEQ ID No. 5, respectively;

preferably, the sequences of the upstream and downstream primers for synthesizing the nucleic acid are shown as SEQ ID NO. 6 and SEQ ID NO. 7, respectively;

more preferably, the nucleic acid is a sgRNA;

or preferably, the sgRNA fragment sequence targets a gene of animal ACE2 gene for site-directed cleavage of ACE2 gene;

or preferably, the sgRNA fragment sequence is used to construct a humanized animal model;

more preferably, the cleavage point of the sgRNA fragment sequence is located in exon1 of ACE2 gene of the animal;

even more preferably, the cutting point is within 140bp base range after 5' UTR of the animal ACE2 gene;

further preferably, the animal is a mammal;

further preferably, the mammal is a rodent;

further preferably, the rodent is a mouse.

3. A targeting vector comprising a 5' homology arm, a human ACE2 gene fragment, and an SV40 polyA sequence; the targeting vector targets an animal ACE2 gene, the animal ACE2 gene containing a cleavage point corresponding to the nucleic acid fragment sequence of claim 1 or 2;

preferably, the 5' homology arm is a 5' homology arm homologous to a 5' target sequence at the genomic locus of interest;

or preferably, the targeting vector is used for promoting the expression of the human target gene by using the promoter of the animal target gene after inserting the CDS sequence of the human source gene into the promoter and 5' UTR region sequence of the animal gene;

preferably, the targeting vector further comprises a3 'homology arm, the 3' homology arm being a3 'homology arm homologous to a 3' target sequence at the genomic locus of interest;

further preferably, the targeting vector further comprises a screening marker PGK-Puro;

preferably, the animal is a mammal;

more preferably, the mammal is a rodent;

more preferably, the animal is a mouse.

4. A DNA molecule encoding the nucleic acid fragment sequence of any one of claims 1-2.

5. A cell comprising the nucleic acid fragment sequence of any one of claims 1 to 2 or the targeting vector of claim 3 or the DNA molecule of claim 4.

6. Use of a nucleic acid fragment sequence of any one of claims 1-2 for the preparation of a genetically humanized cell strain or a humanized animal model;

preferably, the gene is ACE 2;

or preferably, the animal is a mammal;

more preferably, the animal is a rodent;

more preferably, the animal is a mouse.

7. A method for constructing a humanized animal cell line, which comprises using the nucleic acid fragment sequence of any one of claims 1 or 2;

preferably, the method comprises introducing a human target gene into an animal cell, so that the target gene expresses the CDS of the human full-length target gene in situ in the animal cell;

preferably, the gene of interest is ACE 2;

more preferably, the animal is a mammal;

more preferably, the animal is a rodent;

more preferably, the animal is a mouse;

or preferably, the cell is an embryonic stem cell;

preferably, the method uses gene editing techniques for the construction of humanized animal cell models;

preferably, the gene editing technology comprises embryonic stem cell-based DNA homologous recombination technology, CRISPR/Cas9 technology;

more preferably, the gene editing technology is based on CRISPR/Cas9 to construct ACE2 humanized animal; or more preferably, the construction method comprises the steps of:

(1) constructing the targeting vector of claim 3;

(2) introducing the constructed targeting vector and the vector to which the nucleic acid of claim 1 or 2 is linked into an embryonic stem cell of animal origin;

(3) culturing the embryonic stem cells in the step (2) into clones to obtain the embryonic stem cells;

preferably, the animal is a mammal;

further preferably, the mammal is a rodent;

further preferably, the rodent is a mouse.

8. An ACE2 gene humanized animal cell strain prepared by the method of claim 7.

9. A method for constructing a gene-humanized animal model, comprising injecting the animal cell of claim 8 into an animal;

preferably, the method comprises forming an individual animal from the animal cells by tetraploid compensation or blastocyst injection.

10. A humanized mouse or a tissue, a body fluid, a cell, a disrupted product or an extract thereof of an offspring thereof, wherein the humanized mouse is constructed by the method according to claim 9.

11. Use of a humanized animal model or its progeny derived from the construction method according to claim 9 for the manufacture of human antibodies or as model systems for pharmacological, immunological, microbiological and medical research, or for the production and use of animal experimental disease models for pathogenic research and/or for the development of new diagnostic and/or therapeutic strategies, or for screening, validation, evaluation or study of ACE2 gene function, ACE2 antibodies, drugs against ACE2 targets, pharmacodynamic studies.