CN113897363A - ACE2 gene knockout embryonic stem cell subline, construction method and application thereof - Google Patents

ACE2 gene knockout embryonic stem cell subline, construction method and application thereof Download PDF

Info

Publication number
CN113897363A
CN113897363A CN202111041730.2A CN202111041730A CN113897363A CN 113897363 A CN113897363 A CN 113897363A CN 202111041730 A CN202111041730 A CN 202111041730A CN 113897363 A CN113897363 A CN 113897363A
Authority
CN
China
Prior art keywords
plasmid
stem cell
ace2 gene
ace2
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111041730.2A
Other languages
Chinese (zh)
Other versions
CN113897363B (en
Inventor
刘澎涛
刘芳
阮德功
谭家奇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Stem Cell Transformation Research Center Co ltd
Original Assignee
Stem Cell Transformation Research Center Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Stem Cell Transformation Research Center Co ltd filed Critical Stem Cell Transformation Research Center Co ltd
Priority to CN202111041730.2A priority Critical patent/CN113897363B/en
Publication of CN113897363A publication Critical patent/CN113897363A/en
Application granted granted Critical
Publication of CN113897363B publication Critical patent/CN113897363B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/485—Exopeptidases (3.4.11-3.4.19)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/17—Metallocarboxypeptidases (3.4.17)
    • C12Y304/17023—Angiotensin-converting enzyme 2 (3.4.17.23)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5073—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/15—Transforming growth factor beta (TGF-β)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • C12N2503/02—Drug screening
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Plant Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Reproductive Health (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Transplantation (AREA)
  • Vascular Medicine (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a method for knocking out ACE2 gene in a pluripotent stem cell, which comprises the steps of cloning sgRNA with a pair of nucleotide sequences shown as SEQ ID No. 5-8 on plasmid vectors respectively, and then co-transfecting the sgRNA with Cas9 plasmid to the pluripotent stem cell. The invention also discloses a pair of sgRNA, plasmid and complete set of plasmid adopted by the knockout method, a construction method of an ACE2 gene knockout embryonic stem cell subline, and an establishment method of an ACE2 gene knockout humanized differentiated cell model. The double gRNA knockout method on the pluripotent stem cells has the advantages of high knockout efficiency and easiness in operation. The embryonic stem cell sublines constructed based on the knockout method can be developed into any human cell/tissue/organoid model free from infection of new coronavirus, and have extremely important significance in research and development of medicines and vaccines for treating the new coronavirus.

Description

ACE2 gene knockout embryonic stem cell subline, construction method and application thereof
Technical Field
The invention relates to the technical field of gene editing and stem cell differentiation, in particular to an ACE2 gene knockout embryonic stem cell subline, a construction method and application thereof in preparation, screening and evaluation of vaccines and medicines for resisting new coronaviruses.
Background
The global outbreak of COVID-19 has presented a significant challenge to the world's economy and public health. SARS-CoV-2 is the main pathogenic agent of new coronary patients, and the spike protein (S protein) is the key protein for mediating virus invasion into host cells. It was found that the novel coronavirus entered the host cell after binding to the ACE2 receptor. Single cell sequencing data found that ACE2 protein was significantly expressed in alveolar cells. It has also been found that the ACE2 protein is highly aggregated in nasal epithelial cells. Therefore, ACE2 plays a major role in new coronavirus infection.
In the existing research process of vaccines and medicines of the novel coronavirus, an animal model is generally adopted for verification. However, the difference between animals and human bodies is still large, and the results of various mechanism researches or drug experiments in the animal bodies cannot truly reflect the human body conditions, so that the existing vaccines generated by the animals still have more adverse reactions. Researchers also adopt an organ chip technology to establish a new coronavirus infection model based on a tissue level, and a series of pathophysiological changes such as lung tissue barrier injury, immune cell adhesion, inflammatory factor release, lung microvascular endothelial cell injury and the like caused by new coronavirus infection are simulated. In addition, researchers have also studied new coronaviruses using organoid models derived from embryonic stem cells or induced pluripotent stem cells. These models are closer to the human state than animal models, but are still difficult to establish. How to establish the characteristics of short modeling time, low consumption, human source and the like, and the human source differentiated cell model for rapidly developing the aspects of virus pathogenesis, virus propagation, rapid drug test and the like is an important path for overcoming the virus. In addition, many experimental models for studying new coronavirus infection currently use methods of overexpression of ACE2 gene, but this does not represent the true function of ACE2, because the function of the overexpressed gene is different from that produced at the actual expression level of cells. Therefore, it is necessary to construct ACE2 gene knockout cell lines for validation.
Expanded Potential Stem Cells (EPSCs) are novel embryonic stem cells, can be developed into any type of tissue cells, and have extremely important prospects in the aspects of research and treatment of diseases. According to the findings of literature search, no method for knocking out ACE2 gene in embryonic stem cells so as to establish ACE2 gene knocked-out dry embryonic stem cell sublines exists so far, and no related report on differentiation capacity after knocking out the embryonic stem cells exists.
The applicant found through experiments that human EPSC cells (hEPSC) do not express ACE2 and are not susceptible to new coronaviruses; the fact that ACE2 is expressed on extra-embryonic differentiated cells and is susceptible to new coronavirus not only suggests that ACE2 plays a major role in infecting new coronavirus to EPSC extra-embryonic differentiated cells, but also indicates that EPSC may express ACE2 and be susceptible to new coronavirus in subsequent differentiation, so that an ESPC embryonic stem cell subline with ACE2 gene knocked out is required to be established first if various human-derived differentiated cell models or organoid models differentiated from EPSC are to be protected from the risk of infection of new coronavirus, or various cell products (including exosomes and the like) prepared from differentiated EPSC or gene-edited EPSC are used. In view of the above reasons, the construction of ACE2 gene knockout embryonic stem cell sublines in EPSC has important application value.
Disclosure of Invention
The technical problem to be solved by the invention is to provide a method for knocking out ACE2 gene in pluripotent stem cells, which has high knocking-out efficiency and low control difficulty.
The invention also aims to solve the technical problem of providing a method for constructing the ACE2 gene knockout embryonic stem cell subline.
The invention also aims to solve the technical problem of providing a method for establishing a human-derived differentiated cell model with an ACE2 gene knocked out.
In order to solve the above technical problems, the present invention provides a method for knocking out ACE2 gene in pluripotent stem cells, comprising: a pair of sgRNAs with nucleotide sequences shown as SEQ ID No. 5-8 are respectively cloned on gRNA plasmid vectors and then cotransfected with a Cas9 plasmid into the pluripotent stem cells.
As an improvement of the technical scheme, the pluripotent stem cells are EPSC cells or iPSC cells.
As an improvement of the technical scheme, the pluripotent stem cells are human expanded potential stem cells.
Correspondingly, the invention also provides a construction method of the ACE2 gene knockout embryonic stem cell subline, which comprises the following steps: an ACE2 gene knockout embryonic stem cell subline is constructed by using a CRISPR/Cas9 technology, and the construction method comprises the following steps: a pair of sgRNAs with nucleotide sequences shown as SEQ ID No. 5-8 are adopted, after the sgRNAs are respectively cloned on a gRNA plasmid vector, the sgRNAs and a Cas9 plasmid are cotransfected with a human expansion potential stem cell to obtain a recombinant cell, and the recombinant cell is cultured to obtain an embryonic stem cell subline with the ACE2 gene knocked out.
Correspondingly, the invention also provides a method for establishing a human-derived differentiated cell model with the ACE2 gene knocked out, which comprises the following steps: the method comprises the steps of cloning sgRNAs with nucleotide sequences shown as SEQ ID No. 5-8 on plasmid vectors respectively, co-transfecting a humanized expansion potential stem cell with a Cas9 plasmid to obtain a recombinant cell, amplifying the recombinant cell, and inducing and differentiating the recombinant cell into an extra-embryonic differentiation cell under the action of a TGF-beta inhibitor to obtain an extra-embryonic differentiation humanized differentiation cell model with the ACE2 gene knocked out.
As an improvement of the technical scheme, the gRNA plasmid vector is pKLV2-U6 sgRNA.
As an improvement of the technical scheme, the Cas9 plasmid is pKLV2-EF1 alpha-Bsdcas 9-W plasmid.
As an improvement of the technical scheme, the sgRNA and the gRNA plasmid vector are connected by Bbs I enzyme digestion.
As an improvement of the above technical solution, the transfection is an electrotransfection.
As an improvement of the technical scheme, a pair of sgRNAs with nucleotide sequences shown in SEQ ID No. 5-8 are adopted and respectively cloned to a pKLV2-U6sgRNA plasmid vector which is linearized after BbsI digestion to obtain a pKLV2-U6sgRNA1 plasmid and a pKLV2-U6sgRNA2 plasmid, and the pKLV2-U6sgRNA1 plasmid, the pKLV2-U6sgRNA2 plasmid and the pKLV2-EF1 alpha-BsdCas 9-W plasmid are uniformly mixed according to a preset proportion to obtain a mixed plasmid, and the mixed plasmid is adopted to transfect the human-derived expansion potential stem cells.
As an improvement of the technical scheme, the weight ratio of the pKLV2-EF1 alpha-BsdCas 9-W plasmid, the pKLV2-U6sgRNA1 plasmid and the pKLV2-U6sgRNA2 plasmid is as follows: (4-10): (2-5): (2-5).
As an improvement of the technical scheme, a TGF-beta inhibitor SB431542 is adopted to induce the recombinant cells to differentiate into the extracellularly differentiated cells.
Correspondingly, the invention also discloses sgRNA for knocking out ACE2 gene in pluripotent stem cells, and the nucleotide sequence of the sgRNA is shown in SEQ ID No. 5-8.
Correspondingly, the invention also discloses a plasmid which is the pKLV2-U6sgRNA1 plasmid or pKLV2-U6sgRNA2 plasmid.
Correspondingly, the invention also discloses a complete set of plasmids, which comprises the pKLV2-U6sgRNA1 plasmid, pKLV2-U6sgRNA2 plasmid and pKLV2-EF1 alpha-BsdCas 9-W plasmid.
Correspondingly, the invention also discloses an application of the sgRNA in (1) or (2):
(1) the application in constructing ACE2 gene knockout embryonic stem cell sublines; or
(2) The application of the ACE2 gene knockout human-derived differentiated cell model is established.
Correspondingly, the invention also discloses the application of the plasmid in (1) or (2):
(1) the application in constructing ACE2 gene knockout embryonic stem cell sublines; or
(2) The application of the ACE2 gene knockout human-derived differentiated cell model is established.
Correspondingly, the invention also discloses the application of the plasmid set in (1) or (2):
(1) the application in constructing ACE2 gene knockout embryonic stem cell sublines; or
(2) The application of the ACE2 gene knockout human-derived differentiated cell model is established.
Correspondingly, the invention also discloses an ACE2 gene knockout embryonic stem cell subline which is constructed by the method.
Correspondingly, the invention also discloses a human-derived differentiated cell model with the ACE2 gene knocked out, which is established by the method.
Correspondingly, the invention also discloses application of the ACE2 gene knockout embryonic stem cell subline in preparation, screening and evaluation of a vaccine against COVID-19.
Correspondingly, the invention also discloses application of the ACE2 gene knockout embryonic stem cell subline in preparation, screening and evaluation of COVID-19 resistant medicines.
Correspondingly, the invention also discloses an application of the ACE2 gene knockout embryonic stem cell subline in any one of the following (1) to (3):
(1) the application in establishing a human-derived differentiated cell model with an ACE2 gene knocked out;
(2) the application of the stem cell-induced anti-COVID-19 organoid is established;
(3) the application of the ACE2 gene knockout exosome in an embryonic stem cell subline is prepared.
Correspondingly, the invention also discloses an application of the human differentiated cell model with the ACE2 gene knocked out in any one of the following (1) to (3):
(1) the application of the stem cell-induced anti-COVID-19 organoid is established;
(2) application of exosome in preparation of ACE2 gene knockout embryonic stem cell subline
(3) The application in preparing, screening and evaluating vaccines and medicines for resisting COVID-19.
The implementation of the invention has the following beneficial effects:
according to the invention, through a specific pair of sgRNAs, the ACE2 gene in the human-derived expanded potential stem cell is efficiently knocked out by adopting a CRISPR/Cas9 technology, the knocking is thorough, and the operation method is simple. The knockout embryonic stem cell subline has the extra-embryonic development capability and can be continuously induced into a human-derived differentiated cell model which is not infected by new coronavirus. And the ACE2 gene knockout embryonic stem cell subline can be developed into any human cell/tissue/organoid model free from infection of new coronavirus, and has extremely important significance in the aspects of research of medicines, vaccines and the like of the new coronavirus.
Drawings
FIG. 1 is a graphical representation of the genomic phenotype of PCR detection of ACE2 knockouts;
FIG. 2 is an analysis chart of the ACE2 knockout effect by Western blot assay;
FIG. 3 is a graph showing the results of RT-qPCR analysis of normal human EPSC cells (EPSCs) and human EPSC cells (ACE2-KO) after ACE2 gene knock-out;
FIG. 4 is a diagram showing the results of flow cytometry of normal human EPSC cells (EPSCs) and human EPSC cells (ACE2-KO) after the ACE2 gene knockout;
FIG. 5 is an immunofluorescence assay of normal human EPSC cells (hEPSC) sternness and pluripotency markers;
FIG. 6 is a RT-qPCR assay of pluripotency markers for normal human EPSC cells (hEPSC);
FIG. 7 is a graph of expression detection of ACE2, TMPRSS2, CD147 in normal human EPSC cells (hEPSC) (RT-qPCR);
FIG. 8 is a graph showing the result of detecting the copy number of viral gene expression in cells analyzed by RT-qPCR after SARS-CoV-2 infection of normal human EPSC cells (hEPSC);
FIG. 9 is a graph showing the results of detection of expression of pluripotency genes by RT-qPCR after infection of normal human EPSC cells (hEPSC) with SARS-CoV-2;
FIG. 10 is a graph showing the results of detection of expression of a pluripotent marker and viral proteins by immunofluorescence after infection of normal human EPSC cells (hEPSC) with SARS-CoV-2;
FIG. 11 is a graph showing the results of analysis of cell-associated factors and markers (RT-qPCR) by day9 (SB 43-9) of the differentiation of normal human EPSC cells (EPSCs) into extra-embryonic differentiated cells induced by SB 43;
FIG. 12 is a graph showing the expression detection (RT-qPCR) of ACE2, TMPRSS2 and CD147 by SB43 in inducing normal human EPSC cells (hEPSCs) to differentiate cells extracellularly at days 4 and 9 (SB43_ Day4 and SB43_ Day 9);
FIG. 13 is a graph showing the viral load in cell supernatants after infection of SARS-CoV-2 with SB43 to induce differentiation of normal human EPSC cells into extra-embryonic differentiated cells on days 4 and 9 (SB43_ D4 and SB43_ D9);
FIG. 14 is a graph comparing the viral load in cell supernatants of 0.1MOI SARS-CoV-2 infection with SB43 induced differentiation of normal human EPSC cells to extra-embryonic differentiated cells on Day4 (SB43 Day4) with that of Caco2 cells and Vero E6 cells;
FIG. 15 is a graph showing the results of RT-qPCR analysis of virus replication in cells at 4 th and 9 th days (SB43_ D4 and SB43_ D9) by inducing differentiation of normal human EPSC cells to extracellularly differentiated cells by infection with SARS-CoV-2 with SB 43;
FIG. 16 is a photograph of immunofluorescence confocal measurements of SARS-CoV-2 infection with SB43 induced differentiation of normal human EPSC cells into extra-embryonic differentiated cells at Day4 (SB43_ Day 4);
FIG. 17 is a graph of the results of analysis of the viral gene copy number after infection with SARS-CoV-2 by normal human EPSC cells (EPSCs) and ACE2 knock-out subcells (ACE-KO-EPSCs);
FIG. 18 is a graph showing expression detection of ACE2, TMPRSS2, CD147 after induction of SB43 (day4) by normal human EPSC cells (WT) and ACE2 knock-out embryonic stem cell subline (ACE-KO) (RT-qPCR);
FIG. 19 is a graph comparing the viral load in cell supernatants of normal human EPSC cells (WT) and ACE2 knock-out embryonic stem cell sublines (ACE-KO) after induction with SB43 (day4) infected with SARS-CoV-2 at 0.1 MOI;
FIG. 20 is a graph showing the results of immunofluorescence confocal assay of normal human EPSC cells (WT) and ACE2 knock-out subcellular cells (ACE-KO) induced by SB43 (day4) after infection with SARS-CoV-2 virus for 48 hr;
FIG. 21 is a graph of the function of differentiation markers (RT-qPCR) of normal human EPSC cells (WT) and ACE2 knock-out embryonic stem cell sublines (KO) after induction with SB43 (day 4);
FIG. 22 is a structural map of a gRNA plasmid (pKLV2-U6sgRNA5(BbsI) -PGKkuro 2 ABFB-W);
FIG. 23 is a structural map of Cas9 plasmid (pKLV2-EF1 alpha-Bsdcas 9-W).
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail with reference to the accompanying drawings.
Method for knocking out ACE2 gene in human-derived expanded pluripotent stem cell (hEPSC cell)
As a first aspect of the present invention, the present invention provides a method for knocking out ACE2 gene in a hEPSC cell, which specifically comprises:
firstly, selecting human EPSC cells and culturing the cells;
specifically, M1-hEPSC cells were taken,
M1-hEPSC cells were plated on SNL feeder cells for passage every 3-5 days, washed with PBS, treated with EDTA-0.25% trypsin for 3-5 minutes, digested with DMEM medium (M10) containing 10% fetal bovine serum, and collected and centrifuged (300g, 3 minutes). After removal of the supernatant, the hepscs were resuspended. hEPSC cells were seeded in hEPSCM supplemented with 5 μ M Y27632(Tocris, cat. No.1254) (hEPSCM used here is N2B27 based medium).
In the present invention, the method for culturing human EPSC cells is not limited to this, and various human EPSC cells may be cultured in the field by selecting other pretreatment methods and other culture media, as the case may be.
(II) designing and synthesizing sgRNA;
specifically, the gene ACE2 (Transcript: ACE2-202 ENST00000427411.2) was searched in Ensemble (https:// asia. ensemblel.org/index. html); according to a target sequence to be edited (generally located at an exon at the front of comparison), the sequence is input into an online design tool (http:// criprpr. mit. edu /), a design principle that 20bp and PAM sequences are 'NGG' is selected, and the sequence of the gRNA is automatically designed and sequenced by software. Multiple alternative gRNA sequences are available. Such as:
gRNA1
hACE2-gRNA1-F：GAATAATGCTGGGGACAAA(SEQ ID No.1)
hACE2-gRNA1-R：TTTGTCCCCAGCATTATTC(SEQ ID No.2)
gRNA2
hACE2-gRNA2-F：CTCAGAAGACAAGAGCAAA(SEQ ID No.3)
hACE2-gRNA2-R：TTTGCTCTTGTCTTCTGAG(SEQ ID No.4)
gRNA3
hACE2-gRNA3-F：TGAGCACCATCTACAGTAC
hACE2-gRNA3-R：GTACTGTAGATGGTGCTCA
gRNA4
hACE2-gRNA4-F：CAGTTTAGACTACAATGAG
hACE2-gRNA4-R：CTCATTGTAGTCTAAACTG
gRNA5
hACE2-gRNA5-F：GTGGTCTTGAAAAATGAGA
hACE2-gRNA5-R：TCTCATTTTTCAAGACCAC
gRNA6
hACE2-gRNA6-F：ATGTGCACAAAGGTGACAA
hACE2-gRNA6-R：TTGTCACCTTTGTGCACAT
gRNA7
hACE2-gRNA7-F：CTAAGCATTTAAAATCCAT
hACE2-gRNA7-R：ATGGATTTTAAATGCTTAG
as a result, it was found that gRNA1 had less off-target effect from gRNA2, and it was easy to perform fragment deletion and genotype identification (at least a difference of 100bp or more was observed between the two sequences, and thus two different bands appeared by gel electrophoresis after deletion of the fragment, and it was relatively easy to perform genotype identification).
Further, adding CACCG to the 5 'end of the gRNA to obtain a forward oligonucleotide sequence, adding AAAC to the 5' end of the complementary strand to obtain a reverse oligonucleotide sequence, and adding a C to the extreme end to obtain a sgRNA primer sequence as follows:
sgRNA1
hACE2-sgRNA1-F：CACCGGAATAATGCTGGGGACAAA(SEQ ID No.5)
hACE2-sgRNA1-R：AAACTTTGTCCCCAGCATTATTCC(SEQ ID No.6)
sgRNA2
hACE2-sgRNA2-F：CACCGCTCAGAAGACAAGAGCAAA(SEQ ID No.7)
hACE2-sgRNA2-R：AAACTTTGCTCTTGTCTTCTGAGC(SEQ ID No.8)
the forward and reverse oligonucleotide sequence primers were synthesized by Shanghai Biotech, respectively, diluted to 100uM with 10-fold molar deionized water, and stored at 4 ℃ for further use.
(III) plasmid RNA construction
1. Annealing the sgRNA primer to form a double-stranded system
Two pairs of forward oligonucleotide sequence primers (hACE2-sgRNA1-F or hACE2-sgRNA2-F) and corresponding reverse oligonucleotide sequence primers ((hACE2-sgRNA1-R or hACE2-sgRNA2-R) are taken to form a system, and the system is denatured and annealed on a PCR instrument to obtain a double-stranded oligonucleotide chain, wherein the annealed double-stranded oligonucleotide chain contains a cohesive end of BbsI.
Specifically, the total volume of the denaturation/annealing system was 20. mu.L, wherein 1. mu.L of the forward oligonucleotide chain (100. mu.M) and 1. mu.L of the reverse oligonucleotide chain (100. mu.M), H2O 18μL。
The running program of the PCR instrument is as follows: at 95 ℃ for 10 min;
in another embodiment of the present invention, the PCR instrument is operated as follows: at 95 ℃ for 10 min; 10min at 70 ℃; at 37 ℃ for 20 min; at 25 ℃ for 20 min.
2. Linearization of enzyme digestion gRNA universal plasmid
Wherein, a universal gRNA vector with a U6 promoter and a BbsI enzyme cutting site is selected for BbsI enzyme cutting. Preferably, pKLV2-U6sgRNA5(BbsI) -PGKkuro 2ABFB-W (pKLV2-U6sgRNA for short) is selected as a vector, enzyme digestion is carried out on a PCR instrument, the digested plasmid is subjected to electrophoresis by using 1% agarose gel, gel of a target band is cut, and a Takara gel recovery kit is used for recovering a DNA product.
Specifically, the volume of the total enzyme digestion system is 100 μ L, wherein 10 xSmartCut buffer 10 μ L, BbsI enzyme 3 μ L, pKLV2-U6sgRNA 10 μ g, ddH2And the balance of O.
Specifically, the PCR run program is: the enzyme is cleaved at 37 deg.C for 6-8hr (or overnight).
3. The sgRNA is connected with the enzyme-cleaved and linearized gRNA vector
Two pairs of annealed double-stranded oligonucleotide chains are connected with a pKLV2-U6sgRNA vector digested by BbsI in a PCR instrument, so that pKLV2-U6sgRNA1 and pKLV2-U6sgRNA2 recombinant sgRNA plasmids can be obtained respectively.
Specifically, the volume of the ligation total system was 10. mu.L, wherein 4.5. mu.L of the double-stranded oligonucleotide chain obtained after annealing, 0.5. mu.L of the linearized pKLV2-U6sgRNA plasmid (>50ng/uL), and 5. mu.L of the Takara ligation mixture.
Specifically, the running program of the PCR instrument is 16 deg.C for 1-2hr, and the PCR instrument is taken out and stored at 4 deg.C.
4. Plasmid transformation and identification
The ligation product 1uL obtained in the above step was added to DH5a competent cells on ice, and after 30min of transformation, the bacteria were plated on ampicillin positive (Amp +) agarose gel (LB) plates. After overnight growth, positive cloning bacteria are picked up and put into LB solution with positive ampicillin overnight with shaking at 37 ℃, plasmids are extracted by Takara plasmid extraction kit and sequenced and identified, and then pKLV2-U6sgRNA plasmids with correct sequencing are obtained (figure 22). Specifically, a plasmid corresponding to sgRNA1 is named as pKLV2-U6sgRNA1 plasmid, and a plasmid corresponding to sgRNA2 is named as pKLV2-U6sgRNA2 plasmid.
Wherein the total sequencing amount is 15 μ L, wherein the double-stranded oligonucleotide chain obtained after annealing is 1 μ L, the U6 primer is 1 μ L, ddH2O13. mu.L. Wherein the content of the first and second substances,
the U6 primer sequences are as follows:
5’-GAGGGCCTATTTCCCATGATT-3’
similarly, the above transformation and amplification was performed using the Cas9 plasmid (pKLV2-EF 1. alpha. -BstPas 9-W), stored at-20 ℃ until use.
(IV) transfecting the human EPSC cells by adopting the mixed plasmids;
specifically, lipofection, nuclear transfection or electroporation transfection may be used, but not limited thereto.
Preferably, in the present invention, the transfection is carried out by electroporation, which comprises the following steps:
when the hEPSC cell density reaches 70-80%, electroporation can be performed next day. Preparation of mixed plasmids 5-10 min before treatment of hEPSC [ plasmid pKLV2-EF1 α -BsdCas9-W (fig. 23): pKLV2-U6sgRNA1 plasmid: pKLV2-U6sgRNA2 plasmid was encoded at 2: 1: 1 into 200uL of MEM dedicated for transfection in an amount ranging from 4ug:2ug:2ug or 10ug:5ug:5ug, and then washing the hEPSC cells with PBS for 2 times and treating with EDTA-0.05% trypsin for 10 minutes, and then adding M10 medium to neutralize the trypsin. The digested cells were collected and centrifuged (300 g.times.3 min) and the supernatant was discarded. Will be 1 × 106The cells were resuspended in 200uL MEM medium containing the mixed plasmid, transferred to a 0.4cm electroporation cuvette and immediately electroporated (BioRAD GenePulser, 230V 500 uF). Then, human EPSC medium (500uL) and 10uM Rock inhibitor (Y27632) were added, and the cells were gently blown into single cells and seeded into 2-3 wells of 6-well plates. After 24 hours, the medium was changed to normal EPSC medium for further culture, blasticidin (BSD,10ug) was added, Puromycin (Puromycin) drug screening was performed on the third day, and the drug was stopped after 3-4 days. Positive clones were picked 7-10 days later.
(V) DNA PCR detection of ACE2 knockout genomic phenotype
The genome of each clone was PCR amplified by picking 24 clones and using unedited EPSC cells as controls. The amplification primers, the amplification system and the amplification program are as follows:
(1) an amplification primer: primers are designed within 200 bp-1000 bp outside the sgRNA sequence and synthesized by the company of Biotechnology engineering (Shanghai).
Specifically, the designed genotype identifying primers are as follows:
ACE2-g1-geno-F：GTGGCCTGGTCACTCTTAAC(SEQ ID No.9)
ACE2-g1-geno-R：CAAATAAAGGCAGCTGCTGTG(SEQ ID No.10)
(2) an amplification system: total 20. mu.L, wherein, Takara mixed buffer 10uL, ACE2-g1-geno-F (10. mu.M) 0.8. mu.L, ACE2-g1-geno-R (10. mu.M) 0.8. mu.L, parental cell or transfected cell (ACE2-KO) genomic DNA 0.4. mu.L, ddH2O 8uL。
(3) And (3) amplification procedure: 30s at 95 ℃; 30s at 64 ℃ and 0.4 ℃ reduction from each cycle after the fifth cycle; 72 ℃ for 1min)35 cycles; 3min at 72 ℃; storing at 4 ℃.
The detection results are shown in table 1 and fig. 1; as can be seen from the table: sanger sequencing and identification of a PCR gel recovery fragment show that 148bp knockout is performed between two gRNAs of a second coding exon of an ACE2 gene, 4 clones in 24 screened clones are heterozygous knockout, and 5 clones are homozygous knockout, so that high efficiency of ACE2 gene editing in hEPSC is shown. In FIG. 1, only the band of about 418bp is a non-editing cell (WT), only the band of 270bp is a biallelic editing cell (DKO), and both the band of about 418bp and the band of 270bp are monallelic editing cells.
Wherein, the genome sequence of the WT cell in the intercepted sequencing result graph is as follows:
GTCATTTCAGAATAATGCTGGGGACAAATGGTCTGCCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGTATCCACTACAAGAAATTCAGAATCTCACAGTCAAGCTTCAGCTGCAGGCTCTTCAGCAAAATGGGTCTTCAGTGCTCTCAGAAGACAAGAGCAAACGGGTACGTTTGTGAACATTTTAGCATTGATC
the sequence after the ACE2 knockout in the sequencing result map is intercepted as follows:
GTCATTTCAGAATAATGCTGGGGAC GTTTGTGAACATTTTAGCATTGATC
comparing the sequences, the sequence to be knocked out is determined to be 148bp, and the sequence is as follows:
AAATGGTCTGCCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGTATCCACTACAAGAAATTCAGAATCTCACAGTCAAGCTTCAGCTGCAGGCTCTTCAGCAAAATGGGTCTTCAGTGCTCTCAGAAGACAAGAGCAAACGGGTAC, where the gRNA1 sequence (GAATAATGCTGGGGACAAA) was clipped by Cas 9-induced pair of grnas from the last three AAA bases to gRNA2(CTCAGAAGACAAGAGCAAA) and 7 bp thereafter (cgggtac).
TABLE 1 Table of PCR gel recovery fragments after Sanger sequencing of ACE2 Gene knockout
Figure BDA0003249514620000111
(VI) Western Blot identification of protein
Cell samples were fixed with 4% paraformaldehyde (Sigma, Cat. No. P6148) for 15 min at room temperature, permeabilized with 0.1% Triton-100(Sigma, Cat. No. T8787) for 30min, and then blocked with 10% donkey serum (Sigma, Cat. No. D9663) and 1% BSA (Sigma, Cat. No. A2153) by incubation for 1hr and incubated with primary antibody overnight at 4 ℃. After incubation with fluorescent secondary antibody at room temperature for 1hr, nuclei were stained with 10. mu.g/mL DAPI (Thermo Fisher Scientific, Cat. No.62248) for 10mins and observed under a fluorescent microscope.
The detection result is shown in fig. 2, and it can be seen from the figure that the ACE2 gene knockout effect is significant.
(VII) fluorescent quantitative PCR (RT-qPCR)
Total RNA was extracted from the RNeasy Mini Kit (Qiagen, Cat. No.74104) and reverse transcribed to cDNA. PowerUp on a PCR instrument using the Kit Fastking gDNA dispering RT SuperMix (Tiangen, Cat. No. KR118)TMSYBRTMGreen Master Mix (Applied Biosystems) was used to detect the expression of SARS-CoV-2 and other marker genes in cells.
Specifically, the sequences of the primers for PCR detection according to the present invention are shown in the following table:
TABLE 2 PCR detection primer sequence Listing
Figure BDA0003249514620000121
The results are shown in FIG. 3, and it can be seen that in ACE2-KO cells after ACE2 gene knockout and normal human EPSC cells (hEPSCs), CDX2, ELF5, MIX1, FOXA2, SOX17, GATA4, PAX6, NES, SOX1 are expressed negatively; OCT4 and NANOG were positively expressed, and there was no difference between them. It was suggested that ACE2 knockdown did not affect EPSC pluripotency.
(VIII) flow cytometry
The cells to be examined were digested with 0.25% trypsin/EDTA at 37 ℃ for 2-3 minutes, and the digested cells were filtered through a40 μm nylon mesh (Corning, Cat. No.352235) to remove debris. The centrifuged cells were fixed with a fixative (BD Cytofix, Cat. No.554655), and the cells eluted with PBS were stored at 4 ℃ in PBS + 0.1% NaN3(Sigma, Cat. No.199931) + 5% FBS (Gibco, Cat. No.10270) to the laboratory. Use ofACEA NovoCyte Quanteon assay. The 488nm (530/30 bandpass filter) and 561nm (610/20 bandpass filter) channels were used to detect FITC and remove autofluorescence. The 405nm (445/45 bandpass filter) channel was used to detect DAPI positive cells. FACS data was analyzed using Flowjo. The antibody is Alexa
Figure BDA0003249514620000131
488 anti-human/mouse SSEA-3 antibody (Biolegend, Cat. No.330305) and Alexa
Figure BDA0003249514620000132
The 488 anti-human/mouse TRA-1-60 antibody (Biolegend, Cat. No. 330613).
The results are shown in FIG. 4, which shows that SSEA3 and TRA-1-60 are positively expressed in normal human EPSC cells (EPSCs) and ACE2-KO cells with ACE2 gene knocked out. The cells after the ACE2 gene knockout are not obviously different from the cells before the ACE2 gene knockout in the pluripotency and differentiation gene expression.
In conclusion, the method for knocking out ACE2 in human EPSC cells provided by the invention can effectively knock out the ACE2 gene in hEPSC cells, has no influence on the expression of other genes after knocking out, and has no significant difference with parent hEPSC cells.
It should be noted that the application of the method for knocking out ACE2 gene in the present invention is not limited to human-derived expanded pluripotent stem cells (hEPSC cells), but may also be applied to other pluripotent stem cells, such as EPSC cells and iPSC cells.
Second, construction of ACE2 gene knockout embryonic stem cell subline and establishment of humanized differentiated cell model
Construction of ACE2 gene knockout embryonic stem cell subline
The cells after the transfer were seeded in a six-well plate coated with gelatin and supplemented with 2mL of EPSC medium and 10. mu. M Y-27632 at 37 ℃ with 5% CO2The cells in the cell culture box are continuously cultured. Changing the normal EPSC culture medium after 24hr, adding Blasticidin (BSD) and puromycin for drug screening, and stopping drug screening after 48-96 hr. After 8-10 days of electrotransfer, grams can be seen under an objective lensA ridge is formed. Observing in a super clean bench through a microscope, adjusting a P200 pipettor to 45 mu L, picking single clone by using a gun head with a filter element, transferring the single clone into a small hole of a 96-well plate, digesting 0.05% of pancreatin into single cells, and continuously culturing to obtain the embryonic stem cell subline.
Establishment of human-derived differentiated cell model with ACE2 gene knockout function
Human EPSC cells (ACE2-KO-hEPSCs) after knocking out ACE2 were separated with EDTA-0.25% trypsin and 0.1X 10 cells were separated6Cells per well were seeded in six-well plates. Cells were cultured for 1 day in 20% KSR medium supplemented with 5. mu. M Y27632. From day 2 onwards, 10 μ M SB431542 was added to 20% KSR medium to promote differentiation of extra-embryonic cells, i.e., to obtain an extra-embryonic differentiated human-derived differentiated cell model. And cells were collected at specific time points (day4 and day9) for analysis.
(III) amplification and infection of SARS-Cov-2
SARS-Cov-2 strain (SARS-Cov-2 HKU-001 a; GenBank accession number MT230940) was isolated from a nasopharyngeal aspirate from one patient in hong Kong with COVID-19 and propagated using VeroE6 cells. Viral titer determination was performed by plaque assay of VeroE6 cell culture supernatants. All experiments involving live SARS-CoV-2 were performed according to approved standard procedures for the Biosafety third-class facility of the Mary Hospital, hong Kong university.
The hEPSCs, ACE2-KO-hEPSCs were inoculated 1 day before infection, and other types of differentiated cells were inoculated according to their appropriate time points. On the day of infection, cells were washed with PBS and infected with SARS-CoV-2 at different titers (MOI). After 1 hour of viral infection, the cell minimal medium was changed to complete medium. Cytopathology was observed daily with a light microscope and cell supernatants and cell lysates were collected at appropriate time points for quantitative RT-PCR to assess viral load.
(IV) viral load detection
Supernatants were collected and infected cells lysed at the indicated time points and viral RNA extraction was performed using QIAamp viral RNA mini kit (QIAGEN) or QIARneasy mini kit (QIAGEN). The culture supernatant was lysed using 560. mu.L of AVL buffer, followed by extraction of total RNA using QIAamp viral RNA mini kit (QIAGEN). For analysis of virus replication kinetics, extracted RNA was quantified using a one-step QuantiNova Probe RT-PCR kit (QIAGEN), i.e., 20. mu.L of a mixture reaction solution (containing 2 XQuantiNova Probe RT-PCR Master Mix 10. mu.L, QuantiNova Probe RT-PCR Master Mix 0.2. mu.L, 10. mu.M of each of the positive and reverse primers 1.6. mu.L, 10. mu.M of the probe 0.4. mu.L, 5. mu.L of RNA, 1.2. mu.L of RNase-free water) was prepared, followed by reverse transcription by incubation at 45 ℃ for 10 minutes, denaturation at 95 ℃ for 5 minutes, incubation at 95 ℃ for 5 seconds, incubation at 55 ℃ for 30 seconds, 45 cycles, and cooling at 40 ℃ for 30 seconds. Primers for the RNA-dependent RNA polymerase/helicase (RdRP/Hel) gene region of SARS-CoV-2 are shown in Table 2, and the probe sequences used are as follows:
5’-FAM TTAAGATGTGGTGCTTGCATACGTAGAC-IABkFQ-3’。
(V) study of Gene expression in various cells and Virus infection
(1) Human EPSC cells (hEPSC/EPSCs)
Human EPSC cells (M1-hEPSC) were expanded in culture and their sternness and pluripotency markers were identified using RT-qPCR (KLF4, NANOG, SOX2 and OCT4) and immunofluorescence (OCT4, SSEA3, SSEA4) (fig. 5, fig. 6). Then RT-qPCR detects the expression of ACE2, TMPRSS2 and CD147 in human EPSC cells, and finds that: ACE2 was barely detectable on hEPSC cells, whereas TMPRSS2 and CD147 were expressed in higher amounts (fig. 7).
Furthermore, virus infection experiments are carried out aiming at human EPSC cells, after SARS-CoV-2 is infected with hEPSCs, RT-qPCR is used for analyzing the copy number of virus gene expression in cells (figure 8), immunofluorescence is used for detecting the pluripotency markers and virus protein expression (figure 9), and RT-qPCR is used for detecting the pluripotency gene expression (figure 10); the following are found: hEPSC is not susceptible to SARS-CoV-2 and the pluripotent gene expression is unchanged after 48hr virus incubation. This suggests that: probably related to the little expression of ACE2, whereas TMPRSS2 and CD147 expressed by human EPSC cells did not appear to mediate viral entry.
(2) Extra-embryonic differentiated cells (SB43-hEPSC) prepared from human EPSC cells
EPSCs can be induced to differentiate into extra-embryonic differentiated cells (SB43-hEPSC) by continuously using a TGF-beta inhibitor (SB431542) for 10-12 days; RT-PCR identified the expression of its extra-embryonic differential cell-associated markers (e.g., SDC1, ERVW, GATA3, KRT7, CGB) (FIG. 11), confirming high expression of these markers. The results of the RT-qCR assay showed that hEPSC treated with SB43 showed a gradual increase in ACE2 expression during the gradual differentiation into extra-embryonic differentiated cells, whereas TMPRSS2 and CD147 were consistently higher and at more stable levels than ACE2 (FIG. 12).
Further, virus infection experiments were performed on SB43 differentiated cells and the viral load in the supernatant of SB43 differentiated model cells was examined (fig. 13); when SARS-CoV-2 at 0.1MOI was infected with hEPSC (SB43 Day4) after differentiation for 4 days at SB43, the viral load in the supernatant was compared to that of Caco2 and VeroE6 cell strains (FIG. 14) and found to be lower than that of VeroE6 cells but higher than that of Caco2 colon adenoma cells. RT-qPCR analysis SARS-CoV-2 infection SB43 differentiation model (day4 and day9 of differentiation) intracellular viral replication (FIG. 15) and immunofluorescence confocal results of virus infected cells (FIG. 16) also confirmed the above results.
From experiments with parental hEPSCs/EPSCs and SB43-hEPSC it can be seen that: hEPSCs that do not express ACE2 are not infected with virus; whereas SB43-hEPSC, which expresses ACE2, is susceptible to viruses. This initially suggests from the expression level: in comparison to TMPRSS2 and CD147, ACE2 plays a major role in SB43-hEPSC virus infection.
(3) hEPSC subcellular knockout of ACE2 gene (ACE2-KO-hEPSCs)
Human hEPSC cells and ACE2-KO-hEPSCs were cultured and subjected to SARS-CoV-2 virus infection test (0.1MOI), and RT-qPCR analysis of SARS-CoV-2 virus gene copy number showed that ACE2-KO-hEPSCs cells were similar to human Extended Potential Stem Cells (EPSCs) and still were not sensitive to viruses (FIG. 17).
(4) SB43 induced differentiation of ACE2-KO-hEPSCs human-derived differentiated cell model (SB43-ACE2-KO-hEPSCs)
Differentiation of normal hEPSC and ACE2-KO-hEPSC cells into extra-embryonic differentiated cells by SB43 (day4), analysis of SARS-CoV-2 virus and ACE2, TMPRSS2 and BSG/CD147 expression by RT-qPCR (FIG. 18) found that the ACE2-KO group did not detect virus expression, while the group of cells still expressed TMPRSS2 and BSG/CD 147.
The virus load was measured in the supernatants of infected virus cells (2hr, 24hr, 48hr, 72hr) at different times, and it was found that the virus load of the in vitro differentiated cells differentiated from ACE2-KO cells was significantly reduced (fig. 19), and almost no virus was infected.
Immunofluorescence confocal assay at 48hr post-infection revealed that SB 43-differentiated EPSC cells (day4) expressed ACE2, an extra-embryonic differential cell marker, and SARS-CoV-2N protein, while extra-embryonic differential cells differentiated at ACE2-KO expressed the extra-embryonic differential cell marker but did not express viral N protein and ACE2 (fig. 20), suggesting that the lack of ACE2 is an important reason for the unsusceptibility of the extra-embryonic differential human-derived differential cell model responsible for ACE2-KO-hEPSC cell differentiation.
The expression of the extra-embryonic differential cell markers was analyzed by RT-qPCR after SB 43-induced differentiation (day4) of the hEPSC and ACE 2-KO-hEPSC. The ACE2-KO cell differentiation potential after knockout is not changed; however, after viral infection, the expression levels of the markers varied in the extracellularly differentiated cells. Increased CGB expression, significantly increased ERVW1, significantly increased SDC1, significantly increased KRT7, insignificant TP63 changes, and significant TEAD4 decreases (figure 21).
The experiments show that the human EPSC embryonic stem cell subline with the ACE2 gene knocked out still has the extra-embryonic development capacity and has no obvious difference from the conventional human expanded potential stem cell. The embryonic stem cell subline can be continuously induced to develop into an extraembryonic differentiated human-derived differentiated cell model which is not infected by new coronavirus.
Meanwhile, the totipotency of the ACE2-KO-hEPSCs and parent cells is not obviously different, so that the ACE2-KO-hEPSCs is suggested to be possibly free from infection of new coronavirus when the embryonic stem cell sublines are developed into other in-embryo human cell/tissue/organoid models. Therefore, the ACE2 knockout embryonic stem cell subline has extremely wide application prospects in the aspects of preparing various differentiated cell products, screening medicines, evaluating vaccines against COVID-19 and the like.
The above description is only a preferred embodiment of the present invention, and certainly should not be taken as limiting the scope of the invention, which is defined by the claims and their equivalents.
Figure BDA0003249514620000181
Figure BDA0003249514620000191
Figure BDA0003249514620000201
Sequence listing
<110> Stem cell transformation research center, Inc
<120> ACE2 gene knockout embryonic stem cell subline, construction method and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gaataatgct ggggacaaa 19
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tttgtcccca gcattattc 19
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctcagaagac aagagcaaa 19
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tttgctcttg tcttctgag 19
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
caccggaata atgctgggga caaa 24
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aaactttgtc cccagcatta ttcc 24
<210> 7
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
caccgctcag aagacaagag caaa 24
<210> 8
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
aaactttgct cttgtcttct gagc 24

Claims (24)

1. A method for knocking out ACE2 gene in pluripotent stem cells is characterized in that sgRNA with a pair of nucleotide sequences shown in SEQ ID No. 5-8 are adopted, cloned to gRNA plasmid vectors respectively and then cotransfected with Cas9 plasmid into the pluripotent stem cells.
2. The method for knocking out the ACE2 gene in a pluripotent stem cell according to claim 1, wherein the pluripotent stem cell is an EPSC cell or an iPSC cell.
3. The method of knocking out the ACE2 gene in a pluripotent stem cell according to claim 1 or 2, wherein the pluripotent stem cell is a human expanded potential stem cell.
4. A construction method of an ACE2 gene knockout embryonic stem cell subline is characterized in that an ACE2 gene knockout embryonic stem cell subline is constructed by using a CRISPR/Cas9 technology, and the construction method comprises the following steps: a pair of sgRNAs with nucleotide sequences shown as SEQ ID No. 5-8 are adopted, after the sgRNAs are respectively cloned on a gRNA plasmid vector, the sgRNAs and a Cas9 plasmid are cotransfected with a human expansion potential stem cell to obtain a recombinant cell, and the recombinant cell is cultured to obtain an embryonic stem cell subline with the ACE2 gene knocked out.
5. A method for establishing a human-derived differentiated cell model for knocking out an ACE2 gene is characterized in that sgRNAs with nucleotide sequences shown as SEQ ID Nos. 5-8 are adopted, respectively cloned to plasmid vectors, then co-transfected with a Cas9 plasmid to obtain a human-derived expanded potential stem cell, a recombinant cell is obtained, the recombinant cell is amplified and induced to differentiate into an extra-embryonic differentiated cell under the action of a TGF-beta inhibitor, and the human-derived differentiated cell model for knocking out the ACE2 gene is obtained.
6. The method of claim 1, 4 or 5, wherein the gRNA plasmid vector is pKLV2-U6 sgRNA.
7. The method of claim 1, 4 or 5, wherein the Cas9 plasmid is a pKLV2-EF1 a-BsdCas 9-W plasmid.
8. The method of claim 1, 4 or 5, wherein the sgRNA is enzymatically linked to the gRNA plasmid vector by BbsI.
9. The method of claim 1, 4 or 5, wherein the transfection is an electrotransfection.
10. The method of claim 1, 4 or 5, wherein a pair of sgRNAs with nucleotide sequences shown as SEQ ID Nos. 5-8 are adopted and cloned to a plasmid vector pKLV2-U6sgRNA linearized after BbsI digestion to obtain a pKLV2-U6sgRNA1 plasmid and a pKLV2-U6sgRNA2 plasmid, and the pKLV2-U6sgRNA1 plasmid, the pKLV2-U6sgRNA2 plasmid and the pKLV2-EF1 alpha-BsdCas 9-W plasmid are uniformly mixed according to a preset proportion to obtain a mixed plasmid, and the mixed plasmid is used for transfecting the human-derived expansion potential stem cell.
11. The method of claim 10, wherein the weight ratio of the pKLV2-EF1 α -BsdCas9-W plasmid, pKLV2-U6sgRNA1 plasmid, and pKLV2-U6sgRNA2 plasmid is: (4-10): (2-5): (2-5).
12. The method of claim 5, wherein the differentiation of the recombinant cell into an extra-embryonic differentiated cell is induced using the TGF- β inhibitor SB 431542.
13. The sgRNA for knocking out ACE2 gene in pluripotent stem cell is characterized in that the nucleotide sequence is shown in SEQ ID No. 5-8.
14. A plasmid, wherein the plasmid is the pKLV2-U6sgRNA1 plasmid or pKLV2-U6sgRNA2 plasmid described in claim 10.
15. A plasmid kit comprising the pKLV2-U6sgRNA1 plasmid, pKLV2-U6sgRNA2 plasmid, and pKLV2-EF1 α -BsdCas9-W plasmid of claim 10.
16. The sgRNA of claim 13, for use in (1) or (2):
(1) the application in constructing ACE2 gene knockout embryonic stem cell sublines; or
(2) The application of the ACE2 gene knockout human-derived differentiated cell model is established.
17. Use of the plasmid of claim 14 in (1) or (2):
(1) the application in constructing ACE2 gene knockout embryonic stem cell sublines; or
(2) The application of the ACE2 gene knockout human-derived differentiated cell model is established.
18. Use of the plasmid set of claim 15 in (1) or (2):
(1) the application in constructing ACE2 gene knockout embryonic stem cell sublines; or
(2) The application of the ACE2 gene knockout human-derived differentiated cell model is established.
19. An ACE2 gene knock-out embryonic stem cell subline constructed by the method of claim 4, 6, 7, 8, 9, 10, 11 or 12.
20. A human-derived differentiated cell model with an ACE2 gene knockout, created by the method of any one of claims 5 to 12.
21. Use of the ACE2 gene knockout embryonic stem cell subline of claim 19 for the preparation, screening, and evaluation of vaccines against COVID-19.
22. Use of the ACE2 gene knockout embryonic stem cell subline of claim 19 for the preparation, screening and evaluation of medicaments against COVID-19.
23. The use of the ACE2 gene knockout embryonic stem cell subline of claim 19 in any one of the following (1) to (3):
(1) the application in establishing a human-derived differentiated cell model with an ACE2 gene knocked out;
(2) the application of the stem cell-induced anti-COVID-19 organoid is established;
(3) the application of the ACE2 gene knockout exosome in an embryonic stem cell subline is prepared.
24. The use of the ACE2 gene knock-out human differentiated cell model of claim 20 in any one of the following (1) to (3):
(1) the application of the stem cell-induced anti-COVID-19 organoid is established;
(2) the application in preparing exosomes of an embryonic stem cell subline with an ACE2 gene knocked out;
(3) the application in preparing, screening and evaluating vaccines and medicines for resisting COVID-19.
CN202111041730.2A 2021-09-07 2021-09-07 Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof Active CN113897363B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111041730.2A CN113897363B (en) 2021-09-07 2021-09-07 Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111041730.2A CN113897363B (en) 2021-09-07 2021-09-07 Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof

Publications (2)

Publication Number Publication Date
CN113897363A true CN113897363A (en) 2022-01-07
CN113897363B CN113897363B (en) 2024-03-29

Family

ID=79188692

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111041730.2A Active CN113897363B (en) 2021-09-07 2021-09-07 Embryo stem cell subline for knocking out ACE2 gene, construction method and application thereof

Country Status (1)

Country Link
CN (1) CN113897363B (en)

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112143704A (en) * 2020-09-17 2020-12-29 湖南普拉特网络科技有限公司 Cell strain capable of indicating ACE2 expression level and construction method and application thereof
CN112646780A (en) * 2020-11-22 2021-04-13 翁炳焕 hACE2 knockout novel coronavirus gene silencing stem cell
CN112680466A (en) * 2021-01-21 2021-04-20 广州派真生物技术有限公司 Animal model expressing humanized ACE2 and application thereof
CN113355323A (en) * 2020-03-06 2021-09-07 生物岛实验室 Preparation method and application of humanized ACE2 gene modified mouse model
CN113355325A (en) * 2020-03-06 2021-09-07 中国科学院广州生物医药与健康研究院 Preparation method and application of humanized ACE2 gene modified mouse embryonic stem cell model
US20210309998A1 (en) * 2020-04-01 2021-10-07 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Therapeutic and Diagnostic Target for SARS-CoV-2 and COVID-19
CN113801852A (en) * 2021-10-18 2021-12-17 齐齐哈尔医学院 GPD 1L-deleted human embryonic stem cell strain and construction method and application thereof
CN115261336A (en) * 2022-06-06 2022-11-01 干细胞转化研究中心有限公司 Application of human-derived extra-embryonic trophoblast cell model in efficient virus preparation, detection and drug screening
WO2022261293A1 (en) * 2021-06-09 2022-12-15 The Regents Of The University Of California Lung organoid model and method of use
US20230080265A1 (en) * 2021-08-26 2023-03-16 Synbal, Inc. Humanized mouse models for study of covid-19

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113355323A (en) * 2020-03-06 2021-09-07 生物岛实验室 Preparation method and application of humanized ACE2 gene modified mouse model
CN113355325A (en) * 2020-03-06 2021-09-07 中国科学院广州生物医药与健康研究院 Preparation method and application of humanized ACE2 gene modified mouse embryonic stem cell model
US20210309998A1 (en) * 2020-04-01 2021-10-07 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Therapeutic and Diagnostic Target for SARS-CoV-2 and COVID-19
CN112143704A (en) * 2020-09-17 2020-12-29 湖南普拉特网络科技有限公司 Cell strain capable of indicating ACE2 expression level and construction method and application thereof
CN112646780A (en) * 2020-11-22 2021-04-13 翁炳焕 hACE2 knockout novel coronavirus gene silencing stem cell
CN112680466A (en) * 2021-01-21 2021-04-20 广州派真生物技术有限公司 Animal model expressing humanized ACE2 and application thereof
WO2022261293A1 (en) * 2021-06-09 2022-12-15 The Regents Of The University Of California Lung organoid model and method of use
US20230080265A1 (en) * 2021-08-26 2023-03-16 Synbal, Inc. Humanized mouse models for study of covid-19
CN113801852A (en) * 2021-10-18 2021-12-17 齐齐哈尔医学院 GPD 1L-deleted human embryonic stem cell strain and construction method and application thereof
CN115261336A (en) * 2022-06-06 2022-11-01 干细胞转化研究中心有限公司 Application of human-derived extra-embryonic trophoblast cell model in efficient virus preparation, detection and drug screening

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
CHEN J等: "A placental model of SARS-CoV-2 infection reveals ACE2-dependent susceptibility and differentiation impairment in syncytiotrophoblasts", 《NATURE CELL BIOLOGY》, vol. 25, no. 8, pages 1223 - 1234 *
GAO X等: "Establishment of porcine and human expanded potential stem cells", 《NATURE CELL BIOLOGY》, vol. 21, no. 6, pages 9 *
ONABAJO OO等: "Homo sapiens angiotensin converting enzyme 2（ACE2）， RefSeqGene on chromosome X", 《GENBANK DATABASE》, pages 012575 *
RUAN D等: "Human early syncytiotrophoblasts are highly susceptible to SARS-CoV-2 infection", 《CELL REPORTS MEDICINE》, vol. 3, no. 12, pages 100849 *
WEATHERBEE BAT等: "Expression of SARS-CoV-2 receptor ACE2 and the protease TMPRSS2 suggests susceptibility of the human embryo in the first trimester", 《OPEN BIOLOGY》, vol. 10, no. 7, pages 200162 *
YANG L等: "A Human Pluripotent Stem Cell-based Platform to Study SARS-CoV-2 Tropism and Model Virus Infection in Human Cells and Organoids", 《CELL STEM CELL》, vol. 27, no. 1, pages 125 - 136 *
刘婵等: "应用CRISPR/Cas9技术制备Ace2基因敲除小鼠模型及基因型的鉴定", 《生理学报》, vol. 71, no. 4, pages 588 *
李俐: "人扩展多能干细胞衍生心肌细胞促进大鼠心肌梗死功能修复", 《中国博士学位论文全文数据库(电子期刊) 医药卫生科技辑》, pages 10 *

Also Published As

Publication number Publication date
CN113897363B (en) 2024-03-29

Similar Documents

Publication Publication Date Title
Firth et al. Functional gene correction for cystic fibrosis in lung epithelial cells generated from patient iPSCs
US11905521B2 (en) Methods and systems for targeted gene manipulation
JP6603721B2 (en) Endonuclease targeting blood coagulation factor VIII gene and composition for treating hemophilia containing the same
WO2016197354A1 (en) Crispr-cas9 method for specific knockout of swine pdx1 gene and sgrna for use in targeting specifically pdx1 gene
WO2016197361A1 (en) Method for specific knockout of swine ggta1 gene using crispr-cas9 specificity, and sgrna used for specifically targeting ggta1 gene
WO2016197360A1 (en) Method for specific knockout of swine gfra1 gene using crispr-cas9 specificity, and sgrna used for specifically targeting gfra1 gene
WO2016197355A1 (en) Crispr-cas9 method for specific knockout of swine sall1 gene and sgrna for use in targeting specifically sall1 gene
WO2016187904A1 (en) Method for pig cmah gene specific knockout by means of crispr-cas9 and sgrna for specially targeting cmah gene
WO2016197356A1 (en) Method for knockout of swine sla-2 gene using crispr-cas9 specificity, and sgrna used for specifically targeting sla-2 gene
WO2016197358A1 (en) Method for specific knockout of swine fgl-2 gene using crispr-cas9 specificity, and sgrna used for specifically targeting fgl-2 gene
WO2016197357A1 (en) Method for specific knockout of swine sla-3 gene using crispr-cas9 specificity, and sgrna used for specifically targeting sla-3 gene
WO2019160077A1 (en) Method for producing low-antigenic cell
JP2016538001A (en) Somatic haploid human cell line
US11851648B2 (en) Humanized cell line
CN106834348B (en) Porcine reproductive and respiratory syndrome virus with fluorescent marker and construction method and application thereof
JP2015500637A (en) Haploid cells
BeltCappellino et al. CRISPR/Cas9-mediated knockout and in situ inversion of the ORF57 gene from all copies of the Kaposi's sarcoma-associated herpesvirus genome in BCBL-1 cells
CN106636154B (en) sgRNA screening system and method
Gerdes et al. Retrotransposon instability dominates the acquired mutation landscape of mouse induced pluripotent stem cells
Gladue et al. Interaction of structural core protein of classical swine fever virus with endoplasmic reticulum-associated degradation pathway protein OS9
AU2021347348A9 (en) Attb cell line, transgenic cell lines derived therefrom, and methods of making the same
CN113897363A (en) ACE2 gene knockout embryonic stem cell subline, construction method and application thereof
You et al. The Marek's Disease Virus Unique Gene Mdv082 Is Dispensable for Virus Replication But Contributes to a Rapid Disease Onset
CN110893240B (en) Application of NME2 gene in inhibiting avian reovirus replication
Nakade et al. Efficient selection of knocked-in pluripotent stem cells using a dual cassette cellular elimination system

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant