CN113897363B - Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof - Google Patents

Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof Download PDF

Info

Publication number
CN113897363B
CN113897363B CN202111041730.2A CN202111041730A CN113897363B CN 113897363 B CN113897363 B CN 113897363B CN 202111041730 A CN202111041730 A CN 202111041730A CN 113897363 B CN113897363 B CN 113897363B
Authority
CN
China
Prior art keywords
plasmid
ace2
cells
cell
stem cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111041730.2A
Other languages
Chinese (zh)
Other versions
CN113897363A (en
Inventor
刘澎涛
刘芳
阮德功
谭家奇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Stem Cell Transformation Research Center Co ltd
Original Assignee
Stem Cell Transformation Research Center Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Stem Cell Transformation Research Center Co ltd filed Critical Stem Cell Transformation Research Center Co ltd
Priority to CN202111041730.2A priority Critical patent/CN113897363B/en
Publication of CN113897363A publication Critical patent/CN113897363A/en
Application granted granted Critical
Publication of CN113897363B publication Critical patent/CN113897363B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/485—Exopeptidases (3.4.11-3.4.19)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/17—Metallocarboxypeptidases (3.4.17)
    • C12Y304/17023—Angiotensin-converting enzyme 2 (3.4.17.23)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5073—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/15—Transforming growth factor beta (TGF-β)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • C12N2503/02—Drug screening
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Plant Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Reproductive Health (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Transplantation (AREA)
  • Vascular Medicine (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a method for knocking out ACE2 genes in pluripotent stem cells, which comprises the steps of cloning a pair of sgRNAs with nucleotide sequences shown as SEQ ID No. 5-8 onto plasmid vectors respectively, and co-transfecting the pluripotent stem cells with Cas9 plasmids. The invention also discloses a pair of sgRNA, plasmids and complete plasmids adopted by the knockout method, a construction method of an embryonic stem cell subline for knocking out the ACE2 gene, and a construction method of a humanized differentiated cell model for knocking out the ACE2 gene. The dual gRNA knockout method on the pluripotent stem cells has the advantages of high knockout efficiency and easiness in operation. The embryonic stem cell subline constructed based on the knockout method can be developed into any humanized cell/tissue/organoid model free from infection of the new coronavirus, and has great significance in research and development of medicines and vaccines for treating the new coronavirus.

Description

Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof
Technical Field
The invention relates to the technical field of gene editing and stem cell differentiation, in particular to an embryonic stem cell subline for knocking out an ACE2 gene, a construction method and application thereof in preparation, screening and evaluation of anti-novel coronavirus vaccines and medicines.
Background
The global explosion of covd-19 presents a significant challenge to world economy and public health. SARS-CoV-2 is the major causative agent of new patients and spike protein (S protein) is the key protein that mediates viral invasion into host cells. The novel coronavirus was found to enter host cells after binding to ACE2 receptor. Single cell sequencing data found that ACE2 protein was significantly expressed in alveolar cells. ACE2 proteins have also been found to be highly aggregated in nasal epithelial cells. ACE2 therefore plays a major role in new coronavirus infection.
In the research process of the existing vaccine and medicine of the novel coronavirus, an animal model is generally adopted for verification. However, the animal and human body are still quite different, and various mechanism researches or drug experimental results in the animal body fail to truly reflect the human body condition, so that more adverse reactions still exist in the vaccine generated by the animal at present. Researchers also use organ chip technology to build a new coronavirus infection model based on tissue level, and simulate a series of pathophysiological changes such as lung tissue barrier injury, immune cell adhesion, inflammatory factor release, lung microvascular endothelial cell injury and the like caused by new coronavirus infection. In addition, there are scholars who use organoid models derived from embryonic stem cells or induced pluripotent stem cells to study new coronaviruses. These models are already closer to the human body than animal models, but they still require considerable difficulty to build. How to build the humanized differentiated cell model with short modeling time, low consumption, humanization and other characteristics, and fast development of virus pathogenesis, virus transmission, fast drug testing and other aspects is an important path for overcoming viruses. In addition, many experimental models currently studying new coronavirus infection often use methods that overexpress the ACE2 gene, but this does not reflect the true function of ACE2, as the function of the overexpressed gene is not the same as that produced at the actual expression level of the cell. Therefore, it is necessary to construct ACE2 knockout cell lines for validation.
Expanded Potential Stem Cells (EPSCs) are novel embryonic stem cells, can be developed into any type of tissue cells, and have extremely important prospects in research and treatment of diseases. Literature search has found that there has been no method for knocking out the ACE2 gene in embryonic stem cells so far, thereby establishing a stem embryonic stem cell subline for knocking out the ACE2 gene, and there has been no report on the differentiation ability after knocking out embryonic stem cells.
The applicant finds through experiments that the humanized EPSC cells (hESCs) do not express ACE2 and are not susceptible to the novel coronavirus; while ACE2 expression on cells differentiated extraembryologically and susceptible to new coronaviruses suggests that ACE2 plays a major role in infection of new coronaviruses by EPSC extraembryologically differentiated cells, it also suggests that EPSCs may express ACE2 and be susceptible to new coronaviruses in their subsequent differentiation, and thus, if various human differentiated cell models or organoid models or the like differentiated from EPSCs are subsequently to be protected from new coronavirus infection, or various cell products (including exosomes etc.) prepared from differentiated EPSCs or genetically edited EPSCs, it is necessary to first establish an ESPC embryonic stem cell subfraction which the ACE2 gene is knocked out. For the reasons, the method has important application value in constructing an embryonic stem cell subline for knocking out the ACE2 gene in EPSC.
Disclosure of Invention
The technical problem to be solved by the invention is to provide a method for knocking out ACE2 genes in pluripotent stem cells, which has high knocking-out efficiency and low control difficulty.
The invention also solves the technical problem of providing a construction method of an embryonic stem cell subline for knocking out an ACE2 gene.
The invention also solves the technical problem of providing a method for establishing a humanized differentiated cell model for knocking out an ACE2 gene.
In order to solve the technical problems, the invention provides a method for knocking out ACE2 genes in pluripotent stem cells, which comprises the following steps: a pair of sgRNAs with nucleotide sequences shown as SEQ ID No. 5-8 are adopted to clone on the gRNA plasmid vector respectively, and then co-transfect the pluripotent stem cells with the Cas9 plasmid.
As an improvement of the above technical scheme, the pluripotent stem cells are EPSC cells or iPSC cells.
As an improvement of the technical scheme, the pluripotent stem cells are human expansion potential stem cells.
Correspondingly, the invention also provides a construction method of an embryonic stem cell subline for knocking out the ACE2 gene, which comprises the following steps: constructing an embryonic stem cell subline for knocking out an ACE2 gene by adopting a CRISPR/Cas9 technology, wherein the construction method comprises the following steps of: and (3) cloning a pair of sgRNAs with nucleotide sequences shown as SEQ ID No. 5-8 on a gRNA plasmid vector, co-transfecting a human expansion potential stem cell with a Cas9 plasmid to obtain a recombinant cell, and culturing the recombinant cell to obtain an embryonic stem cell subline with the ACE2 gene knocked out.
Correspondingly, the invention also provides a method for establishing a humanized differentiated cell model for knocking out the ACE2 gene, which comprises the following steps: and (3) cloning a pair of sgRNAs with nucleotide sequences shown as SEQ ID No. 5-8 on plasmid vectors respectively, co-transfecting the humanized expansion potential stem cells with Cas9 plasmids to obtain recombinant cells, amplifying the recombinant cells, and inducing and differentiating the recombinant cells into extraembryogenic differentiated cells under the action of a TGF-beta inhibitor to obtain an extraembryogenic differentiated human differentiation cell model for knocking out ACE2 genes.
As a modification of the above technical scheme, the gRNA plasmid vector is pKLV2-U6sgRNA.
As an improvement of the above technical scheme, the Cas9 plasmid is pKLV2-EF1 alpha-BstCAS 9-W plasmid.
As an improvement of the above technical scheme, the sgRNA is connected with the gRNA plasmid vector through Bbs I digestion.
As an improvement to the above technical solution, the transfection is electrotransfection.
As an improvement of the technical scheme, a pair of sgRNAs with nucleotide sequences shown in SEQ ID No. 5-8 are adopted and cloned on a linearized pKLV2-U6sgRNA plasmid vector after BbsI enzyme digestion to obtain a pKLV2-U6sgRNA1 plasmid and a pKLV2-U6sgRNA2 plasmid, and the pKLV2-U6sgRNA1 plasmid, the pKLV2-U6sgRNA2 plasmid and the pKLV2-EF1 alpha-Bstcas 9-W plasmid are uniformly mixed according to a preset proportion to obtain a mixed plasmid, and the mixed plasmid is adopted to transfect human expansion potential stem cells.
As an improvement of the technical scheme, the weight ratio of the pKLV2-EF1 alpha-BstCAs 9-W plasmid, the pKLV2-U6sgRNA1 plasmid and the pKLV2-U6sgRNA2 plasmid is as follows: (4-10): (2-5): (2-5).
As an improvement of the above technical scheme, the TGF-beta inhibitor SB431542 is adopted to induce the recombinant cells to differentiate into extraembryogenic differentiated cells.
Correspondingly, the invention also discloses an sgRNA for knocking out the ACE2 gene in the pluripotent stem cells, and the nucleotide sequence of the sgRNA is shown as SEQ ID No. 5-8.
Correspondingly, the invention also discloses a plasmid which is the pKLV2-U6sgRNA1 plasmid or the pKLV2-U6sgRNA2 plasmid.
