KR102468650B1 - Recombinant vector inducing expression of T7 RNA polymerase and mRNA capping enzyme and uses thereof - Google Patents

Abstract

The present invention relates to: a recombinant vector including an inducible promoter, an mRNA capping enzyme coding sequence, and a T7 RNA polymerase coding sequence; a host cell transformed with the recombinant vector; and uses thereof. According to the present invention, an in vitro transcription step can be skipped compared to a conventional virus production method using reverse genetics, and viruses can be produced with high efficiency. Therefore, the present invention can be usefully used in related fields.

Description

Recombinant vector inducing expression of T7 RNA polymerase and mRNA capping enzyme and uses thereof {Recombinant vector inducing expression of T7 RNA polymerase and mRNA capping enzyme and uses thereof}

The present invention relates to a recombinant vector for inducing expression of T7 RNA polymerase and mRNA capping enzyme and uses thereof.

T7 RNA polymerase is a single-subunit DNA-dependent RNA polymerase (ssRNAP) that makes RNA using DNA as a template and was discovered from T7 bacteriophage. T7 RNA polymerase recognizes a specific nucleotide sequence of the promoter and plays a role in transcribing the DNA nucleotide sequence following the T7 promoter into RNA.

97 kDa D1R and 33 kDa D12L are heterodimer proteins that are mRNA capping enzymes of vaccinia virus. These enzymes play three important roles in mRNA encapsidation: 1) mRNA triphosphatase, 2) guanyltransferase, and 3) (guanine-7-)methyltransferase. mRNA nucleic acid outgrowth is influenced by viral gene multisubunit RNA polymerase, early gene transcription initiation, termination factors, poly(A) polymerase, and mRNA capping enzyme .

The 2A self-cleaving peptide (or 2A peptide) family is a class of proteins composed of 18 to 22 amino acids, and is a protein used when constructing a polypeptide or linking two proteins. The long polypeptide is then cleaved between the carboxy-terminal proline (P)-glycine (G) to create two short protein fragments. There are a total of four 2A peptides, F2A, E2A, P2A and T2A.

Methods for inducing viruses from vectors containing full-length viral genes have been largely classified into two types. First, cells are transfected with viral mRNA induced using T7 RNA polymerase in a laboratory plastic tube, and then the virus is produced using an intracellular translation mechanism, or second, T7 RNA polymerization Viruses have been produced by transiently expressing the enzyme in cells or by inducing viral mRNA and protein in cells by transforming a capping enzyme and a viral vector into cells expressing only T7 RNA polymerase. However, its efficiency is extremely low, and the production of large-sized viruses has always been limited.

Meanwhile, Korean Patent Publication No. 2001-0029487 discloses 'a method for producing burnavirus from synthetic RNA transcripts', and Korean Patent Publication No. 2007-0110838 discloses 'rescue influenza virus'. There is no description of the 'recombinant vector for inducing and expressing T7 RNA polymerase and mRNA capping enzyme and use thereof' of the present invention.

The present invention was derived from the above needs, and the present inventors constructed a recombinant vector in which the expression of T7 RNA polymerase and mRNA capping enzyme are induced by a tetracycline derivative. After transforming the constructed recombinant vector into Vero cells, a cell line for vaccine production, introducing the full-length infectious cDNA clone of the virus into the transformed Vero cells, the T7 RNA polymerase and mRNA capping enzyme of the present invention were produced intracellularly. The present invention was completed by confirming that the method using the co-expressing transgenic Vero cells had significantly better virus productivity than the virus production method using in vitro transcription, a conventional virus production method.

In order to solve the above problems, the present invention is an inducible promoter; mRNA capping enzyme coding sequence; And T7 RNA polymerase coding sequence; it provides a recombinant vector comprising a.

In addition, the present invention provides a host cell transformed with the recombinant vector.

In addition, the present invention comprises (a) transforming a host cell with the recombinant vector; (b) inducing expression of mRNA capping enzyme and T7 RNA polymerase by treating the transformed host cell with tetracycline or a derivative thereof; and (c) introducing a recombinant vector containing a useful protein coding sequence into a transformed host cell in which the expression of the mRNA capping enzyme and T7 RNA polymerase is induced to induce expression of a useful protein. Provides a production method of

The present inventors constructed a recombinant vector in which T7 RNA polymerase and mRNA capping enzymes D1R and D12L are expressed through a tetracycline-induced system, and transformed cells with the recombinant vector to develop a cell model that facilitates virus production. The present invention can skip the in vitro transcription step compared to the conventional virus production method using reverse genetics and can produce viruses with high efficiency, so it can be usefully used in related fields.

Figure 1 is an overall schematic diagram of the present invention, illustrating the development and use of transformed cells using recombinant vectors.
Figure 2 is a vector map of the recombinant vector (pJM-TKpASite-PGKp-HygroB-iCapping-IRES-DsRed-NLS-T7Pol) of the present invention, (a) is a prior map schematically showing the important components of the recombinant vector, ( b) is a circular map.
Figure 3 is a cell that continuously expresses target proteins in Vero-E6 host cells using a recombinant vector, and it was confirmed through the expression of red protein (DsRed) from two cell lines that the target proteins were expressed through doxycycline. .
Figure 4 is the expression of green protein (GFP) by T7 RNA polymerase in two cell lines (Vero-E6-iT7Pol-Cap#32 and Vero-E6-iT7Pol-Cap#35) transformed with the recombinant vector of the present invention. This is the result of checking whether
Figure 5 is a result confirming the production of Middle East Respiratory Virus (MERS) in two cell lines (Vero-E6-iT7Pol-Cap#32 and Vero-E6-iT7Pol-Cap#35) transformed with the recombinant vector of the present invention. Reagent only: full-length viral infectious cDNA clone untreated group, Vector only: control group treated with a DNA vector containing no reagent and viral full-length cDNA, T7p-dGGG-MF: MERS virus full-length infectious cDNA clone transformed group , TREp-MF: A transgenic group using TRE (tetracyclin responsive element) as a promoter for expressing MERS virus full-length cDNA (TRE promoter is used instead of T7 promoter. TRE promoter expresses gene without T7 RNA polymerase when treated with tetracycline) T7p-dGGG-MF RNA: RNA transgenic group obtained by in vitro transcription of the T7p-dGGG-MF clone.

In order to achieve the object of the present invention, the present invention is an inducible promoter; mRNA capping enzyme coding sequences; And T7 RNA polymerase coding sequence; it provides a recombinant vector comprising a.

In the recombinant vector according to the present invention, the inducible promoter may be a tetracycline response element (TRE) promoter, but is not limited thereto.

In the recombinant vector according to the present invention, "T7 RNA polymerase" means an enzyme that recognizes the T7 promoter sequence and expresses mRNA from an inserted foreign gene located after the promoter sequence.

In the recombinant vector according to the present invention, the mRNA capping enzyme is preferably D1R (mRNA-capping enzyme 97 kDa subunit, UniProtKB - P04298) and D12L (mRNA-capping enzyme 33 kDa subunit, UniProtKB - P20980) derived from vaccinia virus. It may be, but is not limited thereto.

More specifically, the recombinant vector according to the present invention includes a TRE promoter; D12L coding sequence; 2A peptide coding sequence; D1R coding sequence; an internal ribosome entry site (IRES) sequence; 2A peptide coding sequence; nuclear localization signal (NLS) peptide coding sequence; T7 RNA polymerase coding sequence; and a polyadenylation signal sequence; may be operably linked, and a report gene sequence may be added after the IRES sequence, but is not limited thereto.

The recombinant vector according to an embodiment of the present invention most preferably includes a TRE promoter; D12L coding sequence; P2A peptide coding sequence; D1R coding sequence; IRES sequence; red protein (dsRed) coding sequence; T2A peptide coding sequence; NLS peptide coding sequence; T7 RNA polymerase coding sequence; and a polyadenylation signal sequence; may be operably linked, but is not limited thereto.

In addition, the recombinant vector may further include a reverse tetracycline-controlled transcativator (rtTA) expression cassette operably linked downstream of a cytomegalovirus (CMV) promoter, but is not limited thereto.

In the recombinant vector of the present invention, the TRE promoter can activate the transcription of a gene linked to the promoter by a rtTA (reverse tetracycline transactivator) protein. Specifically, the rtTA protein cannot bind to the TRE promoter and activate transcription when tetracycline or its derivative, doxycycline, is not present, and cannot activate the TRE promoter when tetracycline or its derivative, doxycycline, is present. binds to and activates transcription. Therefore, expression of T7 RNA polymerase and mRNA capping enzyme can be regulated by whether or not tetracycline or doxycycline is added.

In addition, the T7 RNA polymerase expressed in the recombinant vector of the present invention contains a nuclear localization signal (NLS) sequence at the amino terminal (N-term) side, and is expressed in cells and then moves into the nucleus. T7 RNA polymerase present in the nucleus can effectively proceed with production of viral gene mRNA from viral full-length infectious cDNA clones that migrate into the nucleus after being injected from the outside.

In the present invention, the term "operably linked" refers to a nucleic acid fragment that is combined with another nucleic acid fragment so that its function or expression is affected by the other nucleic acid fragment. That is, the sequences encoding the T7 RNA polymerase and the mRNA capping enzyme may be linked so that their expression can be controlled by a promoter in the vector.

According to one embodiment of the present invention, the recombinant vector (pJM-TKpASite-PGKp-HygroB-iCapping-IRES-DsRed-NLS-T7Pol, Fig. 2) of the present invention is D12L, D1R, DsRed, In addition to the nucleotide sequence encoding T7 RNA polymerase and the promoter sequence operably linked to the sequence, thymidine kinase polyadenine sequence (poly (A) signal (TK) site DNA), SV40 polyadenine sequence (SV40 poly A signal DNA ), a poly A adenine sequence (poly A signal DNA) or a bovine growth hormone poly adenine sequence (bGH poly A signal DNA) may be further included. The polyadenine sequence functions as a transcription termination sequence.

In the recombinant vector according to an embodiment of the present invention, the 2A peptide is foot-and-mouth disease virus 18-derived F2A (VKQTLNFDLLKLAGDVESNPGP, SEQ ID NO: 8), equine rhinitis A virus-derived E2A (QCTNYALLKLAGDVESNPGP, SEQ ID NO: 9), P2A from porcine teschovirus-1 (ATNFSLLKQAGDVEENPGP, SEQ ID NO: 10), or T2A from Thosea asigna virus (EGRGSLTCGDVEENPGP, SEQ ID NO: 11) can be

In one embodiment of the present invention, in the process of constructing the recombinant vector, whether each synthetic nucleotide sequence is spliced can be confirmed through nucleotide sequence analysis, and D12L, D1R, report protein (eg, DsRed) and T7 RNA polymerase expression cassette can be produced through synthesis. A recombinant (expression) vector containing such regulatory sequences and suitable transcriptional/translational control signals can be constructed by methods well known to those skilled in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombinant technology, and the like. The DNA sequence can be effectively linked to a suitable promoter in a recombinant (expression) vector to direct mRNA synthesis. Also, the recombinant (expression) vector may include a ribosome binding site and a transcription terminator as a translation initiation site.

Recombinant (expression) vectors will preferably include one or more selectable markers. The marker is a nucleic acid sequence having a characteristic that can be selected by a conventional chemical method, and includes all genes capable of distinguishing transformed cells from non-transformed cells. Examples include, but are not limited to, antibiotic resistance genes such as ampicillin, kanamycin, G418, bleomycin, hygromycin, and chloramphenicol.

As used herein, the term "recombinant" refers to a cell that replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a protein encoded by a heterologous peptide or a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the cell's native form, either in sense or antisense form. Recombinant cells can also express genes found in cells in their natural state, but the genes have been modified and reintroduced into the cell by artificial means.

In addition, in the present invention, the term "vector" is a circular DNA structure capable of carrying genes, replicating them in bacterial cells, and enabling gene expression in eukaryotic cells. It has a restriction enzyme recognition sequence (multiple cloning site) that recognizes and cuts only a specific nucleotide sequence, so it is possible to insert a gene or artificially synthesized sequence. Vectors include, but are not limited to, plasmid vectors, cosmid vectors, bacterial artificial chromosome vectors, yeast artificial chromosome vectors, bacteriophage vectors, viral vectors, and the like, and according to one embodiment of the present invention, pJM vectors are preferred.

In the present invention, the term "recombinant vector" is a vector constructed to insert a target gene into various vectors and express the target gene in a desired host cell, and contains essential regulatory elements that enable expression of the inserted gene. refers to genetic constructs that contain

In addition, in the present invention, the term "expression cassette" refers to a unit cassette capable of expressing a target protein or sequence to produce a target protein or sequence, and an expression cassette includes the following three main elements. It contains: i) a promoter; ii) a target protein coding sequence or a polynucleotide to be expressed, which is operably linked to the promoter and whose transcription is directed by the promoter when the corresponding expression cassette is introduced into a cell; and iii) a terminator polynucleotide (also referred to as a transcription terminator) that directs the termination of transcription and is located immediately downstream of the target protein coding sequence or polynucleotide to be expressed.

The recombinant vector according to the present invention may preferably consist of the nucleotide sequence of SEQ ID NO: 7, but is not limited thereto.

The present invention also provides a host cell transformed with the recombinant vector according to the present invention. A host cell according to the present invention is a cell expressing T7 RNA polymerase and mRNA capping enzymes (D12L and D1R).

In one embodiment of the present invention, the host cell may be any host cell known in the art capable of stably and continuously cloning and expressing the recombinant vector of the present invention, preferably a Vero cell line. It may, but is not limited thereto.

When the vector of the present invention is transformed into a eukaryotic cell, as a host cell, yeast ( Saccharomyce cerevisiae ), insect cell, human cell (eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2 , 3T3, RIN and MDCK cell lines) and plant cells, etc. may be used.

In addition, when the vector of the present invention is transformed into a prokaryotic cell, as a host cell, Escherichia coli ( Escherichia coli ), Bacillus genus ( Bacillus ) strain, Salmonella typhimurium ( Salmonella typhimurium ), Serratia Marcesson ( Serratia marcescens ) and Enterobacteriaceae and strains such as various Pseudomonas sp.

In the recombinant vector of the present invention and the host cell transformed therewith, the rtTA protein used for activation of the TRE promoter by doxycycline is continuously expressed by the CMV promoter, which is useful for the recovery of proteins using the TRE promoter, especially viruses. can be useful

The present invention also

(a) transforming a host cell with the recombinant vector of the present invention;

(b) inducing expression of mRNA capping enzyme and T7 RNA polymerase by treating the transformed host cell with tetracycline or a derivative thereof; and

(c) inducing expression of a useful protein by introducing a recombinant vector containing a useful protein coding sequence into a transformed host cell in which the expression of the mRNA capping enzyme and T7 RNA polymerase is induced; production methods are provided.

The method of delivering the recombinant vector of the present invention into a host cell (transformation method), when the host cell is a prokaryotic cell, the CaCl ₂ method, the Hanhan method (Hanahan, D, J Mol Biol, (1983) 166:557 -580) and electroporation method. In addition, when the host cell is a eukaryotic cell, the vector can be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and gene bombardment. can

In the production method according to one embodiment of the present invention, the induction of expression of mRNA capping enzyme and T7 RNA polymerase in step (b) is carried out by tetracycline or a derivative thereof (eg, doxycycline) after treatment with a report protein (reporter) For example, by detecting the expression of DsRed), it can be confirmed that the mRNA capping enzyme and the T7 RNA polymerase are expressed.

In addition, the production method of the present invention may further include a step of isolating and identifying a useful protein from the culture after culturing the host cell into which the useful protein coding sequence has been introduced in step (c). As a method for isolating and identifying the target component (useful protein) from the culture, any method known in the art may be used, and is not particularly limited to a specific method.

In the production method according to the present invention, the useful protein may be at least one selected from the group consisting of antigens, antibodies, cell receptors, enzymes, structural proteins, serum and cell proteins, but is not limited thereto, and the antigens are preferably Preferably, it may be a virus, and the virus is more preferably Middle East respiratory syndrome-related coronavirus (MERS-CoV), Severe acute respiratory syndrome coronavirus (SARS-CoV), and Severe acute respiratory syndrome coronavirus 2 of the Coronaviridae family. (SARS-CoV-2, cause of COVID-19), Zika virus, Dengue virus, Yellow fever virus, Rift valley fever virus, Lassa virus ( Lassa virus, Ebola virus, Marburg virus, Crimean Congo hemorrhagic fever virus, Nipah virus, Henipavirus or Chikungunya virus ( Chikungunya virus), but is not limited thereto.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

Example 1. Construction of vectors expressing mRNA capping enzymes (D12L and D1R), red protein (DsRed) and T7 RNA polymerase

To construct vectors expressing mRNA capping enzymes (D12L and D1R), red protein (DsRed) and T7 RNA polymerase, experiments were performed as follows.

1-1: Construction of pUC-JM vector

The pJM-rtTA vector was constructed by inserting the CMV promoter-rtTA coding gene and the TK promoter-TetR into the pUC19 (New England Biolabs, USA) vector. The CMV-rtTA expression cassette was from pRetroX-Tet-On Advanced (Takara Bio, Japan), the TK promoter was from pGLUC mini-TK (New England Biolab), and the TetR coding sequence was from Gateway ^TM pENTR ^TM 1A Dual selection vector. obtained through a chain reaction. The pJM-rtTA vector was constructed by inserting these three gene regions into the pUC-19 vector through Gibson assembly (New England Biolabs).

The pJM-rtTA vector was digested with NotI and PmeI restriction enzymes (New England Biolabs, USA) to remove all nucleotide sequences between the two restriction enzyme recognition sequences. Restriction enzyme reaction was performed at 37 ℃ for 16 hours after preparing the reactants under the conditions shown in Table 1 below. Then, DNA1 of SEQ ID NO: 1 (BamHI-NotI-Ko-Atg-V5 Tag-D12L-T2A-V5 Tag-D1R_opti-PacI) and DNA2 of SEQ ID NO: 2 (PacI-IRES-Ko-Atg-EcoRI-DsRed-EcoRI -MycNLS-T7pol_opti-BglII-PmeI-NheI) was custom-synthesized (Bionics, Korea), and then both DNAs were digested with NotI, PacI, and PmeI restriction enzymes. The reaction using the three restriction enzymes was performed at 37° C. for 16 hours after preparing the reactants under the conditions shown in Table 2 below.

NotI and PmeI restriction enzyme reaction composition dH ₂ O 33 μl Cutsmart (10X) 5 μl DNA (0.1 μg/μl) 10 μl NotI (10 units/μl) 1 μl PmeI (10 units/μl) 1 μl Total 50 µL

NotI, PacI and PmeI Restriction Enzyme Reaction Composition dH ₂ O 32 μl Cutsmart (10X) 5 μl DNA (0.1 μg/μl) 10 μl NotI (10 units/μl) 1 μl PacI (10 units/μL) 1 μl PmeI (10 units/μl) 1 μl Total 50 µl

The vector fragments, DNA1, and DNA2 cut with restriction enzymes were each separated using a PCR/Gel Purification kit (Favorgen, USA) according to the manufacturer's manual, and quantified to perform a ligation reaction. Ligation reaction was carried out at 16 ℃ for 16 hours with the reaction solution shown in Table 3 below.

ligation reaction composition dH ₂ O 2.5 μl T4 DNA Ligase buffer (10X) 1 μl Vector Fragment (25 ng/μl) 2 μl DNA1 (25 ng/μl) 2 μl DNA2 (25 ng/μL) 2 μl T4 DNA Ligase (20 units/μl) 0.5 μl Total 10 μl

After the ligation reaction, 2 μl of the ligation reaction was added to 50 μl of TOP10 competent cells (Thermo Fisher Scientific, USA) according to the manufacturer's instructions by heat shock method (42 ° C for 45 seconds and ice for 5 minutes). transformed. After culturing the transformed TOP10 cells, plasmid DNA was extracted using a Favorgen plasmid mini kit (Favorgen), and it was confirmed through sequencing that the pJM-rtTA vector and DNA1 and DNA2 were correctly linked. The vector in which DNA1 and DNA2 were ligated with the above vector was named pJM-D12LD1R-dsRed-T7Pol vector.

1-2: Construction of pJM vector into which hygromycin resistance gene (HygB) expressed by TKpA-site and PGK promoter is inserted

The pJM-D12LD1R-dsRed-T7Pol vector was digested with AgeI and HpaI restriction enzymes (Engenomics, Korea) to remove all nucleotide sequences between the two restriction enzyme recognition sequences. Restriction enzyme reaction was performed at 37 ℃ for 16 hours after preparing the reactants under the conditions shown in Table 4 below. The TKpA-site in the pcDNA3.1-Hygro(+) plasmid (Thermo Fisher Scientific) was amplified by PCR using the primers of SEQ ID NOs: 3 and 4, and the PCR product was purified using the Favorgen Gel/PCR Purification kit. In addition, PGKp-HygroB from pRetroX-tight-Hyg (Clontech, USA) was amplified by PCR using the primers of SEQ ID NOs: 5 and 6, and the PCR product was purified using Favorgen Gel/PCR Purification Kit. Thereafter, SLIC (sequence ligation independent cloning) ligation was performed on the restriction enzyme-treated vector and the two PCR amplification products using T4 DNA polymerse (Enginenomics, Korea), and after the reaction was completed, TOP10 50 μl of competent cells were transformed by heat shock using 2 μl of the ligation reaction. The finally prepared vector was named pJM-TKpASite-PGKp-HygroB-iCapping-IRES-DsRed-NLS-T7Pol (SEQ ID NO: 7) (FIG. 2). Restriction enzyme reaction, PCR reaction and SLIC reaction conditions are shown in Tables 4, 6 and 7 below.

AgeI and HpaI restriction enzyme reaction composition dH ₂ O 33 μl BufferD (10X) 5 μl DNA (0.2 μg/μl) 10 μl AgeI (10 units/μl) 1 μl HpaI (10 units/μL) 1 μl Total 50 µl

Primer information used for PCR sequence number Base sequence (5'→3') purpose 3 TTGACATGCTCCCGGGTAAACCGGTGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCG TKpA-site amplification 4 TCCCCTACCCCTATGGCAGGGCCTGCCGCCCCGA 5 CCTGCCATAGGGGTAGGGGAGGCGCTTTTCCCAA PGKp-HygroB amplification 6 TAAGCTGCAATAAACAAGTTAACCTATTCCTTTGCCCTC

PCR reaction composition and reaction conditions PCR reaction PCR cycle dH ₂ O 24 µl 94℃ 2 minutes KOD Neo Plus (5X) 10 μl 98℃ 10 seconds 30 times dNTPs (2 mM) 5 μl 58℃ 30 seconds MgSO4 3 μl 68℃ 30 seconds F primer (2 pmol) 3 μl 4℃ infinity R primer (2 pmol) 3 μl Vector (1 ng/μl) 1 μl KOD Neo Plus (1 units/μL) 1 μl Total 50 µl

SLIC reaction composition dH ₂ O 3.5 μl T4 DNA polymerase buffer (10X) 2 μl Vector Fragment (25 ng/μl) 2 μl PCR product 1 (10 ng/ul) 1 μl PCR product 2 (25 ng/ul) 1 μl T4 DNA polymerase (3 units/μl) 0.5 μl Total 10 μl

Example 2. Construction of transgenic Vero-E6 cells expressing D12L, D1R, DsRed and T7 RNA polymerase

2-1: Injection of pJM-TKpASite-PGKp-HygroB-iCapping-IRES-DsRed-NLS-T7Pol

1 μg of the pJM-TKpASite-PGKp-HygroB-iCapping-IRES-DsRed-NLS-T7Pol vector was prepared in one well of a 6-well plate using TrnasIT-LT1 Transfection Reagent (Mirus Bio, USA) according to the manufacturer's manual. Transformed by injecting 2 X 10 ⁵ Vero-E6 cells, and grown for 24 hours in a 37°C, 5% CO ₂ cell incubator. After 24 hours, all cells were harvested using trypsin, transferred to a 100 mm cell culture dish (SPL. Korea), and grown in a 37°C, 5% CO ₂ cell incubator for 24 hours. They were grown for one week in a cell culture medium (DMEM + 10% FBS + 1X Penicillin/streptomycin; Wellgene, Korea) supplemented with 250 μg/ml hygromycin B (Duchefa Biochemie, The Netherlands). It was replaced with a fresh cell culture medium supplemented with 100 μg/ml hygromycin B once every two days, and the surviving cells were maintained in the cell culture medium supplemented with 50 μg/ml hygromycin B after one week.

2-2: single cell cloning

Of the surviving cells, 50 cells were evenly placed in a 96-well plate (SPL) and allowed to grow in a cell growth medium supplemented with 250 μg/ml hygromycin B for 2 weeks. At this time, after checking whether the cell group in each well grew from one cell, only the well containing the cell group grown in one cell was selected. Cells in each well were transferred to 24-well, 6-well, 100 mm plates to increase the number of cells.

In order to confirm the expression pattern of the target protein in the finally obtained 11 cell groups, 1 μg/ml doxycycline (Duchefa Biochemie) was treated to confirm the expression level of red protein (DsRed) on the 2nd and 4th days, among which #32 and High levels of red protein expression were confirmed in #35 cells (FIG. 3). These cells were named Vero-E6-iT7Pol-Cap#32 and Vero-E6-iT7Pol-Cap#35, respectively.

2-3: Target protein expression by T7 RNA polymerase

1 μg of the pUC57-T7p-EGFP vector (which has only the T7 promoter, so that the target protein-EGFP-is expressed only by T7 RNA polymerase) was prepared in a 6-well plate using TransIT-LT1 Transfection Reagent according to the manufacturer's manual. 2 X 10 ⁵ were injected into each well of Vero-E6-iT7Pol-Cap#32 and Vero-E6-iT7Pol-Cap#35 cells. After vector injection, cell growth medium supplemented with 1 μg/ml doxycycline was added to express D12L, D1R, and T7 RNA polymerase, and GFP expression was confirmed on days 1 and 2. As a result, EGFP expression was confirmed in both Vero-E6-iT7Pol-Cap#32 and Vero-E6-iT7Pol-Cap#35, and it was confirmed that the expression level increased with time (FIG. 4).

2-4: Confirmation of virus production using viral full-length infectious cDNA clones

TransIT-LT1 Transfection reagent was used to prepare 1 μg of pCCI-SalI-SF-T7p-dGGG-MF vector (Korean Patent Registration No. 10-2119875), a full-length infectious cDNA clone of middle east respiratory syndrome virus (MERS). According to the manufacturer's manual, 2 X 10 ⁵ Vero-E6-iT7Pol-Cap#32 and Vero-E6-iT7Pol-Cap#35 cells were injected into each well of a 6-well plate. After vector injection, cell growth medium supplemented with 1 μg/ml doxycycline was added to express D12L, D1R, and T7 RNA polymerase, and virus production was confirmed in both cells. As a result of confirming the virus titer using the TCID ₅₀ method, it was confirmed that 4.86 X 10 ⁷ of virus was produced in Vero-E6-iT7Pol-Cap#32, and 3.17 X 10 ⁸ in Vero-E6-iT7Pol-Cap#35. It was confirmed that the virus was produced (FIG. 5). In addition, T7p-dGGG-MF RNA was prepared from the pCCI-SalI-SF-T7p-dGGG-MF vector using in vitro transcription, and in the same manner as above, Vero-E6, Huh-7, and Vero-E6 When 2 μg of T7p-dGGG-MF RNA was transfected into iT7Pol-Cap#32 and Vero-E6-iT7Pol-Cap#35 cells, it was confirmed that no virus was produced in all cells.

From the above results, it can be seen that the recombinant vector pJM-TKpASite-PGKp-HygroB-iCapping-IRES-DsRed-NLS-T7Pol constructed in the present invention and host cells transformed with the recombinant vector are very useful for virus production.

<110> INDUSTRIAL COOPERATION FOUNDATION JEONBUK NATIONAL UNIVERSITY <120> Recombinant vector inducing expression of T7 RNA polymerase and mRNA capping enzyme and uses its <130> PN22143 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 3600 <212 > DNA <213> Artificial Sequence <220> <223> BamHI-NotI-Ko-Atg-V5 Tag-D12L-T2A-V5 Tag-D1R_opti-PacI <400> 1 tcagatcgcc tggagaagga tccgcgcggc cgcgccacca tgggcaagcc catccccaac 60 cccccgacga at gccccgacgaacg cat gggcacccac 120 gtgctgctgc ccttctacga gaccctgccc gagctgaacc tgagcctggg caagagcccc 180 ctgcccagcc tggagtacgg cgccaactac ttcctgcaga tcagccgcgt gaacgacctg 240 aaccgcatgc ccaccgacat gctgaagctg ttcacccacg acatcatgct gcccgagagc 300 gacctggaca aggtgtacga gatcctgaag atcaacagcg tgaagtacta cggccgcagc 360 accaaggccg acgccgtggt ggccgacctg agcgcccgca acaagctgtt caagcgcgag 420 cgcgacgcca tcaagagcaa caaccacctg accgagaaca acctgtacat cagcgactac 480 aagatgctga ccttcgacgt gttccgcccc ctgttcgact tcgtgaacga gaagtactgc 540 atcatcaagc tgcccaccct gttcggccgc ggcgtgatcg acaccatgcg catctactgc 600 agcctgttca agaacgtgcg cctgctgaag tgcgtgagcg acagctggct gaaggacagc 660 gccatcatgg tggccagcga cgtgtgcaag aagaacctgg acctgttcat gagccacgtg 720 aagagcgtga ccaagagcag cagctggaag gacgtgaaca gcgtgcagtt cagcatcctg 780 aacaaccccg tggacaccga gttcatcaac aagttcctgg agttcagcaa ccgcgtgtac 840 gaggccctgt actacgtgca cagcctgctg tacagcagca tgaccagcga cagcaagagc 900 atcgagaaca agcaccagcg ccgcctggtg aagctgctgc tgggcagcgg cgagggccgc 960 ggcagcctgc tgacctgcgg cgacgtggag gagaaccccg gccccggcaa gcccatcccc 1020 aaccccctgc tgggcctgga cagcaccgac gccaacgtgg tgagcagcag caccatcgcc 1080 acctacatcg acgccctggc caagaacgcc agcgagctgg agcagcgcag caccgcctac 1140 gagatcaaca acgagctgga gctggtgttc atcaagcccc ccctgataac cctgaccaac 1200 gtggtgaaca tcagcaccat ccaggagagc ttcatccgct tcaccgtgac caacaaggag 1260 ggcgtgaaga tccgcaccaa gatccccctg agcaaggtgc acggcctgga cgtgaagaac 1320 gtgcagctgg tggacgccat cgacaacatc gtgtgggaga agaagagcct ggtgaccgag 1380 aaccgcctgc acaaggagtg cctgctgcgc ct gagcaccg aggagaggta catcttcctg 1440 gactacaaga agtacggcag cagcatccgc ctggagctgg tgaacctgat ccaggccaag 1500 accaagaact tcaccatcga cttcaagctg aagtacttcc tgggcagcgg cgcccagagc 1560 aagagcagcc tgctgcacgc catcaaccac cccaagagcc gccccaacac cagcctggag 1620 atcgagttca ccccccgcga caacgagaag gtgccctacg acgagctgat aaaggagctg 1680 accaccctga gccgccacat cttcatggcc agccccgaga acgtgatcct gagccccccc 1740 atcaacgccc ccatcaagac cttcatgctg cccaagcagg acatcgtggg cctggacctg 1800 gagaacctgt acgccgtgac caagaccgac ggcatcccca tcaccatccg cgtgaccagc 1860 aacggcctgt actgctactt cacccacctg ggctacatca tccgctaccc cgtgaagcgc 1920 atcatcgaca gcgaggtggt ggtgttcggc gaggccgtga aggacaagaa ctggaccgtg 1980 tacctgataa agctgatcga gcccgtgaac gccatcaacg accgcctgga ggagagcaag 2040 tacgtggaga gcaagctggt ggacatctgc gaccgcatcg tgttcaagag caagaagtac 2100 gagggcccct tcaccaccac cagcgaggtg gtggacatgc tgagcaccta cctgcccaag 2160 cagcccgagg gcgtgatcct gttctacagc aagggcccca agagcaacat cgacttcaag 2220 atcaagaagg agaacaccat cgaccagacc gccaacgt gg tgttccgcta catgagcagc 2280 gagcccatca tcttcggcga gagcagcatc ttcgtggagt acaagaagtt cagcaacgac 2340 aagggcttcc ccaaggagta cggcagcggc aagatcgtgc tgtacaacgg cgtgaactac 2400 ctgaacaaca tctactgcct ggagtacatc aacacccaca acgaggtggg catcaagagc 2460 gtggtggtgc ccatcaagtt catcgccgag ttcctggtga acggcgagat cctgaagccc 2520 cgcatcgaca agaccatgaa gtacatcaac agcgaggact actacggcaa ccagcacaac 2580 atcatcgtgg agcacctgcg cgaccagagc atcaagatcg gcgacatctt caacgaggac 2640 aagctgagcg acgtgggcca ccagtacgcc aacaacgaca agttccgcct gaaccccgag 2700 gtgagctact tcaccaacaa gcgcacccgc ggccccctgg gcatcctgag caactacgtg 2760 aagaccctgc tgatctcgat gtactgcagc aagaccttcc tggacgacag caacaagcgc 2820 aaggtgctgg ccatcgactt cggcaacggc gccgacctgg agaagtactt ctacggcgag 2880 atcgccctgc tggtggccac cgaccccgac gccgacgcca tcgcccgcgg caacgagagg 2940 tacaacaagc tgaacagcgg catcaagacc aagtactaca agttcgacta catccaggag 3000 accatccgca gcgacacctt cgtgagcagc gtgcgcgagg tgttctactt cggcaagttc 3060 aacatcatcg actggcagtt cgccatccac tacagcttcc acc cccgcca ctacgccacc 3120 gtgatgaaca acctgagcga gctgaccgcc agcggcggca aggtgctgat aaccaccatg 3180 gacggcgaca agctgagcaa gctgaccgac aagaagacct tcatcatcca caagaacctg 3240 cccagcagcg agaactacat gagcgtggag aagatcgccg acgaccgcat cgtggtgtac 3300 aaccccagca ccatgagcac ccccatgacc gagtacatca tcaagaagaa cgacatcgtg 3360 cgcgtgttca acgagtacgg cttcgtgctg gtggacaacg tggacttcgc caccatcatc 3420 gagcgcagca agaagttcat caacggcgcc agcaccatgg aggaccgccc cagcaccaag 3480 aacttcttcg agctgaaccg cggcgccatc aagtgcgagg gcctggacgt ggaggacctg 3540 ctgagctact acgtggtgta cgtgttcagc aagaggtaat taattaaccg cccctctccc 3600 3600 <210> 2 <211> 4052 <212> DNA <213> Artificial Sequence <220> <223> PacI-IRES-Ko-Atg-EcoRI-DsRed-EcoRIT-Myc -BglII-PmeI-N heI <400> 2 ggtaattaat taaccgcccc tctccctccc ccccccctaa cgttactggc cgaagccgct 60 tggaataagg ccggtgtgcg tttgtctata tgttattttc caccatattg ccgtcttttg 120 gcaatgtgag ggcccggaaa cctggccctg tcttcttgac gagcattcct aggggtcttt 180 cccctctcgc caaaggaatg caaggtctgt tgaatgtcgt gaagg aagca gttcctctgg 240 aagcttcttg aagacaaaca acgtctgtag cgaccctttg caggcagcgg aaccccccac 300 ctggcgacag gtgcctctgc ggccaaaagc cacgtgtata agatacacct gcaaaggcgg 360 cacaacccca gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa tggctctcct 420 caagcgtatt caacaagggg ctgaaggatg cccagaaggt accccattgt atgggatctg 480 atctggggcc tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa aacgtctagg 540 ccccccgaac cacggggacg tggttttcct ttgaaaaaca cgatgatgcc accatggaat 600 tcgatagcac tgagaacgtc atcaagccct tcatgcgctt caaggtgcac atggagggct 660 ccgtgaacgg ccacgagttc gagatcgagg gcgagggcga gggcaagccc tacgagggca 720 cccagaccgc caagctgcag gtgaccaagg gcggccccct gcccttcgcc tgggacatcc 780 tgtcccccca gttccagtac ggctccaagg tgtacgtgaa gcaccccgcc gacatccccg 840 actacaagaa gctgtccttc cccgagggct tcaagtggga gcgcgtgatg aacttcgagg 900 acggcggcgt ggtgaccgtg acccaggact cctccctgca ggacggcacc ttcatctacc 960 acgtgaagtt catcggcgtg aacttcccct ccgacggccc cgtaatgcag aagaagactc 1020 tgggctggga gccctccacc gagcgcctgt acccccgcga cggcgtgctg aagggcgaga 10 80 tccacaaggc gctgaagctg aagggcggcg gccactacct ggtggagttc aagtcaatct 1140 acatggccaa gaagcccgtg aagctgcccg gctactacta cgtggactcc aagctggaca 1200 tcacctccca caacgaggac tacaccgtgg tggagcagta cgagcgcgcc gaggcccgcc 1260 accacctgtt ccaggaattc ggcagcggcg ccaccaactt cagcctgctg aagcaggccg 1320 gcgacgtgga ggagaacccc ggcccccccg ccgccaagcg cgtgaagctg gacaacacca 1380 tcaacatcgc caagaacgac ttcagcgaca tcgagctggc cgccatcccc ttcaacaccc 1440 tggccgacca ctacggcgag cgcctggccc gcgagcagct ggccctggag cacgagagct 1500 acgagatggg cgaggcccgc ttccgcaaga tgttcgagcg ccagctgaag gccggcgagg 1560 tggccgacaa cgccgccgcc aagcccctga taaccaccct gctgcccaag atgatcgccc 1620 gcatcaacga ctggttcgag gaggtgaagg ccaagcgcgg caagcgcccc accgccttcc 1680 agttcctgca ggagatcaag cccgaggccg tggcctacat caccatcaag accaccctgg 1740 cctgcctgac cagcgccgac aacaccaccg tgcaggccgt ggccagcgcc atcggccgcg 1800 ccatcgagga cgaggcccgc ttcggccgca tccgcgacct ggaggccaag cacttcaaga 1860 agaacgtgga ggagcagctg aacaagcgcg tgggccacgt gtacaagaag gccttcatgc 1920 agg tggtgga ggccgacatg ctgagcaagg gcctgctggg cggcgaggcc tggagcagct 1980 ggcacaagga ggacagcatc cacgtgggcg tgcgctgcat cgagatgctg atcgagagca 2040 ccggcatggt gagcctgcac cgccagaacg ccggcgtggt gggccaggac agcgagacca 2100 tcgagctggc ccccgagtac gccgaggcca tcgccacccg cgccggcgcc ctggccggca 2160 tcagccccat gttccagccc tgcgtggtgc cccccaagcc ctggaccggc atcaccggcg 2220 gcggctactg ggccaacggc cgccgccccc tggccctggt gcgcacccac agcaagaagg 2280 ccctgatgcg ctacgaggac gtgtacatgc ccgaggtgta caaggccatc aacatcgccc 2340 agaacaccgc ctggaagatc aacaagaagg tgctggccgt ggccaacgtg ataaccaagt 2400 ggaagcactg ccccgtggag gacatccccg ccatcgagcg cgaggagctg cccatgaagc 2460 ccgaggacat cgacatgaac cccgaggccc tgaccgcctg gaagcgcgcc gccgccgccg 2520 tgtaccgcaa ggacaaggcc cgcaagagcc gccgcatcag cctggagttc atgctggagc 2580 aggccaacaa gttcgccaac cacaaggcca tctggttccc ctacaacatg gactggcgcg 2640 gcagggtgta cgccgtgagc atgttcaacc cccagggcaa cgacatgacc aagggcctgc 2700 tgaccctggc caagggcaag cccatcggca aggagggcta ctactggctg aagatccacg 2760 gcgccaact g cgccggcgtg gacaaggtgc ccttccccga gcgcatcaag ttcatcgagg 2820 agaaccacga gaacatcatg gcctgcgcca agagccccct ggagaacacc tggtgggccg 2880 agcaggacag ccccttctgc ttcctggcct tctgcttcga gtacgccggc gtgcagcacc 2940 acggcctgag ctacaactgc agcctgcccc tggccttcga cggcagctgc agcggcatcc 3000 agcacttcag cgccatgctg cgcgacgagg tgggcggcag ggccgtgaac ctgctgccca 3060 gcgagaccgt gcaggacatc tacggcatcg tggccaagaa ggtgaacgag atcctgcagg 3120 ccgacgccat caacggcacc gacaacgagg tggtgaccgt gaccgacgag aacaccggcg 3180 agatcagcga gaaggtgaag ctgggcacca aggccctggc cggccagtgg ctggcctacg 3240 gcgtgacccg cagcgtgacc aagcgcagcg tgatgaccct ggcctacggc agcaaggagt 3300 tcggcttccg ccagcaggtg ctggaggaca ccatccagcc cgccatcgac agcggcaagg 3360 gcctgatgtt cacccagccc aaccaggccg ccggctacat ggccaagctg atctgggaga 3420 gcgtgagcgt gaccgtggtg gccgccgtgg aggccatgaa ctggctgaag agcgccgcca 3480 agctgctggc cgccgaggtg aaggacaaga agaccggcga gatcctgcgc aagaggtgcg 3540 ccgtgcactg ggtgaccccc gacggcttcc ccgtgtggca ggagtacaag aagcccatcc 3600 agacccgcct gaac ctgatg ttcctgggcc agttccgcct gcagcccacc atcaacacca 3660 acaaggacag cgagatcgac gcccacaagc aggagagcgg catcgccccc aacttcgtgc 3720 acagccagga cggcagccac ctgcgcaaga ccgtggtgtg ggcccacgag aagtacggca 3780 tcgagagctt cgccctgatc cacgacagct tcggcaccat ccccgccgac gccgccaacc 3840 tgttcaaggc cgtgcgcgag accatggtgg acacctacga gagctgcgac gtgctggccg 3900 acttctacga ccagttcgcc gaccagctgc acgagagcca gctggacaag atgcccgccc 3960 tgcccgccaa gggcaacctg aacctgcgcg acatcctgga gagcgacttc gccttcgcct 4020 aaagatctgt ttaaacgcta gcgcctcgac tg 4052 <210> 3 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ttgacatgct cccgggtaaa ccggtggggg aggctaactg aaacacggaa ggagacaata 60 ccg 63 <210> 4 <211> 24 <211> 34 > DNA <213> Artificial Sequence <220> <223> primer <400> 4 tcccctaccc ctatggcagg gcctgccgcc ccga 34 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 cctgccatag gggtagggga ggcgcttttc ccaa 34 <210> 6 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 taagctgcaa taaacaagtt aacctattcc tttgccctc 39 <210> 7 <211> 15590 <212> DNA <213> Artificial Sequence <220> <223> pJM-TKpASite-PGKp-HygroB-iCapping-IRES-DsRed-NLS-T7Pol <400> 7 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatgat cgattagtta ttaatagtaa tcaattacgg ggtcattagt tcatagccca 240 tatatggagt tccgcgttac ataacttacg gtaaatggcc cgcctggctg accgcccaac 300 gacccccgcc cattgacgtc aataatgacg tatgttccca tagtaacgcc aatagggact 360 ttccattgac gtcaatgggt ggagtattta cggtaaactg cccacttggc agtacatcaa 420 gtgtatcata tgccaagtac gccccctatt gacgtcaatg acggtaaatg gcccgcctgg 480 cattatgccc agtacatgac cttatgggac tttcctactt ggcagtacat ctacgtatta 540 gtcatcgcta ttaccatggt gatgcggttt tggcagtaca tcaatgggcg tggatagcgg 600 tttgactcac ggggatttcc aagtctccac cccattgacg tcaatgggag tttgttttgg 660 caccaaaatc aacgggactt tccaaaatgt cgtaacaact ccgccccat t gacgcaaatg 720 ggcggtaggc gtgtacggtg ggaggtctat ataagcagag ctggtttagt gaaccgtcag 780 atcatttaaa tccaccatgt ccagactgga caagagcaaa gtcataaacg gcgctctgga 840 attactcaat ggagtcggta tcgaaggcct gacgacaagg aaactcgctc aaaagctggg 900 agttgagcag cctaccctgt actggcacgt gaagaacaag cgggccctgc tcgatgccct 960 gccaatcgag atgctggaca ggcatcatac ccacttctgc cccctggaag gcgagtcatg 1020 gcaagacttt ctgcggaaca acgccaagtc attccgctgt gctctcctct cacatcgcga 1080 cggggctaaa gtgcatctcg gcacccgccc aacagagaaa cagtacgaaa ccctggaaaa 1140 tcagctcgcg ttcctgtgtc agcaaggctt ctccctggag aacgcactgt acgctctgtc 1200 cgccgtgggc cactttacac tgggctgcgt attggaggaa caggagcatc aagtagcaaa 1260 agaggaaaga gagacaccta ccaccgattc tatgccccca cttctgagac aagcaattga 1320 gctgttcgac cggcagggag ccgaacctgc cttccttttc ggcctgaact aatcatatgt 1380 ggcctgagaa acagctaaag tgcgaaagcg gcgggccggc cgacgccctt gacgattttg 1440 acttagacat gctcccagcc gatgcccttg acgactttga ccttgatatg ctgcctgctg 1500 acgctcttga cgatttggac cttgacatgc tcccgggtaa accggtgggg gaggctaac t 1560 gaaacacgga aggagacaat accggaagga acccgcgcta tgacggcaat aaaaagacag 1620 aataaaacgc acggtgttgg gtcgtttgtt cataaacgcg gggttcggtc ccagggctgg 1680 cactctgtcg ataccccacc gagaccccat tggggccaat acgcccgcgt ttcttccttt 1740 tccccacccc accccccaag ttcgggtgaa ggcccagggc tcgcagccaa cgtcggggcg 1800 gcaggccctg ccataggggt aggggaggcg cttttcccaa ggcagtctgg agcatgcgct 1860 ttagcagccc cgctgggcac ttggcgctac acaagtggcc tctggcctcg cacacattcc 1920 acatccaccg gtaggcgcca accggctccg ttctttggtg gccccttcgc gccaccttct 1980 actcctcccc tagtcaggaa gttccccccc gccccgcagc tcgcgtcgtg caggacgtga 2040 caaatggaag tagcacgtct cactagtctc gtgcagatgg acagcaccgc tgagcaatgg 2100 aagcgggtag gcctttgggg cagcggccaa tagcagcttt gctccttcgc tttctgggct 2160 cagaggctgg gaaggggtgg gtccgggggc gggctcaggg gcgggctcag gggcggggcg 2220 ggcgcccgaa ggtcctccgg aggcccggca ttctgcacgc ttcaaaagcg cacgtctgcc 2280 gcgctgttct cctcttcctc atctccgggc ctttcgacct gcatcccgcc accatgaaaa 2340 agcctgaact caccgcgacg tctgtcgaga agtttctgat cgaaaagttc gacagcgtct 2400 ccgacctgat gcagctctcg gagggcgaag aatctcgtgc tttcagcttc gatgtaggag 2460 ggcgtggata tgtcctgcgg gtaaatagct gcgccgatgg tttctacaaa gatcgttatg 2520 tttatcggca ctttgcatcg gccgcgctcc cgattccgga agtgcttgac attggggagt 2580 tcagcgagag cctgacctat tgcatctccc gccgtgcaca gggtgtcacg ttgcaagacc 2640 tgcctgaaac cgaactgccc gctgttctgc agccggtcgc ggaggccatg gatgcgatcg 2700 ctgcggccga tcttagccag acgagcgggt tcggcccatt cggaccgcaa ggaatcggtc 2760 aatacactac atggcgtgat ttcatatgcg cgattgctga tccccatgtg tatcactggc 2820 aaactgtgat ggacgacacc gtcagtgcgt ccgtcgcgca ggctctcgat gagctgatgc 2880 tttgggccga ggactgcccc gaagtccggc acctcgtgca cgcggatttc ggctccaaca 2940 atgtcctgac ggacaatggc cgcataacag cggtcattga ctggagcgag gcgatgttcg 3000 gggattccca atacgaggtc gccaacatct tcttctggag gccgtggttg gcttgtatgg 3060 agcagcagac gcgctacttc gagcggaggc atccggagct tgcaggatcg ccgcggctcc 3120 gggcgtatat gctccgcatt ggtcttgacc aactctatca gagcttggtt gacggcaatt 3180 tcgatgatgc agcttgggcg cagggtcgat gcgacgcaat cgtccgatcc ggagccggga 3240 ctgtc gggcg tacacaaatc gcccgcagaa gcgcggccgt ctggaccgat ggctgtgtag 3300 aagtactcgc cgatagtgga aaccgacgcc ccagcactcg tccgagggca aaggaatagg 3360 ttaacttgtt tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca 3420 caaataaagc atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat 3480 gcgatcgctt ttcgatacta gtgtcgacca cacaaaaaac caacacacag atgtaatgaa 3540 aataaagata ttttattcgt acgttaccag ggatcctctc cttgctgcaa cagggagatc 3600 acctttggtt tggtaaacag gaatcctgcc atggaggcca ggttgctgta attctccagc 3660 atcacctcac ggtacaggct tctctgagac agatccagct tcttccactc gtcccgagta 3720 aagagcacag ccacatcttc aaatgtcact gacactgcta gctttctctt cttttttggt 3780 ttattaccat cctcaatggg tgtatgcttt ttttcatcta actgtgcaga aaatccaaat 3840 attaatgatt tcagcccgaa atggaaggcc atttcagcag aggttctcgc ctgaatatta 3900 aatgcctctt gtaataatgg tggtgcagcg tctatcacat gattattttc tatctggttt 3960 gttgcttgct cctctaatac tgcacccaac gtaaaatggc tgatagattg cagaatgaaa 4020 agagcctcct cgaccgaaaa ccctgcatcg catagacagc gtagttgcgc ctctgcttgt 4080 tcaaactggg ggggcgtagg agaggtccct atatgcaatc gggctccatc acgatggacc 4140 agtaatgctt tacggaaact cagagcattt tcctggagaa actgctgcca actctcagtc 4200 ggtaacggtg ctgaacgggt gtgatgcttc gccagtattg cctctgaaag catgttcata 4260 agagtctgct tgttgcgcac gtgccaatac aatgtaggct gctctacacc tagcttctgg 4320 gcgagtttac gggttgttaa accttcgatt ccgacctcat taagcagctc taatgcgctg 4380 ttaatcactt tacttttatc taatctagac atggaggtgc atgcttaagc gggtcgctgc 4440 agggtcgctc ggtgttcgag gccacacgcg tcaccttaat atgcgaagtg gacctgggac 4500 cgcgccgccc cgactgcatc tgcgtgttcg aattcgccaa tgacaagacg ctgggcgggg 4560 tttgtgtcat catagaacta aagacatgca aatatatttc ttccggggac accgccagca 4620 aacgcgagca acgggccacg gggatgaagc agctgcgcca ctccctgaag ctcctgcagt 4680 ccctcgcgcc tccgggtgac aagatagtgt acctgtgccc cgtcctggtg tttgtcgccc 4740 aacggacgct ccgcgtcagc cgcgtgaccc ggctcgtccc gcagaaggtc tccggtaata 4800 tcaccgcagt cgtgcggatg ctccagagcc tgtccacgta tacggtcccc atggagccta 4860 ggacccagcg agcccgtcgc cgccgcggcg gcgccgcccg ggggtctgcg agcagaccga 4920 aaaggtcaca ctctgg ggcg cgcgacccgc ccgagtcagc ggcccgccag ttaccacccg 4980 ccgaccaaac ccccgcctcc acggagggcg ggggggtgct taagaggatc gcggcgctct 5040 tctgcgtgcc cgtggccacc aagaccaaac cccgagccgc ctccgaatga gagtgtttcg 5100 ttccttcccc ctccccccgc gtcagacaaa ccctaaccac cgcttaagcg gcccccgcga 5160 ggtccgaaga ctcatttatg catttacgcg tttggcgcgc cgatatcctc gagtttactc 5220 cctatcagtg atagagaacg tatgtcgagt ttactcccta tcagtgatag agaacgatgt 5280 cgagtttact ccctatcagt gatagagaac gtatgtcgag tttactccct atcagtgata 5340 gagaacgtat gtcgagttta ctccctatca gtgatagaga acgtatgtcg agtttatccc 5400 tatcagtgat agagaacgta tgtcgagttt actccctatc agtgatagag aacgtatgtc 5460 gaggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg aaccgtcaga 5520 tcgcctggag aaggatccgc ggccgcgcca ccatgggcaa gcccatcccc aaccccctgc 5580 tgggcctgga cagcaccgac gagatcgtga agaacatccg cgagggcacc cacgtgctgc 5640 tgcccttcta cgagaccctg cccgagctga acctgagcct gggcaagagc cccctgccca 5700 gcctggagta cggcgccaac tacttcctgc agatcagccg cgtgaacgac ctgaaccgca 5760 tgcccaccga catgctgaag ctgttcaccc acgacatcat gctgcccgag agcgacctgg 5820 acaaggtgta cgagatcctg aagatcaaca gcgtgaagta ctacggccgc agcaccaagg 5880 ccgacgccgt ggtggccgac ctgagcgccc gcaacaagct gttcaagcgc gagcgcgacg 5940 ccatcaagag caacaaccac ctgaccgaga acaacctgta catcagcgac tacaagatgc 6000 tgacct tcga cgtgttccgc cccctgttcg acttcgtgaa cgagaagtac tgcatcatca 6060 agctgcccac cctgttcggc cgcggcgtga tcgacaccat gcgcatctac tgcagcctgt 6120 tcaagaacgt gcgcctgctg aagtgcgtga gcgacagctg gctgaaggac agcgccatca 6180 tggtggccag cgacgtgtgc aagaagaacc tggacctgtt catgagccac gtgaagagcg 6240 tgaccaagag cagcagctgg aaggacgtga acagcgtgca gttcagcatc ctgaacaacc 6300 ccgtggacac cgagttcatc aacaagttcc tggagttcag caaccgcgtg tacgaggccc 6360 tgtactacgt gcacagcctg ctgtacagca gcatgaccag cgacagcaag agcatcgaga 6420 acaagcacca gcgccgcctg gtgaagctgc tgctgggcag cggcgagggc cgcggcagcc 6480 tgctgacctg cggcgacgtg gaggagaacc ccggccccgg caagcccatc cccaaccccc 6540 tgctgggcct ggacagcacc gacgccaacg tggtgagcag cagcaccatc gccacctaca 6600 tcgacgccct ggccaagaac gccagcgagc tggagcagcg cagcaccgcc tacgagatca 6660 acaacgagct ggagctggtg ttcatcaagc cccccctgat aaccctgacc aacgtggtga 6720 acatcagcac catccaggag agcttcatcc gcttcaccgt gaccaacaag gagggcgtga 6780 agatccgcac caagatcccc ctgagcaagg tgcacggcct ggacgtgaag aacgtgcagc 6840 tggtggacgc c atcgacaac atcgtgtggg agaagaagag cctggtgacc gagaaccgcc 6900 tgcacaagga gtgcctgctg cgcctgagca ccgaggagag gtacatcttc ctggactaca 6960 agaagtacgg cagcagcatc cgcctggagc tggtgaacct gatccaggcc aagaccaaga 7020 acttcaccat cgacttcaag ctgaagtact tcctgggcag cggcgcccag agcaagagca 7080 gcctgctgca cgccatcaac caccccaaga gccgccccaa caccagcctg gagatcgagt 7140 tcaccccccg cgacaacgag aaggtgccct acgacgagct gataaaggag ctgaccaccc 7200 tgagccgcca catcttcatg gccagccccg agaacgtgat cctgagcccc cccatcaacg 7260 cccccatcaa gaccttcatg ctgcccaagc aggacatcgt gggcctggac ctggagaacc 7320 tgtacgccgt gaccaagacc gacggcatcc ccatcaccat ccgcgtgacc agcaacggcc 7380 tgtactgcta cttcacccac ctgggctaca tcatccgcta ccccgtgaag cgcatcatcg 7440 acagcgaggt ggtggtgttc ggcgaggccg tgaaggacaa gaactggacc gtgtacctga 7500 taaagctgat cgagcccgtg aacgccatca acgaccgcct ggaggagagc aagtacgtgg 7560 agagcaagct ggtggacatc tgcgaccgca tcgtgttcaa gagcaagaag tacgagggcc 7620 ccttcaccac caccagcgag gtggtggaca tgctgagcac ctacctgccc aagcagcccg 7680 agggcgtgat cctgttc tac agcaagggcc ccaagagcaa catcgacttc aagatcaaga 7740 aggagaacac catcgaccag accgccaacg tggtgttccg ctacatgagc agcgagccca 7800 tcatcttcgg cgagagcagc atcttcgtgg agtacaagaa gttcagcaac gacaagggct 7860 tccccaagga gtacggcagc ggcaagatcg tgctgtacaa cggcgtgaac tacctgaaca 7920 acatctactg cctggagtac atcaacaccc acaacgaggt gggcatcaag agcgtggtgg 7980 tgcccatcaa gttcatcgcc gagttcctgg tgaacggcga gatcctgaag ccccgcatcg 8040 acaagaccat gaagtacatc aacagcgagg actactacgg caaccagcac aacatcatcg 8100 tggagcacct gcgcgaccag agcatcaaga tcggcgacat cttcaacgag gacaagctga 8160 gcgacgtggg ccaccagtac gccaacaacg acaagttccg cctgaacccc gaggtgagct 8220 acttcaccaa caagcgcacc cgcggccccc tgggcatcct gagcaactac gtgaagaccc 8280 tgctgatctc gatgtactgc agcaagacct tcctggacga cagcaacaag cgcaaggtgc 8340 tggccatcga cttcggcaac ggcgccgacc tggagaagta cttctacggc gagatcgccc 8400 tgctggtggc caccgacccc gacgccgacg ccatcgcccg cggcaacgag aggtacaaca 8460 agctgaacag cggcatcaag accaagtact acaagttcga ctacatccag gagaccatcc 8520 gcagcgacac cttcgtgagc ag cgtgcgcg aggtgttcta cttcggcaag ttcaacatca 8580 tcgactggca gttcgccatc cactacagct tccacccccg ccactacgcc accgtgatga 8640 acaacctgag cgagctgacc gccagcggcg gcaaggtgct gataaccacc atggacggcg 8700 acaagctgag caagctgacc gacaagaaga ccttcatcat ccacaagaac ctgcccagca 8760 gcgagaacta catgagcgtg gagaagatcg ccgacgaccg catcgtggtg tacaacccca 8820 gcaccatgag cacccccatg accgagtaca tcatcaagaa gaacgacatc gtgcgcgtgt 8880 tcaacgagta cggcttcgtg ctggtggaca acgtggactt cgccaccatc atcgagcgca 8940 gcaagaagtt catcaacggc gccagcacca tggaggaccg ccccagcacc aagaacttct 9000 tcgagctgaa ccgcggcgcc atcaagtgcg agggcctgga cgtggaggac ctgctgagct 9060 actacgtggt gtacgtgttc agcaagaggt aattaattaa ccgcccctct ccctcccccc 9120 cccctaacgt tactggccga agccgcttgg aataaggccg gtgtgcgttt gtctatatgt 9180 tattttccac catattgccg tcttttggca atgtgagggc ccggaaacct ggccctgtct 9240 tcttgacgag cattcctagg ggtctttccc ctctcgccaa aggaatgcaa ggtctgttga 9300 atgtcgtgaa ggaagcagtt cctctggaag cttcttgaag acaaacaacg tctgtagcga 9360 ccctttgcag gcagcggaac cccccacc tg gcgacaggtg cctctgcggc caaaagccac 9420 gtgtataaga tacacctgca aaggcggcac aaccccagtg ccacgttgtg agttggatag 9480 ttgtggaaag agtcaaatgg ctctcctcaa gcgtattcaa caaggggctg aaggatgccc 9540 agaaggtacc ccattgtatg ggatctgatc tggggcctcg gtgcacatgc tttacatgtg 9600 tttagtcgag gttaaaaaac gtctaggccc cccgaaccac ggggacgtgg ttttcctttg 9660 aaaaacacga tgatgccacc atggaattcg atagcactga gaacgtcatc aagcccttca 9720 tgcgcttcaa ggtgcacatg gagggctccg tgaacggcca cgagttcgag atcgagggcg 9780 agggcgaggg caagccctac gagggcaccc agaccgccaa gctgcaggtg accaagggcg 9840 gccccctgcc cttcgcctgg gacatcctgt ccccccagtt ccagtacggc tccaaggtgt 9900 acgtgaagca ccccgccgac atccccgact acaagaagct gtccttcccc gagggcttca 9960 agtgggagcg cgtgatgaac ttcgaggacg gcggcgtggt gaccgtgacc caggactcct 10020 ccctgcagga cggcaccttc atctaccacg tgaagttcat cggcgtgaac ttcccctccg 10080 acggccccgt aatgcagaag aagactctgg gctgggagcc ctccaccgag cgcctgtacc 10140 cccgcgacgg cgtgctgaag ggcgagatcc acaaggcgct gaagctgaag ggcggcggcc 10200 actacctggt ggagttcaag tcaatctaca tggccaagaa gcccgtgaag ctgcccggct 10260 actactacgt ggactccaag ctggacatca cctcccacaa cgaggactac accgtggtgg 10320 agcagtacga gcgcgccgag gcccgccacc acctgttcca ggaattcggc agcggcgcca 10380 ccaacttcag cctgctgaag caggccggcg acgtggagga gaaccccggc ccccccgccg 10440 ccaagcgcgt gaagctggac aacaccatca acatcgccaa gaacgacttc agcgacatcg 10500 agctggccgc catccccttc aacaccctgg ccgaccacta cggcgagcgc ctggcccgcg 10560 agcagctggc cctggagcac gagagctacg agatgggcga ggcccgcttc cgcaagatgt 10620 tcgagcgcca gctgaaggcc ggcgaggtgg ccgacaacgc cgccgccaag cccctgataa 10680 ccaccctgct gcccaagatg atcgcccgca tcaacgactg gttcgaggag gtgaaggcca 10740 agcgcggcaa gcgccccacc gccttccagt tcctgcagga gatcaagccc gaggccgtgg 10800 cctacatcac catcaagacc accctggcct gcctgaccag cgccgacaac accaccgtgc 10860 aggccgtggc cagcgccatc ggccgcgcca tcgaggacga ggcccgcttc ggccgcatcc 10920 gcgacctgga ggccaagcac ttcaagaaga acgtggagga gcagctgaac aagcgcgtgg 10980 gccacgtgta caagaaggcc ttcatgcagg tggtggaggc cgacatgctg agcaagggcc 11040 tgctgggcgg cgaggcctgg ag cagctggc acaaggagga cagcatccac gtgggcgtgc 11100 gctgcatcga gatgctgatc gagagcaccg gcatggtgag cctgcaccgc cagaacgccg 11160 gcgtggtggg ccaggacagc gagaccatcg agctggcccc cgagtacgcc gaggccatcg 11220 ccacccgcgc cggcgccctg gccggcatca gccccatgtt ccagccctgc gtggtgcccc 11280 ccaagccctg gaccggcatc accggcggcg gctactgggc caacggccgc cgccccctgg 11340 ccctggtgcg cacccacagc aagaaggccc tgatgcgcta cgaggacgtg tacatgcccg 11400 aggtgtacaa ggccatcaac atcgcccaga acaccgcctg gaagatcaac aagaaggtgc 11460 tggccgtggc caacgtgata accaagtgga agcactgccc cgtggaggac atccccgcca 11520 tcgagcgcga ggagctgccc atgaagcccg aggacatcga catgaacccc gaggccctga 11580 ccgcctggaa gcgcgccgcc gccgccgtgt accgcaagga caaggcccgc aagagccgcc 11640 gcatcagcct ggagttcatg ctggagcagg ccaacaagtt cgccaaccac aaggccatct 11700 ggttccccta caacatggac tggcgcggca gggtgtacgc cgtgagcatg ttcaaccccc 11760 agggcaacga catgaccaag ggcctgctga ccctggccaa gggcaagccc atcggcaagg 11820 agggctacta ctggctgaag atccacggcg ccaactgcgc cggcgtggac aaggtgccct 11880 tccccgagcg catca agttc atcgaggaga accacgagaa catcatggcc tgcgccaaga 11940 gccccctgga gaacacctgg tgggccgagc aggacagccc cttctgcttc ctggccttct 12000 gcttcgagta cgccggcgtg cagcaccacg gcctgagcta caactgcagc ctgcccctgg 12060 ccttcgacgg cagctgcagc ggcatccagc acttcagcgc catgctgcgc gacgaggtgg 12120 gcggcagggc cgtgaacctg ctgcccagcg agaccgtgca ggacatctac ggcatcgtgg 12180 ccaagaaggt gaacgagatc ctgcaggccg acgccatcaa cggcaccgac aacgaggtgg 12240 tgaccgtgac cgacgagaac accggcgaga tcagcgagaa ggtgaagctg ggcaccaagg 12300 ccctggccgg ccagtggctg gcctacggcg tgacccgcag cgtgaccaag cgcagcgtga 12360 tgaccctggc ctacggcagc aaggagttcg gcttccgcca gcaggtgctg gaggacacca 12420 tccagcccgc catcgacagc ggcaagggcc tgatgttcac ccagcccaac caggccgccg 12480 gctacatggc caagctgatc tgggagagcg tgagcgtgac cgtggtggcc gccgtggagg 12540 ccatgaactg gctgaagagc gccgccaagc tgctggccgc cgaggtgaag gacaagaaga 12600 ccggcgagat cctgcgcaag aggtgcgccg tgcactgggt gacccccgac ggcttccccg 12660 tgtggcagga gtacaagaag cccatccaga cccgcctgaa cctgatgttc ctgggccagt 12720 tccgcctg ca gcccaccatc aacaccaaca aggacagcga gatcgacgcc cacaagcagg 12780 agagcggcat cgcccccaac ttcgtgcaca gccaggacgg cagccacctg cgcaagaccg 12840 tggtgtgggc ccacgagaag tacggcatcg agagcttcgc cctgatccac gacagcttcg 12900 gcaccatccc cgccgacgcc gccaacctgt tcaaggccgt gcgcgagacc atggtggaca 12960 cctacgagag ctgcgacgtg ctggccgact tctacgacca gttcgccgac cagctgcacg 13020 agagccagct ggacaagatg cccgccctgc ccgccaaggg caacctgaac ctgcgcgaca 13080 tcctggagag cgacttcgcc ttcgcctaaa gatctgttta aacgctagcg cctcgactgt 13140 gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct tgaccctgga 13200 aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc attgtctgag 13260 taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg aggattggga 13320 agacaatagc aggcatgctg gggaagcgct aagcttggcg taatcatggt catagctgtt 13380 tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa 13440 gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact 13500 gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc 13560 ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg 13620 ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc 13680 cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag 13740 gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 13800 tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca 13860 ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 13920 atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcaatgct cacgctgtag 13980 gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt 14040 tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca 14100 cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg 14160 cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt 14220 tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc 14280 cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg 14340 cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagt g 14400 gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 14460 gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg 14520 gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg 14580 ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc 14640 atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc 14700 agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc 14760 ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag 14820 tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat 14880 ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg 14940 caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt 15000 gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag 15060 atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg 15120 accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt 15180 aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga t cttaccgct 15240 gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac 15300 tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat 15360 aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat 15420 ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca 15480 aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag aaaccattat 15540 tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc 15590 <210> 8 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> F2A <400> 8 Val Lys Gln Thr Leu Asn Phe Asp Leu Leu Lys Leu Ala Gly Asp Val 1 5 10 15 Glu Ser Asn Pro Gly Pro 20 <210 > 9 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> E2A <400> 9 Gln Cys Thr Asn Tyr Ala Leu Leu Lys Leu Ala Gly Asp Val Glu Ser 1 5 10 15 Asn Pro Gly Pro 20 <210> 10 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> P2A <400> 10 Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn 1 5 10 15 Pro Gly Pro <210> 11 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> T2A <400> 11 Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro 1 5 10 15 Gly Pro

Claims (9)

tetracycline response element (TRE) promoter; D12L (mRNA-capping enzyme 33 kDa subunit) coding sequence derived from vaccinia virus; 2A peptide coding sequence; D1R (mRNA-capping enzyme 97 kDa subunit) coding sequence derived from vaccinia virus; an internal ribosome entry site (IRES) sequence; 2A peptide coding sequence; nuclear localization signal (NLS) peptide coding sequence; T7 RNA polymerase coding sequence; and a polyadenylation signal sequence; delete delete delete The recombinant vector according to claim 1, wherein the recombinant vector further comprises a reverse tetracycline-controlled transcativator (rtTA) expression cassette operably linked downstream of a cytomegalovirus (CMV) promoter. A host cell transformed with the recombinant vector of claim 1 or 5. (a) transforming a host cell with the recombinant vector of claim 1 or 5;
(b) inducing expression of mRNA capping enzyme and T7 RNA polymerase by treating the transformed host cell with tetracycline or a derivative thereof; and
(c) inducing expression of a useful protein by introducing a recombinant vector containing a useful protein coding sequence into a transformed host cell in which the expression of the mRNA capping enzyme and T7 RNA polymerase is induced; production method. The production method according to claim 7, wherein the useful protein is at least one selected from the group consisting of antigens, antibodies, cell receptors, enzymes, structural proteins, serum and cell proteins. 9. The method according to claim 8, wherein the antigen is a virus.

Images