Correspondingly, the invention also discloses a complete set of plasmids, which comprises the pKLV2-U6sgRNA1 plasmid, the pKLV2-U6sgRNA2 plasmid and the pKLV2-EF1 alpha-BstCAs 9-W plasmid.
Correspondingly, the invention also discloses application of the sgRNA in (1) or (2):
(1) The application in constructing an embryonic stem cell subline for knocking out the ACE2 gene; or (b)
(2) The application in establishing a humanized differentiated cell model for knocking out the ACE2 gene.
Correspondingly, the invention also discloses application of the plasmid in (1) or (2):
(1) The application in constructing an embryonic stem cell subline for knocking out the ACE2 gene; or (b)
(2) The application in establishing a humanized differentiated cell model for knocking out the ACE2 gene.
Correspondingly, the invention also discloses application of the complete set of plasmids in (1) or (2):
(1) The application in constructing an embryonic stem cell subline for knocking out the ACE2 gene; or (b)
(2) The application in establishing a humanized differentiated cell model for knocking out the ACE2 gene.
Correspondingly, the invention also discloses an embryonic stem cell subline for knocking out the ACE2 gene, which is constructed by the method.
Correspondingly, the invention also discloses a humanized differentiated cell model for knocking out the ACE2 gene, which is established by the method.
Correspondingly, the invention also discloses application of the ACE2 gene knockout embryonic stem cell subline in preparation, screening and evaluation of vaccines against COVID-19.
Correspondingly, the invention also discloses application of the ACE2 gene knockout embryonic stem cell subline in preparation, screening and evaluation of anti-COVID-19 drugs.
Correspondingly, the invention also discloses application of the embryonic stem cell subline for knocking out the ACE2 gene in any one of the following (1) - (3):
(1) Application in establishing a humanized differentiated cell model for knocking out ACE2 genes;
(2) Use in establishing stem cell-induced anti-covd-19 organoids;
(3) Application in preparing exosomes of embryonic stem cell sublines of the knock-out ACE2 gene.
Correspondingly, the invention also discloses application of the humanized differentiated cell model for knocking out the ACE2 gene in any one of the following (1) - (3):
(1) Use in establishing stem cell-induced anti-covd-19 organoids;
(2) Application of exosomes in preparation of embryonic stem cell sublines for knocking out ACE2 genes
(3) The application in preparing, screening and evaluating vaccine and medicine for resisting COVID-19.
The implementation of the invention has the following beneficial effects:
according to the invention, a CRISPR/Cas9 technology is adopted to efficiently knock out ACE2 genes in human expansion potential stem cells through a specific pair of sgRNAs, so that the knock-out is thorough, and the operation method is simple. The obtained embryonic stem cell subline has extra-embryo development capability and can be continuously induced into a human differentiation cell model which is not infected by the novel coronavirus. The embryonic stem cell subline with the ACE2 gene knocked out can be developed into any humanized cell/tissue/organoid model free from infection of new coronaviruses, and has great significance in the aspects of researching medicines, vaccines and the like of the new coronaviruses.
Drawings
FIG. 1 is a genomic phenotype map of PCR detection of ACE2 knockdown;
FIG. 2 is an analysis chart of Western blot verification analysis of ACE2 knockout effects;
FIG. 3 is a graph showing the results of RT-qPCR analysis of normal human EPSC cells (EPSCs) and human EPSC cells (ACE 2-KO) after ACE2 gene knockout;
FIG. 4 is a graph showing the results of flow cytometry detection of normal human EPSC cells (EPSCs) and human EPSC cells (ACE 2-KO) after ACE2 gene knockout;
FIG. 5 is an immunofluorescence assay of normal human EPSC cells (hESCs) dryness and multipotent markers;
FIG. 6 is a diagram of RT-qPCR detection of normal human EPSC cells (hESCs) pluripotency markers;
FIG. 7 is a graph of the detection of the expression of ACE2, TMPRSS2, CD147 in normal human EPSC cells (hEGFC) (RT-qPCR);
FIG. 8 is a graph showing the results of detection of copy number of intracellular viral gene expression by RT-qPCR analysis after infection of normal human EPSC cells (hESCs) with SARS-CoV-2;
FIG. 9 is a graph showing the results of RT-qPCR detection of multipotent gene expression after SARS-CoV-2 infection of normal human EPSC cells (hESCs);
FIG. 10 is a graph showing the results of immunofluorescence detection of multipotent markers and viral protein expression following infection of normal human EPSC cells (hESCs) with SARS-CoV-2;
FIG. 11 is a graph showing the results of cell-associated factor and marker analysis (RT-qPCR) on day9 (Sb43_9) of SB43 induction of differentiation of normal human EPSC cells (EPSCs) into extraembryonal differentiation cells;
FIG. 12 is a graph showing the detection of expression of ACE2, TMPRSS2, CD147 (RT-qPCR) in Day4 and Day9 (Sb43_Day4 and Sb43_Day9) of SB43 induced extraembryonic differentiation of normal human EPSC cells (hECCs);
FIG. 13 is a graph showing the measurement of viral load in cell supernatants after day4 and day9 (Sb43_D4, sb43_D9) when the infection of SARS-CoV-2 with SB43 induced differentiation of normal human EPSC cells into extraembryonal differentiated cells;
FIG. 14 is a graph showing the comparison of viral load in cell supernatants after Day4 (SB 43 Day 4) when SARS-CoV-2 infection at 0.1 MOI induces differentiation of normal human EPSC cells into extraembryogenic differentiated cells with viral load of Caco2 cells and Vero E6 cells;
FIG. 15 is a graph showing the results of RT-qPCR analysis of the cases of intracellular viral replication of SARS-CoV-2 infection SB43 induced differentiation of normal human EPSC cells into extraembryonal differentiated cells on days 4 and 9 (Sb43_D4 and Sb43_D9);
FIG. 16 is an immunofluorescence confocal assay of Day4 (Sb43_Day4) of SARS-CoV-2 infection with SB43 inducing differentiation of normal human EPSC cells into extraembryogenic differentiated cells;
FIG. 17 is a graph of the results of analysis of viral gene copy number (RT-qPCR) of normal human EPSC cells (EPSCs) and ACE2 knockdown subcells (ACE-KO-EPSCs) after SARS-CoV-2 infection;
FIG. 18 is a graph of the detection of expression of (RT-qPCR) of normal human EPSC cells (WT) and ACE2 knockdown embryonic stem cell lineages (ACE-KO) after SB43 induction (day 4) ACE2, TMPRSS2, CD 147;
FIG. 19 is a graph comparing viral load in cell supernatants of normal human EPSC cells (WT) and ACE2 knockdown embryonic stem cell lineages (ACE-KO) after SB43 induction (day 4) of SARS-CoV-2 infection at 0.1 MOI;
FIG. 20 is a graph showing immunofluorescence confocal assay results of normal human EPSC cells (WT) and ACE2 knockdown subcells (ACE-KO) induced by SB43 (day 4) after infection with SARS-CoV-2 virus for 48 hr;
FIG. 21 is a diagram showing the detection of cell differentiation function markers of the following SB43 induction (day 4) of the normal human EPSC cell (WT) and ACE2 knockout embryonic stem cell subline (KO) (RT-qPCR);
FIG. 22 is a structural map of the gRNA plasmid (pKLV 2-U6sgRNA5 (BbsI) -PGKpuro2 ABFB-W);
FIG. 23 is a structural map of Cas9 plasmid (pKLV 2-EF 1. Alpha. -BstCAS 9-W).
Detailed Description
The present invention will be described in further detail with reference to the accompanying drawings, for the purpose of making the objects, technical solutions and advantages of the present invention more apparent.
1. Method for knocking out ACE2 gene in human expanded potential stem cells (hESCs)
As a first aspect of the present invention, the present invention provides a method for knocking out ACE2 gene in a hEPSC cell, comprising:
firstly, selecting human EPSC cells and culturing the human EPSC cells;
specifically, M1-hESC cells were taken,
M1-hESC cells were plated on SNL feeder cells, passaged every 3-5 days, i.e., washed with PBS, treated with EDTA-0.25% trypsin for 3-5 min, stopped with DMEM medium (M10) containing 10% fetal bovine serum, and the cell fluid was collected and centrifuged (300 g, 3 min). After removal of the supernatant, the hEPSC was resuspended. The hEPSC cells were seeded in hepsccm supplemented with 5 μ M Y27632 (tocoris, cat No. 1254) (the hepsccm used here is an N2B27 based medium).
The method of culturing human EPSC cells in the present invention is not limited to this, and other pretreatment methods and other media may be selected according to the specific conditions in the art to culture various human EPSC cells.
Secondly, sgRNA design and synthesis;
specifically, the ACE2 gene (trans: ACE 2-202ENST00000427411.2) is searched in Ensemble (https:// asia. Ensembl. Org/index. Html); according to the target sequence to be edited (generally the exon located at the front of comparison), the sequence is input into an online design tool (http:// crispr. Mit. Edu /), a design principle that 20bp and PAM sequence is NGG is selected, and the software automatically designs the sequence of gRNA and orders the gRNA. A number of alternative gRNA sequences are available. Such as:
gRNA1
hACE2-gRNA1-F：GAATAATGCTGGGGACAAA（SEQ ID No.1）
hACE2-gRNA1-R：TTTGTCCCCAGCATTATTC（SEQ ID No.2）
gRNA2
hACE2-gRNA2-F：CTCAGAAGACAAGAGCAAA（SEQ ID No.3）
hACE2-gRNA2-R：TTTGCTCTTGTCTTCTGAG （SEQ ID No.4）
gRNA3
hACE2-gRNA3-F： TGAGCACCATCTACAGTAC
hACE2-gRNA3-R： GTACTGTAGATGGTGCTCA
gRNA4
hACE2-gRNA4-F：CAGTTTAGACTACAATGAG
hACE2-gRNA4-R：CTCATTGTAGTCTAAACTG
gRNA5
hACE2-gRNA5-F：GTGGTCTTGAAAAATGAGA
hACE2-gRNA5-R：TCTCATTTTTCAAGACCAC
gRNA6
hACE2-gRNA6-F：ATGTGCACAAAGGTGACAA
hACE2-gRNA6-R：TTGTCACCTTTGTGCACAT
gRNA7
hACE2-gRNA7-F：CTAAGCATTTAAAATCCAT
hACE2-gRNA7-R：ATGGATTTTAAATGCTTAG
as a result, it was found that the off-target effect of gRNA1 and gRNA2 was small, fragment knockout was easy, and genotyping was easy (there was a difference distance of at least 100bp between the two sequences, so that two different bands appeared upon gel electrophoresis after knockout of the fragment, and thus genotyping was easy to conduct), so that the two gRNA sequences were selected.
Further, a forward oligonucleotide sequence was obtained by adding CACCG to the 5 '-end of the above gRNA, a reverse oligonucleotide sequence was obtained by adding AAAC to the 5' -end of the complementary strand, and an sRNA primer sequence was obtained by adding one C to the extreme end as follows:
sgRNA1
hACE2-sgRNA1-F：CACCGGAATAATGCTGGGGACAAA（SEQ ID No.5）
hACE2-sgRNA1-R：AAACTTTGTCCCCAGCATTATTCC（SEQ ID No.6）
sgRNA2
hACE2-sgRNA2-F：CACCGCTCAGAAGACAAGAGCAAA（SEQ ID No.7）
hACE2-sgRNA2-R：AAACTTTGCTCTTGTCTTCTGAGC（SEQ ID No.8）
forward and reverse oligonucleotide sequence primers were synthesized by Shanghai Biotechnology, respectively, and diluted to 100. Mu.M with 10-fold molar deionized water, and stored at 4 ℃.
(III) plasmid RNA construction
1. Annealing sgRNA primer to form double-stranded system
The forward oligonucleotide sequence primer (hACE 2-sgRNA1-F or hACE2-sgRNA 2-F) and the corresponding reverse oligonucleotide sequence primer ((hACE 2-sgRNA1-R or hACE2-sgRNA 2-R) are taken to form two pairs of systems, and denatured and annealed on a PCR instrument to obtain a double-stranded oligonucleotide chain, wherein the annealed double-stranded oligonucleotide chain contains the cohesive ends of BbsI.
Specifically, the denaturation and annealing system is overallThe product was 20. Mu.L, in which the forward oligonucleotide strand (100. Mu.M) was 1. Mu.L, and the reverse oligonucleotide strand (100. Mu.M) was 1. Mu.L, H 2 O 18μL。
The PCR instrument was run as follows: 95 ℃ for 10min;
in another embodiment of the invention, the PCR instrument operates as follows: 95 ℃ for 10min;70 ℃ for 10min;37 ℃ for 20min;25 ℃ for 20min.
2. Linearization of restriction enzyme gRNA Universal plasmid
Wherein, universal gRNA vector with U6 promoter and BbsI cleavage site is selected for BbsI cleavage. Preferably, pKLV2-U6sgRNA5 (BbsI) -PGKpuro2ABFB-W (pKLV 2-U6sgRNA for short) is used as a vector, the plasmid is digested on a PCR instrument, 1% agarose gel is used for electrophoresis after the digested plasmid is digested, and a Takara gel recovery kit is used for recovering DNA products after the gel of the target band is digested.
Specifically, the volume of the total system for cleavage was 100. Mu.L, wherein 10 XSmartCuffer 10. Mu.L, bbsI enzyme 3. Mu.L, pKLV2-U6sgRNA 10. Mu.g, ddH 2 And the balance of O.
Specifically, the PCR run program was: the enzyme is digested at 37deg.C for 6-8hr (or overnight).
3. Ligation of sgRNA with enzyme-tangential gRNA vector
The two pairs of annealed double-stranded oligonucleotide chains are connected with the pKLV2-U6sgRNA vector cut by BbsI in a PCR instrument, so that pKLV2-U6sgRNA1 and pKLV2-U6sgRNA2 recombinant sgRNA plasmids can be obtained respectively.
Specifically, the volume of the ligation total system was 10. Mu.L, wherein the double-stranded oligonucleotide strand obtained after annealing was 4.5. Mu.L, the linearized pKLV2-U6sgRNA plasmid was 0.5. Mu.L (> 50 ng/uL), and the Takara ligation mixture was 5. Mu.L.
Specifically, the PCR instrument is operated at 16℃of 1-2 hr, and is taken out and stored at 4 ℃.
4. Plasmid transformation and identification
1uL of the ligation product obtained in the above step was added to DH5a competent cells on ice, and after transformation for 30min, the bacteria were plated on ampicillin-positive (amp+) agarose gel (LB) plates. After overnight growth, positive cloning bacteria were picked up, placed in ampicillin positive LB solution, shaking the bacteria overnight at 37℃with a shaker, the plasmids were extracted with a Takara plasmid extraction kit and subjected to sequencing identification, and after identification, the pKLV2-U6sgRNA plasmids with correct sequencing were obtained (FIG. 22). Specifically, the plasmid corresponding to sgRNA1 is named as pKLV2-U6sgRNA1 plasmid, and the plasmid corresponding to sgRNA2 is named as pKLV2-U6sgRNA2 plasmid.
Wherein the total sequencing system was 15. Mu.L, wherein 1. Mu.L of the annealed double-stranded oligonucleotide strand, 1. Mu.L of the U6 primer and ddH 2 O13. Mu.L. Wherein,
the sequence of the U6 primer is as follows:
5’-GAGGGCCTATTTCCCATGATT-3’
similarly, cas9 plasmid (pKLV 2-EF 1. Alpha. -BstCAS 9-W) was used for the transformation and amplification, and stored at-20 ℃.
Fourth, transfecting the human EPSC cells with the mixed plasmid;
specifically, liposome transfection, nuclear transfection or electroporation transfection may be selected, but is not limited thereto.
Preferably, in the present invention, the electroporation technique is used for transfection, and the specific method is as follows:
when the hESC cell density reached 70-80%, electroporation was performed the next day. Mixed plasmids were prepared 5-10 min before treatment of hESCs [ plasmid pKLV2-EF 1. Alpha. -BstCAs 9-W (FIG. 23): the pKLV2-U6sgRNA1 plasmid: the pKLV2-U6sgRNA2 plasmid was used as a plasmid 2:1:1 into 200uL of transfection-specific MEM in an amount ranging from 4ug to 2ug or 10ug to 5ug interval, and then washing the hEPSC cells with PBS 2 times and EDTA-0.05% pancreatin for 10min, and then adding M10 medium to neutralize pancreatin. After centrifugation (300 g. Times.3 min) of the digested cells were collected, the supernatant was discarded. Will be 1X 10 6 Individual cells were resuspended in 200uL MEM medium containing the mixed plasmid and transferred to 0.4cm electroblots followed immediately by electroporation (BioRAD GenePulser,230V 500uF). Human EPSC medium (500 uL) and 10uM Rock inhibitor (Y27632) were then added, and the cells were gently blown into single cells and plated in 2-3 wells of a 6-well plate. After 24 hours, the culture was continued after changing to normal EPSC medium, blasticidin (BSD, 10 ug) was added, and puromycin was added the third dayScreening of the medicine of Puromycin, and stopping medicine after 3-4 days. Positive clones were picked 7-10 days later.
(V) DNA PCR detection of ACE2 knockout genomic phenotype
24 clones were picked and the genome of each clone was PCR amplified using unedited EPSC cells as a control. The amplification primers, amplification system and amplification procedure were as follows:
(1) Amplification primers: and designing a primer within 200-1000 bp outside the sgRNA sequence, wherein the primer is synthesized by a division company of biological engineering (Shanghai).
Specifically, the genotype identification primers were designed as follows:
ACE2-g1-geno-F：GTGGCCTGGTCACTCTTAAC（SEQ ID No.9）
ACE2-g1-geno-R：CAAATAAAGGCAGCTGCTGTG（SEQ ID No.10）
(2) Amplification system: total 20. Mu.L, wherein Takara mixed buffer 10. Mu.L, ACE2-g1-geno-F (10. Mu.M) 0.8. Mu.L, ACE2-g1-geno-R (10. Mu.M) 0.8. Mu.L, genomic DNA of the parent cell or transfected cell (ACE 2-KO) 0.4. Mu.L, ddH 2 O 8uL。
(3) Amplification procedure: 95 ℃ for 30s;64 ℃ for 30s, 0.4 ℃ per cycle from the fifth cycle; 72 ℃ for 1 min) 35 cycles; 72 ℃ for 3min; stored at 4 ℃.
The detection results are shown in Table 1 and FIG. 1; as can be seen from the table: sanger sequencing identified that the PCR gel recovery fragment showed a 148bp knockout between two gRNAs of the second coding exon of the ACE2 gene, and 4 out of the 24 clones screened were heterozygous knockouts, and 5 were homozygous knockouts, indicating high efficiency of ACE2 gene editing in hESCs. In FIG. 1, only the band of about 418bp is non-edited cells (WT), only the band of 270bp is double allele-edited cells (DKO), and both the band of about 418bp and the band of 270bp are single allele-edited cells.
Wherein, the genome sequence of the WT cell in the truncated sequencing result diagram is:
GTCATTTCAGAATAATGCTGGGGACAAATGGTCTGCCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGTATCCACTACAAGAAATTCAGAATCTCACAGTCAAGCTTCAGCTGCAGGCTCTTCAGCAAAATGGGTCTTCAGTGCTCTCAGAAGACAAGAGCAAACGGGTACGTTTGTGAACATTTTAGCATTGATC
the sequence after the ACE2 is knocked out in the sequencing result diagram is intercepted as follows:
GTCATTTCAGAATAATGCTGGGGAC GTTTGTGAACATTTTAGCATTGATC
by comparing the sequences, the knocked-out sequence is 148bp, and the sequence is:
AAATGGTCTGCCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGTATCCACTACAAGAAATTCAGAATCTCACAGTCAAGCTTCAGCTGCAGGCTCTTCAGCAAAATGGGTCTTCAGTGCTCTCAGAAGACAAGAGCAAACGGGTAC
it can be seen that a pair of grnas, in which the gRNA1 sequence (GAATAATGCTGGGGACAAA) was clipped by Cas9 from the last three AAA bases to gRNA2 (CTCAGAAGACAAGAGCAAA) followed by 7 bp (CGGGTAC).
TABLE 1 PCR gel recovery fragment Table after Sanger sequencing ACE2 Gene knockout
(VI) Western immunoblotting Western Blot identification
Cell samples were fixed with 4% paraformaldehyde (Sigma, cat. No. P6148) for 15 min at room temperature, 0.1% Triton-100 (Sigma, cat. No. T8787) was permeabilized for 30min, then incubated with 10% donkey serum (Sigma, cat. No. D9663) and 1% BSA (Sigma, cat. No. A2153) for 1hr and then incubated with primary antibodies overnight at 4 ℃. After incubation of the fluorescent secondary antibodies for 1hr at room temperature, nuclei were stained with 10 μg/mL DAPI (Thermo Fisher Scientific, cat. No. 62248) for 10mins and then observed under a fluorescence microscope.
The detection results are shown in fig. 2, and the ACE2 gene knockout effect is obvious from the graph.
(seventh) fluorescent quantitative PCR (RT-qPCR)
RNeasy Mini Kit (Qiagen, cat. No. 74104) extracts total RNA and uses Kit Fastking gDNA Dispelling RT SuperMix (Tiangen, cat. No. KR 118) for reverse transcription on PCR instrument to cDNA, powerUp ™ SYBR ™ Green Master Mix (Applied Biosystems) for detecting SARS-CoV-2 and other marker gene expression in cells.
Specifically, the primer sequences for PCR detection according to the present invention are shown in the following table:
TABLE 2 PCR detection primer sequence listing
As a result, as shown in FIG. 3, it can be seen from the figure that ACE2-KO cells from which the ACE2 gene was knocked out were expressed negatively with CDX2, ELF5, MIX1, FOXA2, SOX17, GATA4, PAX6, NES, SOX1 in normal human EPSC cells (hESCs); OCT4 and NANOG are expressed positively, and there is no difference between the two. Suggesting that ACE2 knockout does not affect the pluripotency of EPSC.
Eighth flow cytometry
Cells to be tested were digested with 0.25% pancreatin/EDTA at 37 ℃ for 2-3 minutes, and the digested cells were filtered through a40 μm nylon mesh (Corning, cat No. 352235) to remove debris. The centrifuged cells were fixed with a fixative (BD Cytofix, cat. No. 554655), and the PBS-eluted cells were kept at 4℃and stored in PBS+0.1% NaN3 (Sigma, cat. No. 199931) +5% FBS (Gibco, cat. No. 10270) for detection in the upper machine. Analysis was performed using ACEA NovoCyte Quanteon. 488nm (530/30 band pass filter) and 561nm (610/20 band pass filter) channels were used to detect FITC and remove autofluorescence. A405 nm (445/45 band filter) channel was used to detect DAPI-positive cells. FACS data were analyzed using Flowjo. The antibodies were Alexa Fluor 488 anti-human/mouse SSEA-3 antibody (Biolegend, cat. No. 330305) and Alexa Fluor 488 anti-human/mouse TRA-1-60 antibody (Biolegend, cat. No. 330613).
As shown in FIG. 4, it can be seen that SSEA3 and TRA-1-60 were positively expressed in normal human EPSC cells (EPSCs) and ACE2-KO cells from which the ACE2 gene was knocked out. Suggesting that the pluripotency of the cells after knocking out the ACE2 gene and the expression of the differentiation genes are not significantly different from each other.
In conclusion, the method for knocking out ACE2 in the humanized EPSC cell provided by the invention can effectively knock out the gene of ACE2 in the hESSC cell, has no influence on the expression of other genes after knocking out, and has no obvious difference with the parent hESSC cell.
It should be noted that the application of the method for knocking out the ACE2 gene in the present invention is not limited to human expansion potential stem cells (hEPSC cells), but can be applied to other pluripotent stem cells, such as EPSC cells, iPSC cells, etc.
2. Construction of embryonic stem cell subline for knocking out ACE2 gene and establishment of humanized differentiated cell model
Construction of an ACE2 Gene knockout embryonic Stem cell subline
Cells from which electrotransformation was completed were plated in six well plates coated with gelatin and supplemented with 2mL EPSC medium and 10. Mu. M Y-27632 at 37℃with 5% CO 2 Is continuously cultured in the cell incubator. After 24hr, the normal EPSC medium is changed, blasticidin (BSD) and puromycin are added for drug screening, and drug screening is stopped after 48-96 hours. Clone formation was seen under objective lens 8-10 days after electrotransformation. Observing in an ultra-clean bench through a microscope, adjusting the P200 pipettor to 45 mu L, picking single clone by using a gun head with a filter element, transferring the single clone into a small hole of a 96-well plate, digesting 0.05% of pancreatin into single cells, and continuously culturing to obtain the embryonic stem cell subline.
(II) establishment of humanized differentiated cell model for knocking out ACE2 Gene
Isolation of ACE2 knocked-out human EPSC cells (ACE 2-KO-hESCs) with EDTA-0.25% trypsin and isolation of 0.1X10 6 The cells were seeded in six well plates. Cells were cultured for 1 day using 20% KSR medium supplemented with 5. Mu.g M Y27632. From day 2, 10 μM SB431542 was added to 20% KSR medium to promote extraembryonic cell differentiation, i.e., to obtain an extraembryonic differentiated human derived differentiated cell model. And cells were collected at specific time points (day 4 and day 9) for analysis.
Amplification and infection of SARS-Cov-2
The SARS-Cov-2 strain (SARS-Cov-2 HKU-001a; genBank accession number MT 230940) was isolated from a nasopharyngeal aspirate of a patient of hong Kong-COVID-19 and propagated by amplification using VeroE6 cells. The virus titer was determined by plaque assay of VeroE6 cell culture supernatants. All experiments involving live SARS-CoV-2 were performed following the approved standard procedures for the biological safety tertiary facilities of the Mary Hospital, university of hong Kong.
The hECCs, ACE 2-KO-hECCs were seeded 1 day before infection, and other types of differentiated cells were seeded according to their appropriate time points. On the day of infection, cells were washed with PBS and then infected with SARS-CoV-2 at different titers (MOI). After 1 hour of virus infection, the cell minimal medium was changed to complete medium. Cell pathology was observed daily with a light microscope and cell supernatants and cell lysates were collected at appropriate time points for quantitative RT-PCR to assess viral load.
(IV) viral load detection
Supernatants were collected and infected cells lysed at designated time points and viral RNA extraction was performed using the QIAamp viral RNA mini kit (QIAGEN) or the QIARneasy mini kit (QIAGEN). After the culture supernatant was lysed with 560. Mu.L of AVL buffer, total RNA was subsequently extracted using QIAamp viral RNA mini kit (QIAGEN). For analysis of viral replication kinetics, quantification was performed using the extracted RNA by a one-step QuantiNova probe RT-PCR kit (QIAGEN), i.e., 20. Mu.L of a mixture reaction solution (10. Mu.L containing 2 XQuantiNova probe RT-PCR Master Mix, 0.2. Mu.L of QuantiNova probe RT-PCR Master Mix, 10. Mu.L of each of the forward and reverse primers, 1.6. Mu.L of 10. Mu.M probe, 0.4. Mu.L of 5. Mu.L of RNA, 1.2. Mu.L of RNase-free water) was prepared, followed by reverse transcription at 45℃for 10 minutes, denaturation at 95℃for 5 minutes, incubation at 95℃for 5 seconds, incubation at 55℃for 30 seconds, 45 cycles, and cooling at 40℃for 30 seconds. Primers for the RNA-dependent RNA polymerase/helicase (RdRP/Hel) gene region of SARS-CoV-2 are shown in Table 2, using the probe sequences as follows:
5’-FAM TTAAGATGTGGTGCTTGCATACGTAGAC-IABkFQ-3’。
(V) research on gene expression and viral infection of various cells
(1) Human EPSC cells (hECCs/EPSCs)
Human EPSC cells (M1-hESCs) were expanded in culture and their stem and pluripotency markers were identified using RT-qPCR (KLF 4, NANOG, SOX2 and OCT 4) and immunofluorescence (OCT 4, SSEA3, SSEA 4) (FIGS. 5, 6). RT-qPCR then detects the expression of ACE2, TMPRSS2 and CD147 in human EPSC cells, and finds that: ACE2 was barely detectable on hEPSC cells, whereas the expression levels of TMPRSS2 and CD147 were higher (fig. 7).
Further, virus infection experiments were performed on human EPSC cells, and after infection of hESCs with SARS-CoV-2, the copy number of virus gene expression in the cells was analyzed by RT-qPCR (FIG. 8), immunofluorescence was used to detect multipotential markers and virus protein expression (FIG. 9), and RT-qPCR was used to detect multipotential gene expression (FIG. 10); the discovery is as follows: the hESCs were not susceptible to SARS-CoV-2, and the expression of the pluripotent gene was unchanged after 48hr incubation of the virus. This suggests: it is likely that it is almost not associated with ACE2 expression, whereas TMPRSS2 and CD147 expressed by human EPSC cells do not appear to mediate viral invasion.
(2) Extraembryonic differentiated cells (SB 43-hESCs) prepared from humanized EPSC cells
The EPSCs can be induced to differentiate into extraembryogenic differentiated cells (SB 43-hECCs) by using TGF-beta inhibitor (SB 431542) for 10-12 days; RT-PCR identified the expression of extraembryogenic differentiation cell related markers (e.g., SDC1, ERVW, GATA3, KRT7, CGB) (FIG. 11), confirming the high expression of these markers. The RT-qCR assay showed that the hEPSC was treated with SB43 and that ACE2 expression was gradually increased during the gradual differentiation into extraembryonic differentiated cells, while TMPRSS2 and CD147 were consistently higher than ACE2 and at a more stable level (fig. 12).
Further, virus infection experiments were performed on SB43 differentiated cells to examine the viral load in the supernatant of SB43 differentiated model cells (fig. 13); when SARS-CoV-2 infection at 0.1 MOI was infected with hEPSC (SB 43 Day 4) after 4 days of differentiation from SB43, the viral load in the supernatant was compared to that of Caco2 and VeroE6 cell lines (fig. 14) and found to be lower than VeroE6 cells but higher than that of colon adenoma cells Caco 2. RT-qPCR analysis of the intracellular viral replication of the SB43 differentiation model (day 4 and day9 of differentiation) for SARS-CoV-2 infection (FIG. 15) and immunofluorescence confocal results of virus-infected cells (FIG. 16) also confirmed the results.
From experiments with parental hESCs/EPSCs and SB 43-hESCs it can be seen that: the hESCs which do not express ACE2 do not infect viruses; whereas SB 43-hESCs expressing ACE2 are susceptible to viruses. This primarily suggests from the expression level: ACE2 plays a major role in SB43-hEPSC virus infection compared to TMPRSS2 and CD147.
(3) hECCs subcellular (ACE 2-KO-hECCs) with knock-out ACE2 gene
Human hESCs and ACE 2-KO-hESCs were cultured and SARS-CoV-2 virus infection experiments (0.1 MOI) were performed, and RT-qPCR analysis of SARS-CoV-2 virus gene copy numbers showed that ACE 2-KO-hESCs cells were similar to human Expanded Potential Stem Cells (EPSCs) and still insensitive to viruses (FIG. 17).
(4) SB43 induced differentiation human differentiation cell model of ACE 2-KO-hESCs (SB 43-ACE 2-KO-hESCs)
Differentiation of normal hESCs by SB43 and differentiation of ACE 2-KO-hESCs into extraembryogenic differentiated cells (day 4), RT-qPCR analysis of SARS-CoV-2 virus and ACE2, TMPRSS2 and BSG/CD147 expression (FIG. 18) found that no virus expression was detected by the ACE2-KO group, while the group of cells still expressed TMPRSS2 and BSG/CD147.
The viral load was measured in supernatants of infected virus cells (2 hr, 24hr, 48hr, 72 hr) at different times, and it was found that the extracellular differentiated cell viral load of ACE2-KO cell differentiation was significantly reduced (fig. 19), with little infection with virus.
Immunofluorescence confocal detection 48hr after infection revealed that SB 43-differentiated EPSC cells (day 4) expressed ACE2, extra-embryonic differentiation cell markers and SARS-CoV-2N protein, while extra-embryonic differentiation cells differentiated in ACE2-KO cells expressed extra-embryonic differentiation cell markers but did not express viral N protein and ACE2 (FIG. 20), suggesting that the absence of ACE2 is an important cause of the insusceptibility of the extra-embryonic differentiation human differentiation cell model responsible for ACE 2-KO-hESCs cell differentiation.
hESCs and ACE 2-KO-hESCs were subjected to SB 43-induced differentiation (day 4) and RT-qPCR analysis for extraembryonic differentiated cell marker expression. The differentiation potential of the ACE2-KO cells after knockout is not changed; however, after viral infection, the expression levels of the individual markers in the extraembryogenic differentiated cells vary. CGB expression increased, ERVW1 significantly increased, SDC1 significantly increased, KRT7 significantly increased, TP63 did not significantly change, TEAD4 decreased significantly (fig. 21).
The experiment shows that the humanized EPSC embryonic stem cell subline with the ACE2 gene knocked out still has the extra-embryo development capability and has no obvious difference with the conventional humanized expansion potential stem cell. The embryonic stem cell subline can be continuously induced to develop into an extraembryonic differentiation human differentiation cell model which is not infected by the novel coronavirus.
Meanwhile, since the totipotency of ACE 2-KO-hESCs is not significantly different from that of the parent cells, it is suggested that the embryonic stem cell subline is also likely to be infected by the new coronavirus when it is developed into other intra-embryo humanized cell/tissue/organoid models. Therefore, the embryonic stem cell subline for knocking out ACE2 has very wide application prospect in the aspects of preparing various differentiated cell products or screening medicines, evaluating vaccines for resisting COVID-19 and the like.
The foregoing description is only a preferred embodiment of the present invention, and it is not intended to limit the scope of the claims, so that the equivalent changes of the claims are included in the scope of the present invention.
Sequence listing
<110> Stem cell switching research center Co., ltd
<120> ACE2 gene knockout embryonic stem cell subline, construction method and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gaataatgct ggggacaaa 19
<210> 2
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
tttgtcccca gcattattc 19
<210> 3
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
ctcagaagac aagagcaaa 19
<210> 4
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
tttgctcttg tcttctgag 19
<210> 5
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
caccggaata atgctgggga caaa 24
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
aaactttgtc cccagcatta ttcc 24
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
caccgctcag aagacaagag caaa 24
<210> 8
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
aaactttgct cttgtcttct gagc 24

Claims (11)

1. A construction method of an embryonic stem cell subline for knocking out an ACE2 gene, which is characterized in that the CRISPR/Cas9 technology is adopted to construct the embryonic stem cell subline for knocking out the ACE2 gene, and the construction method comprises the following steps: adopting a pair of sgRNAs with nucleotide sequences shown as SEQ ID No. 5-8, cloning the sgRNAs onto a gRNA plasmid vector respectively, co-transfecting a humanized expansion potential stem cell with a Cas9 plasmid to obtain a recombinant cell, and culturing the recombinant cell to obtain an embryonic stem cell subline with an ACE2 gene knocked out;
the application of the ACE2 gene knockout embryonic stem cell subline in any one of the following (1) to (4):
(1) Application in establishing a humanized differentiated cell model for knocking out ACE2 genes;
(2) Use in establishing stem cell-induced anti-covd-19 organoids;
(3) The application of the polypeptide in preparing exosomes of embryonic stem cell sublines for knocking out ACE2 genes;
(4) The application of the anti-COVID-19 medicines in preparation, screening and evaluation.
2. A method for establishing a humanized differentiated cell model for knocking out an ACE2 gene is characterized by cloning sgRNA with a nucleotide sequence shown as SEQ ID No. 5-8 on a plasmid vector respectively, co-transfecting a humanized expansion potential stem cell with a Cas9 plasmid to obtain a recombinant cell, amplifying the recombinant cell, and inducing and differentiating the recombinant cell into an extraembryonic differentiated cell under the action of a TGF-beta inhibitor to obtain the humanized differentiated cell model for knocking out the ACE2 gene;
the humanized differentiated cell model for knocking out the ACE2 gene is applied to any one of the following (1) - (3):
(1) Use in establishing stem cell-induced anti-covd-19 organoids;
(2) The application of the polypeptide in preparing exosomes of embryonic stem cell sublines for knocking out ACE2 genes;
(3) The application in preparing, screening and evaluating the anti-COVID-19 medicine.
3. The method of claim 1 or 2, wherein the gRNA plasmid vector is pKLV2-U6sgRNA.
4. The method of claim 1 or 2, wherein the Cas9 plasmid is pKLV2-EF1 a-BsdCas 9-W plasmid.
5. The method of claim 1 or 2, wherein the sgRNA is linked to the gRNA plasmid vector by bbsi cleavage.
6. The method of claim 1 or 2, wherein the transfection is electrotransfection.
7. The method according to claim 1 or 2, wherein two pairs of sgrnas with nucleotide sequences as set forth in SEQ ID nos. 5 to 8 are cloned into a pKLV2-U6sgRNA plasmid vector linearized after the BbsI cleavage, respectively, to obtain a pKLV2-U6sgRNA1 plasmid and a pKLV2-U6sgRNA2 plasmid, and the pKLV2-U6sgRNA1 plasmid, the pKLV2-U6sgRNA2 plasmid and the pKLV2-EF1 α -BsdCas9-W plasmid are uniformly mixed according to a predetermined ratio to obtain a mixed plasmid, and the mixed plasmid is used to transfect human expanded potential stem cells.
8. The method of claim 7, wherein the pKLV2-EF1 α -BsdCas9-W plasmid, pKLV2-U6sgRNA1 plasmid, and pKLV2-U6sgRNA2 plasmid are in a weight ratio of: (4-10): (2-5): (2-5).
9. A method according to claim 2, wherein the recombinant cells are induced to differentiate into extraembryogenic differentiated cells using the TGF- β inhibitor SB 431542.
10. An ACE2 gene knockout embryonic stem cell subline constructed by the method of claim 1, 3, 4, 5, 6, 7 or 8.
11. A model of an ACE2 gene knockout humanized differentiated cell created by the method of any one of claims 2 to 9.
CN202111041730.2A 2021-09-07 2021-09-07 Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof Active CN113897363B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111041730.2A CN113897363B (en) 2021-09-07 2021-09-07 Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111041730.2A CN113897363B (en) 2021-09-07 2021-09-07 Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof

Publications (2)

Publication Number Publication Date
CN113897363A CN113897363A (en) 2022-01-07
CN113897363B true CN113897363B (en) 2024-03-29

Family

ID=79188692

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111041730.2A Active CN113897363B (en) 2021-09-07 2021-09-07 Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof

Country Status (1)

Country Link
CN (1) CN113897363B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116376972A (en) * 2023-01-04 2023-07-04 郑州大学 Human embryonic stem cell gene knockout method based on CRISPR/Cas9 technology
CN117286094A (en) * 2023-09-27 2023-12-26 中国人民解放军军事科学院军事医学研究院 Preparation method and application of exosome derived from human organ

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112143704A (en) * 2020-09-17 2020-12-29 湖南普拉特网络科技有限公司 Cell strain capable of indicating ACE2 expression level and construction method and application thereof
CN112646780A (en) * 2020-11-22 2021-04-13 翁炳焕 hACE2 knockout novel coronavirus gene silencing stem cell
CN112680466A (en) * 2021-01-21 2021-04-20 广州派真生物技术有限公司 Animal model expressing humanized ACE2 and application thereof
CN113355323A (en) * 2020-03-06 2021-09-07 生物岛实验室 Preparation method and application of humanized ACE2 gene modified mouse model
CN113355325A (en) * 2020-03-06 2021-09-07 中国科学院广州生物医药与健康研究院 Preparation method and application of humanized ACE2 gene modified mouse embryonic stem cell model
CN113801852A (en) * 2021-10-18 2021-12-17 齐齐哈尔医学院 GPD 1L-deleted human embryonic stem cell strain and construction method and application thereof
CN115261336A (en) * 2022-06-06 2022-11-01 干细胞转化研究中心有限公司 Application of human-derived extra-embryonic trophoblast cell model in efficient virus preparation, detection and drug screening
WO2022261293A1 (en) * 2021-06-09 2022-12-15 The Regents Of The University Of California Lung organoid model and method of use

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11773391B2 (en) * 2020-04-01 2023-10-03 University of Pittsburgh—of the Commonwealth System of Higher Education Therapeutic and diagnostic target for SARS-CoV-2 and COVID-19
US20230080265A1 (en) * 2021-08-26 2023-03-16 Synbal, Inc. Humanized mouse models for study of covid-19

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113355323A (en) * 2020-03-06 2021-09-07 生物岛实验室 Preparation method and application of humanized ACE2 gene modified mouse model
CN113355325A (en) * 2020-03-06 2021-09-07 中国科学院广州生物医药与健康研究院 Preparation method and application of humanized ACE2 gene modified mouse embryonic stem cell model
CN112143704A (en) * 2020-09-17 2020-12-29 湖南普拉特网络科技有限公司 Cell strain capable of indicating ACE2 expression level and construction method and application thereof
CN112646780A (en) * 2020-11-22 2021-04-13 翁炳焕 hACE2 knockout novel coronavirus gene silencing stem cell
CN112680466A (en) * 2021-01-21 2021-04-20 广州派真生物技术有限公司 Animal model expressing humanized ACE2 and application thereof
WO2022261293A1 (en) * 2021-06-09 2022-12-15 The Regents Of The University Of California Lung organoid model and method of use
CN113801852A (en) * 2021-10-18 2021-12-17 齐齐哈尔医学院 GPD 1L-deleted human embryonic stem cell strain and construction method and application thereof
CN115261336A (en) * 2022-06-06 2022-11-01 干细胞转化研究中心有限公司 Application of human-derived extra-embryonic trophoblast cell model in efficient virus preparation, detection and drug screening

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
A Human Pluripotent Stem Cell-based Platform to Study SARS-CoV-2 Tropism and Model Virus Infection in Human Cells and Organoids;Yang L等;《Cell Stem Cell》;第27卷(第1期);第125-136页 *
A placental model of SARS-CoV-2 infection reveals ACE2-dependent susceptibility and differentiation impairment in syncytiotrophoblasts;Chen J等;《Nature Cell Biology》;第25卷(第8期);第1223-1234页 *
Establishment of porcine and human expanded potential stem cells;Gao X等;《Nature Cell Biology》;第21卷(第6期);摘要、第9页第2段和Fig.8 *
Expression of SARS-CoV-2 receptor ACE2 and the protease TMPRSS2 suggests susceptibility of the human embryo in the first trimester;Weatherbee BAT等;《Open Biology》;第10卷(第7期);200162 *
Homo sapiens angiotensin converting enzyme 2（ACE2）， RefSeqGene on chromosome X;Onabajo OO等;《GenBank Database》;Acession NO.NG_012575 *
Human early syncytiotrophoblasts are highly susceptible to SARS-CoV-2 infection;Ruan D等;《Cell Reports Medicine》;第3卷(第12期);Article 100849 *
人扩展多能干细胞衍生心肌细胞促进大鼠心肌梗死功能修复;李俐;《中国博士学位论文全文数据库(电子期刊) 医药卫生科技辑》;DOI: 10.27130/d.cnki.ghubu.2022.000573 *
应用CRISPR/Cas9技术制备Ace2基因敲除小鼠模型及基因型的鉴定;刘婵等;《生理学报》;第71卷(第4期);第588–596页 *

Also Published As

Publication number Publication date
CN113897363A (en) 2022-01-07

Similar Documents

Publication Publication Date Title
JP6603721B2 (en) Endonuclease targeting blood coagulation factor VIII gene and composition for treating hemophilia containing the same
CN113897363B (en) Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof
WO2016197361A1 (en) Method for specific knockout of swine ggta1 gene using crispr-cas9 specificity, and sgrna used for specifically targeting ggta1 gene
JP7385281B2 (en) Method for producing low antigenicity cells
WO2016197354A1 (en) Crispr-cas9 method for specific knockout of swine pdx1 gene and sgrna for use in targeting specifically pdx1 gene
Borca et al. The L83L ORF of African swine fever virus strain Georgia encodes for a non-essential gene that interacts with the host protein IL-1β
WO2016197360A1 (en) Method for specific knockout of swine gfra1 gene using crispr-cas9 specificity, and sgrna used for specifically targeting gfra1 gene
WO2016197356A1 (en) Method for knockout of swine sla-2 gene using crispr-cas9 specificity, and sgrna used for specifically targeting sla-2 gene
AU2012343826A1 (en) Haploid cells
JP2020532291A (en) Scarless genome editing by two-step homologous recombination repair
CN106636154B (en) sgRNA screening system and method
CN115261336B (en) Application of human extraembryonal trophoblast cell model in efficient virus preparation, detection and drug screening
Gladue et al. Interaction of structural core protein of classical swine fever virus with endoplasmic reticulum-associated degradation pathway protein OS9
EP4217472A1 (en) Attb cell line, transgenic cell lines derived therefrom, and methods of making the same
CN110893240B (en) Application of NME2 gene in inhibiting avian reovirus replication
KR101658135B1 (en) Endonuclease for Targeting blood coagulation factor and Use Thereof
US20200008405A1 (en) Methods for producing hypo-allergenic cats using gene editing technology
Afanassieff et al. Generation of induced pluripotent stem cells in rabbits
EP3601530A1 (en) Method of generating 2 cell-like stem cells
Dormiani et al. Rational development of a polycistronic plasmid with a CpG-free bacterial backbone as a potential tool for direct reprogramming
Surma et al. Selection-Free Non-Viral Method Revealed Highly Efficient Crispr-Cas9 Genome Editing of Human Pluripotent Stem Cells Guided by Cellular Autophagy
CN114457034A (en) Pluripotent stem cell derivative for expressing IL-1 blocker and application thereof
CN115948343A (en) Steady transfer cell strain for expressing rabies virus glycoprotein and construction method and application thereof
KR20230000662A (en) Generation of immunocompatible cells by serotype-editing in human leukocyte antigen
CN117384853A (en) Universal cell for expressing PVR and preparation method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant