CN113355325B

CN113355325B - Preparation method and application of humanized ACE2 gene modified mouse embryonic stem cell model

Info

Publication number: CN113355325B
Application number: CN202110245653.6A
Authority: CN
Inventors: 陈捷凯; 孙骄杨; 吴光明; 吴凯昕; 匡俊企; 全雄志; 郭琳
Original assignee: Guangzhou Institute of Biomedicine and Health of CAS
Current assignee: Guangzhou Institute of Biomedicine and Health of CAS
Priority date: 2020-03-06
Filing date: 2021-03-05
Publication date: 2023-07-14
Anticipated expiration: 2041-03-05
Also published as: CN113355325A

Abstract

The invention relates to the field of biological medicine, in particular to a preparation method and application of a humanized ACE2 gene modified mouse embryonic stem cell model. The invention provides a sgRNA fragment sequence. The targeting vector containing the sgRNA fragment sequence can specifically target ACE2 genes and can be used for preparing humanized ACE2 gene modified mouse embryonic stem cell models. The sgRNA fragment sequence of the invention has better targeting specificity and efficiency of cutting target genes.

Description

Preparation method and application of humanized ACE2 gene modified mouse embryonic stem cell model

Technical Field

The invention relates to the field of biological medicine, in particular to a preparation method and application of a humanized ACE2 gene modified mouse embryonic stem cell model.

Background

Although the drug screening is carried out by infecting 2019-nCoV on a Vero E6 cells and other cell models at present, the singleness of the cell model is far from being superior to an animal model.

The experimental animal disease model is an indispensable research tool for researching the etiology and pathogenesis of human disease occurrence, developing control technology and therapeutic drugs. Common laboratory animals include mice, rats, guinea pigs, ground rats (hamsters), rabbits, dogs, monkeys, pigs, fish, etc. However, there are still a few differences in the gene and protein sequences of humans and animals, and many human proteins cannot bind to homologous proteins of animals to produce biological activity, resulting in that the results of many clinical trials are also inconsistent with the results of animal experiments.

With the continuous development and maturation of genetic engineering technology, human cells or genes replace or replace endogenous similar cells or genes of animals to build a biological system or disease model more similar to human beings and a humanized experimental animal model (humanized animal model 1), which provides an important tool for new clinical treatment methods or means. Wherein, the gene humanized animal model is that using genetic manipulation technique to replace the same kind of animal genes with human normal or mutant genes, and can build a model of the human normal or mutant, the system's celebrity large-source. Because the large-sized animal not only has important application value, for example, the cell humanized mouse CN 107815468 A2/28 model can be improved and promoted by gene humanization, but also can express or partially express the protein containing human functions in the animal body due to the existence of human gene fragments, thereby greatly reducing the clinical experimental difference between human and animals and providing possibility for drug screening at animal level.

2019-nCoV, like SARS coronavirus, has Angiotensin converting enzyme 2 (Angiotenin-converting enzyme, ACE 2) as a key target for human infection, wherein 2019-nCoV can infect a variety of mammals such as monkeys, pigs, rabbits, ferrets, gorillas, etc. in addition to humans. Monkey, pig, rabbit, etc. are used as animal models to infect 2019-nCoV for drug screening, and their growth cycle is longer and their body size is larger and difficult to operate in large quantities, whereas mouse models which are relatively easy to operate in large quantities are not susceptible to 2019-nCoV.

Disclosure of Invention

Since there is a certain difference in gene sequence between human-derived ACE2 and murine-derived ACE2, there are literature reports: after virus infection, human source ACE2 has stronger sensibility to SARS-CoV than murine source ACE2, and the pathological symptoms are more obvious. Better animal models are urgently needed for the current clinical research.

The hACE2 transgenic mice have been shown to infect 2019-nCoV and exhibit the characteristic pathogenic features of lung tissue (https:// www.biorxiv.org/content/10.1101/2020.02.07.939389v3#disqus_thread). However, the hACE2 transgenic mice are a systemic overexpression hACE2 mouse model and cannot simulate the space-time tissue expression characteristics of ACE2, and the humanized ACE2 mouse model is a mice model for expressing hACE2 in site specificity of a primary mouse, can simulate the expression characteristics of the primary mACE2, has tissue specificity, and more strictly simulates the pathogenesis of human infection 2019-nCoV.

The application of the present disclosure in drug screening, disease research and the like of 2019-nCoV will be performed by preparing a large scale of 2019-nCoV susceptible mouse humanized Ace2 animal models by a method of expressing humanized Ace2 at the mouse Ace2 site.

It is an object of the present invention to provide a specific nucleic acid fragment sequence.

It is another object of the present invention to provide a sgRNA sequence specifically targeting the ACE2 gene.

It is another object of the present invention to provide a targeting vector specifically targeting the ACE2 gene.

Another object of the present invention is to provide a humanized cell line of ACE2 gene.

The invention further aims at providing a construction method of the ACE2 gene humanized cell strain.

Another object of the present invention is to provide a method for constructing a genetically humanized animal.

It is yet another object of the present invention to provide a humanized ACE2 genetically engineered mouse embryonic stem cell model.

In one aspect, the invention provides a nucleic acid fragment sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 2. The targeting specificity of the nucleic acid fragment sequence and the efficiency of cutting the target gene are good.

In some embodiments, the synthetic sequence is set forth in SEQ ID NO:1 are respectively shown in SEQ ID NO. 6 and SEQ ID NO. 7. In some embodiments, the synthetic sequence is set forth in SEQ ID NO:2 are respectively shown in SEQ ID NO. 4 and SEQ ID NO. 5.

In some embodiments, the nucleic acid is sgRNA.

In some embodiments, the sgRNA fragment sequence targets a gene that is an animal ACE2 gene for site-directed cleavage of the ACE2 gene.

In some embodiments, the sgRNA fragment sequences are used to construct a humanized animal model.

In some embodiments, the cleavage point of the sgRNA fragment sequence is located on exon 1 of the animal ACE2 gene.

In some embodiments, the cut point target is within 140bp of the base after the 5' utr of the animal ACE2 gene.

In some embodiments, the animal is a mammal.

In some embodiments, the mammal is a rodent.

In some embodiments, the rodent is a mouse.

In another aspect, the invention provides a targeting vector comprising a 5 'homology arm, a fragment of a human ACE2 gene and a 3' homology arm; the targeting vector targets an animal ACE2 gene, the animal ACE2 gene comprising a cleavage site corresponding to the sgRNA fragment sequence of

claim

1 or 2. The 5' homology arm is a 5' homology arm homologous to a 5' target sequence at the genomic locus of interest.

In some embodiments, the targeting vector is used to initiate expression of a human gene of interest using an animal gene promoter after insertion of the CDS sequence of the human ACE2 gene into the promoter and 5' utr region sequences of the animal gene.

In some embodiments, the targeting vector further comprises a 3 'homology arm that is homologous to a 3' target sequence at the genomic locus of interest.

In some embodiments, the 5 'homology arm sequence is shown in SEQ ID NO. 13 and the 3' homology arm sequence is shown in SEQ ID NO. 14.

In some embodiments, the CDS sequence of the ACE2 gene is shown in SEQ ID NO. 10.

In some embodiments, the targeting vector further comprises an SV40 polyA sequence as shown in SEQ ID NO. 12, said SV40 polyA sequence being located after said CDS sequence.

In some embodiments, the targeting vector further comprises a screening marker PGK-Puro.

In some embodiments, the animal is a mammal.

In some embodiments, the animal is a mouse.

In some embodiments, the targeting vector further comprises a pX330 vector.

In another aspect, the invention provides a DNA molecule encoding the sgRNA fragment sequence.

In another aspect, the invention provides a cell comprising said sgRNA fragment sequence or said targeting vector or said DNA molecule.

In another aspect, the invention provides the use of the sgRNA fragment sequence in the preparation of a genetically humanized cell line or a humanized animal model.

In some embodiments, the gene is ACE2.

In some embodiments, the animal is a mammal.

In some embodiments, the animal is a rodent.

In some embodiments, the animal is a mouse.

In another aspect, the invention provides a method of constructing a humanized animal cell line using the sgRNA fragment sequence.

In some embodiments, the method comprises introducing a human gene of interest into an animal cell such that the gene of interest expresses the CDS of the human full-length gene of interest in situ within the animal cell.

In some embodiments, the gene of interest is ACE2.

In some embodiments, the animal is a mammal.

In some embodiments, the animal is a rodent.

In some embodiments, the animal is a mouse.

In some embodiments, the cell is an embryonic stem cell.

In some embodiments, the methods use gene editing techniques to construct a model of a humanized animal cell.

In some embodiments, the gene editing techniques include embryonic stem cell-based DNA homologous recombination techniques, CRISPR/Cas9 techniques.

In some embodiments, the gene editing technique is CRISPR/Cas 9-based gene editing technique for construction of ACE2 humanized animals.

In some embodiments, the construction method comprises the steps of: (1) constructing the targeting vector of claim 3; (2) Introducing the constructed targeting vector and the sgRNA-linked vector into embryonic stem cells of animal origin; (3) Culturing the embryonic stem cells in the step (2) into clones to obtain the culture medium.

In some embodiments, the animal is a mammal.

In some embodiments, the mammal is a rodent.

In some embodiments, the rodent is a mouse.

On the other hand, the invention provides an ACE2 gene humanized cell strain prepared by the method.

In some embodiments, the cell line is a humanized mouse embryonic stem cell, which can express human full-length ACE2 protein after specific differentiation or preparation into a mouse model, while endogenous ACE2 protein expression is reduced or eliminated.

In another aspect, the invention provides a method of constructing a genetically humanized animal model comprising injecting said animal cells into an animal.

In some embodiments, the method of constructing the genetically humanized animal model comprises forming the animal cells into an animal individual by tetraploid compensation or blastocyst injection.

In another aspect, the invention provides a tissue, body fluid, cell, or disrupted or extracted product thereof, of a humanized mouse or offspring thereof, the humanized mouse being obtained by a method of constructing a genetically humanized animal model.

The humanized ACE2 gene modified mice are successfully obtained by the method.

In some embodiments, the humanized ACE2 genetically engineered mice express human ACE2 at the RNA level and have tissue specificity.

In some embodiments, the humanized ACE2 genetically engineered mice express human ACE2 at the protein level and have tissue specificity.

In some embodiments, the present studies have shown that humanized ACE2 genetically engineered mice obtained using the methods of the present invention are susceptible to SARS-CoV-2. Thus, mice susceptible to 2019-nCoV are successfully obtained, and a good animal model can be provided for drug screening or other researches of 2019-nCoV. Has good practical significance.

In a further aspect, the invention provides the use of a humanized animal model or a progeny thereof derived from said construction method for the manufacture of human antibodies, or as a model system for pharmacological, immunological, microbiological and medical studies, or in the production and use of animal experimental disease models for etiology studies and/or for the development of new diagnostic and/or therapeutic strategies, or in screening, validation, evaluation or research of ACE2 gene function, ACE2 antibodies, drugs against ACE2 targets, pharmacodynamic studies.

Drawings

FIG. 1 shows a pX330 plasmid map.

FIG. 2 is a graph showing the results of the sequencing of the construction of pX330-sgRNA 1.

FIG. 3 is a graph showing the results of the sequencing of the construction of pX330-sgRNA 2.

FIG. 4 shows the result of verification of the cleavage efficiency of pX330-sgRNA 1-3.

FIG. 5 is a graph showing the results of the sequencing of the construction of pX330-sgRNA 3.

Fig. 6 is a schematic diagram of a humanized ACE2 targeting strategy.

Fig. 7 is information on sequencing results of humanized ACE2 targeting vectors.

FIG. 8 is a PCR identification chart of three fragment ligation in comparative example 1.

FIG. 9 is a graph showing the results of PCR identification of the genotype of humanized ACE2 mouse embryonic stem cells.

FIG. 10 is a graph showing the results of PCR identification of the genotype of humanized ACE2 mouse embryonic stem cells after deletion of PGK-Puro.

Fig. 11 is a schematic diagram of a humanized ACE2 gene.

FIG. 12 is a humanized ACE2 gene-modified mouse obtained by the present invention.

Figure 13 shows that humanized ACE2 genetically modified mice express human ACE2 at the RNA level and have tissue specificity.

The tissue immunofluorescence results of fig. 14 show that human ACE2 is specifically expressed on proteins in humanized ACE2 genetically engineered mouse tissues.

FIG. 15 shows that humanized ACE2 genetically engineered mice of the present invention are susceptible to SARS-CoV-2.

Detailed Description

The technical solution of the present invention is further illustrated by the following specific examples, which do not represent limitations on the scope of the present invention. Some insubstantial modifications and adaptations of the invention based on the inventive concept by others remain within the scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same definition as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention, the preferred methods and materials being described in the detailed description.

As used herein, "a" and "an" refer to the grammatical indefinite articles "a," "an," or "a plurality," "a plurality" (i.e., "at least one," "at least one"). For example, "an element" refers to one or more elements.

"CDS" is an abbreviation for Coding sequence and "Coding sequence" refers to any nucleotide sequence used to encode a polypeptide product of a gene. Conversely, the term "non-coding sequence" refers to any nucleotide sequence that does not encode a polypeptide product of a gene.

The term "fragment" will be understood to refer to a nucleotide sequence that is shorter in length than the reference nucleic acid and that comprises in common part the same nucleotide sequence as the reference nucleic acid. Such nucleic acid fragments according to the invention may, if appropriate, be comprised in a larger polynucleotide of which the fragment is a constituent. Such fragments include, or alternatively consist of, oligonucleotides having a length within the range of at least 6, 8, 9, 10, 12, 15, 18, 20, 21, 22, 23, 24, 25, 30, 39, 40, 42, 45, 48, 50, 51, 54, 57, 60, 63, 66, 70, 75, 78, 80, 90, 100, 105, 120, 135, 150, 200, 300, 500, 720, 900, 1000, or 1500 consecutive nucleotides of a nucleic acid of the invention.

In this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements; i.e. open definition.

"corresponding" means that (a) a polynucleotide has a nucleotide sequence that is substantially identical or complementary to all or part of a reference nucleotide sequence, or a polynucleotide encodes an amino acid sequence that is identical to an amino acid sequence in a peptide or protein; or (b) a peptide or polypeptide having an amino acid sequence that is substantially identical to the amino acid sequence in the reference peptide or protein.

The term "downstream" refers to a nucleotide sequence located 3' to a reference nucleotide sequence. In particular, the downstream nucleotide sequence generally relates to a sequence following the transcription initiation point. For example, the translation initiation codon of a gene is located downstream of the transcription initiation site.

The term "upstream" refers to a nucleotide sequence located 5' to a reference nucleotide sequence. In particular, the upstream nucleotide generally refers to a sequence located 5' to the coding sequence or transcription initiation point. For example, most promoters are located upstream of the transcription initiation site.

"promoter" refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. Generally, the coding sequence is located 3' to the promoter sequence. Promoters may be derived entirely from a natural gene, or consist of different elements derived from different promoters found in nature, or even include synthetic DNA fragments. It will be appreciated by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters that cause a gene to be expressed in most cell types most of the time are commonly referred to as "constitutive promoters". Promoters that cause a gene to be expressed in a particular cell type are commonly referred to as "cell-specific promoters" or "tissue-specific promoters. Promoters that cause a gene to be expressed at a particular stage of development or cell differentiation are commonly referred to as "development-specific promoters" or "cell differentiation-specific promoters. Promoters that are induced and result in expression of a gene after exposing the cell to agents, biomolecules, chemicals, ligands, light or the like that induce the promoter, or treating the cell with such agents, are commonly referred to as "inducible promoters" or "regulated promoters. It should also be appreciated that DNA fragments of different lengths may have the same promoter activity, since in most cases the exact boundaries of the regulatory sequences are not yet fully defined.

The term "5'UTR" or "5' non-coding sequence" or "5 'untranslated region (UTR)" refers to a DNA sequence that is located upstream (5') of a coding sequence.

The terms "restriction endonuclease" and "restriction enzyme" refer to an enzyme that binds to and cleaves a specific nucleotide sequence within double-stranded DNA.

The term "vector" means a nucleic acid molecule that is capable of transferring a nucleic acid molecule to which it has been linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which other DNA segments may be ligated. Another class of vectors are viral vectors, wherein other DNA segments may be ligated into the viral genome. Some vectors are capable of self-replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication as well as episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are capable of integrating into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. In addition, certain vectors are capable of directing expression of genes to which they are operatively linked.

Some vectors the present invention refers to "recombinant expression vectors" (or simply "expression vectors") and refers to vectors, plasmids or vectors designed to enable expression of an inserted nucleic acid sequence after transformation into a host. In general, expression vectors used in recombinant DNA technology are often in the form of plasmids. The "plasmid" and "vector" are used interchangeably herein, as the plasmid is the most commonly used form of vector. However, the present invention is intended to include other forms of such expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses, and adeno-associated viruses), which serve equivalent functions.

The term "plasmid" refers to extrachromosomal elements that often carry genes that are not part of the central metabolism of the cell, and are often in the form of circular double stranded DNA molecules. Such elements may be autonomously replicating sequences, genomic integrating sequences, phage or nucleotide sequences, linear, circular or supercoiled, single-or double-stranded DNA or RNA from any source, wherein a number of nucleotide sequences have been joined or recombined into a unique structure capable of introducing into a cell a promoter fragment and DNA sequence for a selected gene product, as well as appropriate 3' -terminal untranslated sequences.

A "targeting vector" or "targeting vector" is a DNA construct containing a sequence "homologous" to an endogenous chromosomal nucleic acid sequence, adjacent to the desired genetic modification. The flanking homology sequences (referred to as "homology arms") direct the targeting vector to locate at a particular chromosomal location in the genome by virtue of the homology that exists between the homology arms and the corresponding endogenous sequences, and introduce the desired genetic modification by a process known as "homologous recombination". "targeting vectors" and "targeting vectors" may sometimes be universal. Targeting vectors are employed to introduce an insert nucleic acid into a target locus of a rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse or hamster nucleic acid. The targeting vector comprises the insert nucleic acid and further comprises a 5 'homology arm and a 3' homology arm flanking the insert nucleic acid. The homology arm flanking the insert nucleic acid corresponds to a region within a target locus of a rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse or hamster nucleic acid. For ease of reference, the corresponding homologous genomic region within the target genomic locus is referred to herein as the "target site". For example, the targeting vector can comprise a first insert nucleic acid flanked by a first homology arm and a second homology arm that are complementary to the first target site and the second target site. Thus, the targeting vector thereby facilitates integration of the insert nucleic acid into a target locus of a rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse or hamster nucleic acid via homologous recombination events occurring between the homology arms and complementary target sites within the genome of the cell.

In one embodiment, the target locus of the rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse, or hamster nucleic acid comprises a first nucleic acid sequence complementary to a 5 'homology arm and a second nucleic acid sequence complementary to a 3' homology arm.

The vector may be introduced into the desired host cell by methods known in the art, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosomal fusion), use of a gene gun or DNA vector transporter (see, e.g., wu et al, 1992, J.biol. Chem.267:963-967; wu and Wu,1988, J.biol. Chem.263:14621-14624; and Canadian patent application 2,012,311 filed on 1990, month 3, 15).

The term "transfection" refers to the uptake of exogenous or heterologous RNA or DNA by a cell. When exogenous or heterologous RNA or DNA has been introduced into a cell, the cell is "transfected" with such RNA or DNA. When transfected RNA or DNA affects a phenotypic change, the cell is "transformed" by exogenous or heterologous RNA or DNA. The transforming RNA or DNA may be integrated (covalently linked) into chromosomal DNA that forms the genome of the cell.

The term "homology" or "homologous" refers to two sequences, such as nucleotide or amino acid sequences, that are optimally aligned and compared to have at least about 75% nucleotides or amino acids, at least about 80% nucleotides or amino acids, at least about 90-95% nucleotides or amino acids, e.g., more than 97% nucleotides or amino acids, identical. Those skilled in the art will appreciate that for optimal gene targeting, the targeting construct should contain arms homologous to the endogenous DNA sequence (i.e. "homology arms"); thus, homologous recombination can occur between the targeting construct and the targeted endogenous sequence.

As used herein, a homology arm and a target site (i.e., homologous genomic region) are complementary to each other when the two regions share a sufficient level of sequence identity with each other, thereby acting as a substrate for a homologous recombination reaction. "homology" refers to the identity of a DNA sequence to a corresponding or "complementary" sequence or to a consensus sequence. The sequence identity between a given target site and the corresponding homology arm found on the targeting vector can be any degree of sequence identity that allows homologous recombination to occur. For example, the homology arm (or fragment thereof) of the targeting vector may share at least 51%, 53%, 57%, 60%, 65%, 70%, 75%, 80%, 83%, 85%, 87%, 89%, 91%, 93%, 95%, 97%, 98%, 99% or 100% sequence identity with the target site (or fragment thereof) so that the sequence undergoes homologous recombination. Furthermore, the complementary region of homology between the homology arm and the complementary target site may have any length sufficient to promote homologous recombination at the recognition site of cleavage. The homology arms thus have sufficient homology to the corresponding target sites within the genome of the cell for homologous recombination. For ease of reference, homology arms are referred to herein as 5 'homology arms and 3' homology arms. The term relates to the relative position of the homology arm to the inserted nucleic acid in the targeting vector.

In some embodiments, the homology arm of the targeting vector can be of any length sufficient to promote homologous recombination events with the corresponding target site, including, for example, at least 5-10kb, 5-15kb, 10-20kb, 20-30kb, 30-40kb, 40-50kb, 50-60kb, 60-70kb, 70-80kb, 80-90kb, 90-100kb, 100-110kb, 110-120kb, 120-130kb, 130-140kb, 140-150kb, 150-160kb, 160-170kb, 170-180kb, 180-190kb, 190-200kb long or longer. As outlined in further detail below, targeting vectors can employ targeting arms of greater length. In one particular embodiment the sum of the 5 'homology arm and the 3' homology arm is at least 10kb or the sum of the 5 'homology arm and the 3' homology arm is at least about 16kb to about 100kb or about 30kb to about 100kb, in other embodiments the sum of the 5 'homology arm and the 3' homology arm of the ACE2 has a size of about 10kb to about 150kb, about 10kb to about 100kb, about 10kb to about 75kb, about 20kb to about 150kb, about 20kb to about 100kb, about 20kb to about 75kb, about 30kb to about 150kb, about 30kb to about 100kb, about 30kb to about 75kb, about 40kb to about 150kb, about 40kb to about 100kb, about 40kb to about 75kb, about 50kb to about 150kb, about 50kb to about 75kb, about 10kb to about 30kb, about 20kb to about 40kb, about 40kb to about 60kb, about 60kb to about 80kb, about 80kb to about 120kb, about 100kb to about 120 kb.

Certain embodiments herein relate to a humanized gene editing mammal whose genome comprises a polyribonucleic acid encoding a human full-length ACE2 protein. For example, the polyribonucleic acid is operably linked to a promoter polyribonucleic acid. In some embodiments, the humanized gene editing mammal does not express all or part of a polyribonucleic acid encoding an endogenous ACE2 protein of the humanized gene editing mammal, and the polyribonucleic acid encoding a human ACE2 protein comprises a modification of a human ACE2 protein gene.

In some embodiments, the cell is a pluripotent cell, a non-pluripotent cell, a mammalian cell, a human cell, a non-human mammalian cell, a rodent cell, a mouse cell, a hamster cell, a non-human pluripotent cell, a rodent pluripotent cell, or a fibroblast or a lung cell.

In some of the above methods, the cell is a primary cell or an immortalized cell. In some of the above methods, the rodent pluripotent cell is a mouse or rat Embryonic Stem (ES) cell.

In some of the above methods, the animal cell or the human cell is a primary cell or an immortalized cell.

In some of the above methods, the animal cell or the human cell is a pluripotent cell. In some of the above methods, the animal pluripotent cells are mouse Embryonic Stem (ES) cells. In some of the above methods, the human pluripotent cells are human Embryonic Stem (ES) cells, human adult stem cells, development-restricted human progenitor cells, or human Induced Pluripotent Stem (iPS) cells.

In some embodiments, certain embodiments herein provide cells for humanized gene editing, particularly also isolated human and non-human totipotent or pluripotent stem cells, particularly mouse embryonic stem cells, capable of maintaining multipotency following one or more in vitro sequential genetic modifications and capable of delivering the targeted genetic modifications to offspring via germline.

The term "embryonic stem cells" or "ES cells" as used herein includes embryonic derived totipotent or pluripotent cells capable of promoting the development of any tissue of an embryo upon introduction into the embryo. The term "pluripotent cell" as used herein includes undifferentiated cells having the ability to develop into more than one type of differentiated cell. The term "non-pluripotent cells" includes cells that are not pluripotent cells.

In some of the above methods, the targeted gene editing simultaneously comprises deleting an endogenous nucleic acid sequence at the genomic locus of interest or inserting the nucleic acid at the genomic locus of interest.

In some embodiments, the genetic modification or genetic editing comprises two or more modifications independently performed on a cell (e.g., a eukaryotic cell, a non-rat eukaryotic cell, a mammalian cell, a class cell, a non-human mammalian cell, a multipotent cell, a non-human multipotent cell, a human ES cell, a human adult stem cell, a development-restricted human progenitor cell, a human iPS cell, a human cell, a rodent cell, a non-rat rodent cell, a rat cell, a mouse cell, a hamster cell, a fibroblast cell, or a Chinese Hamster Ovary (CHO) cell). The first modification may be achieved by electroporation or any other method known in the art. Subsequently, the same cell genome is subjected to a second modification using a suitable second nucleic acid construct. The third modification may be achieved by second electroporation or any other method known in the art. In various embodiments, subsequent to the first and second genetic modifications of the same cell, a third genetic modification, a fourth genetic modification, a fifth genetic modification, a sixth genetic modification, etc., may be accomplished (sequentially) using, for example, sequential electroporation or any other suitable method known in the art.

In some embodiments, the invention is a targeting vector homologous recombination method for editing a gene, inserting an exogenous nucleic acid into an endogenous genome.

In some embodiments, the insertion nucleic acid comprises insertion of a homologous or orthologous human nucleic acid sequence or replacement thereof with a eukaryotic, non-rat eukaryotic, mammalian, human or non-human mammalian nucleic acid sequence.

In some embodiments, the given inserted polynucleotide may be from any organism, including, for example, rodents, non-rat rodents, rats, mice, hamsters, mammals, non-human mammals, eukaryotes, non-rat eukaryotes, humans, agricultural animals, or domestic animals.

In particular embodiments, the insert nucleic acid may comprise a nucleic acid from a rat, which may comprise a fragment of genomic DNA, a CDNA, a regulatory region, or any portion or combination thereof. In other embodiments, the insert nucleic acid may include nucleic acid from a eukaryotic organism, a non-rat eukaryotic organism, a mammal, a human, a non-human mammal, a rodent, a non-rat rodent, a human, a rat, a mouse, a hamster, a rabbit, a pig, a cow, a deer, a sheep, a goat, a chicken, a cat, a dog, a white melt, a primate (e.g., marmoset, rhesus), a domestic or agricultural mammal, or any other organism of interest. As outlined in more detail herein, the insert nucleic acids employed in the various methods and compositions can cause "humanization" of the target locus of interest.

In one embodiment, the genetic modification is the addition of a nucleic acid sequence. In one embodiment, the insert nucleic acid comprises a genetic modification in the coding sequence. In one embodiment, the genetic modification comprises a deletion mutation of the coding sequence. In one embodiment, the genetic modification comprises a fusion of two endogenous coding sequences. In one embodiment, the insertion nucleic acid comprises insertion of a homologous or orthologous human nucleic acid sequence or replacement thereof with a eukaryotic, non-rat eukaryotic, mammalian, human or non-human mammalian nucleic acid sequence. In one embodiment, the insertion nucleic acid comprises insertion of a homologous or orthologous human nucleic acid sequence into or replacement of a mouse DNA sequence with an endogenous mouse gene coding region comprising the corresponding mouse DNA sequence. In one embodiment, the insertion nucleic acid comprises insertion of a homologous or orthologous human nucleic acid sequence into or replacement of a mouse DNA sequence with an endogenous mouse gene coding region comprising the corresponding mouse DNA sequence. In one embodiment, the hACE2 sequence is inserted at the EXON1 CDS initiation ATG site next to mAce2 for the mouse Ace2 site using a targeting vector.

In one embodiment, the nucleic acid sequence of the targeting vector may comprise a polynucleotide that when integrated into the genome will produce a genetic modification of a region of the ACE2 locus of a mammal, human or non-human mammal, wherein the genetic modification at the ACE2 locus results in a decrease in ACE2 activity, an increase in ACE2 activity or a modulation of ACE2 activity. In one embodiment, the ACE2 gene is produced as a complete replacement.

In one embodiment, the insert nucleic acid may comprise regulatory elements including, for example, promoters, enhancers, or transcription.

In some embodiments, the corresponding replacement region for a given inserted polynucleotide and/or mammalian, human cell or non-human mammalian locus may be a coding region, an intron, an exon, an untranslated region, a regulatory region, a promoter or an enhancer, or any combination thereof.

Provided herein are methods that allow targeted integration of one or more polynucleotides of interest into a target locus, as outlined above, introduction of sequences, and the resulting gene editing cells. "introduced" presents a sequence into a cell (polypeptide or polynucleotide) in such a way that the sequence enters the interior of the cell.

Any cell from any organism can be used in the methods provided herein. In particular embodiments, the cell is from a eukaryotic organism, a non-rat eukaryotic organism, a mammal, a non-human mammal, a human, a rodent, a non-rat rodent, a rat, a mouse, or a hamster. In particular embodiments, the cell is a eukaryotic cell, a non-rat eukaryotic cell, a pluripotent cell, a non-human mammalian cell, a human pluripotent cell, a human ES cell, a human adult stem cell, a development-restricted human progenitor cell, a human induced pluripotent cell (iPS) cell, a mammalian cell, a human cell, a fibroblast, a rodent cell, a non-rat rodent cell, a rat cell, a mouse ES cell, a hamster cell, or a CHO cell.

In some embodiments, the cells employed in the methods have DNA constructs stably incorporated into their loci. "stably incorporated" or "stably introduced" refers to the introduction of a polynucleotide into a cell, such that the nucleotide sequence is integrated into the genome of the cell and is capable of being inherited by its progeny.

In one embodiment, the introduction of one or more polynucleotides into the cell is mediated by electroporation, intracytoplasmic injection, viral infection, adenovirus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or via nucleofection.

In one embodiment, the expression construct is introduced with the introduced nucleic acid.

In one embodiment, introducing the one or more polynucleotides into the cell may be performed multiple times over a period of time. In one embodiment, introducing the one or more polynucleotides into the cell may be performed at least twice over a period of time, at least three times over a period of time, at least four times over a period of time, at least five times over a period of time, at least six times over a period of time, at least seven times over a period of time, at least eight times over a period of time, at least nine times over a period of time, at least ten times over a period of time, at least twelve times over a period of time, at least thirteen times over a period of time, at least ten times over a period of time, at least fifteen times over a period of time, at least sixteen times over a period of time, at least eighteen times over a period of time, at least nineteen times over a period of time, or at least twenty times over a period of time.

In one embodiment, the targeting vector (containing the introduction nucleic acid) is introduced into the cell simultaneously with the expression vector (containing the sgRNA).

In one embodiment, there is further provided a method for manufacturing a humanized non-human animal comprising: (a) Modifying the genome of a pluripotent cell with a targeting vector comprising an insert nucleic acid comprising a human nucleic acid sequence to form a donor cell; (b) introducing the donor cell into a host embryo; and (c) inoculating said host embryo in a surrogate mother, wherein said surrogate mother produces a progeny comprising said human nucleic acid sequence. In one embodiment, the donor cell is introduced into the host embryo in the blastocyst stage or in the pre-morula stage (i.e., 4-cell stage or 8-cell stage). In still further embodiments, the genetic modification is capable of being transmitted via the germline.

In a particular embodiment, a method for manufacturing a humanized mouse is provided, the method comprising: (a) Introducing a targeting vector containing an ACE2 gene fragment and an expression vector connected with sgRNA into a mouse embryo cell to form a gene edited donor cell; (b) introducing the donor cell into a mouse embryo; and (c) inoculating the mouse embryo in a surrogate mother, wherein the surrogate mother produces a progeny comprising the human ACE2 sequence.

EXAMPLE 1 construction of Ace2 Gene sgRNA1 and pX330-sgRNA plasmid

The sgRNA1 sequence that recognizes the target site is synthesized.

sgRNA1 sequence (SEQ ID NO: 1): 5'-tactgctcagtccctcaccgagg-3'

Subsequent annealing experiments were performed on the upstream and downstream annealing primers for synthesizing sgrnas by introducing the BbsI cleavage site into the sgRNA site. The sequence of the upstream and downstream single-stranded primers for the synthesis of sgRNA1 is as follows:

upstream: 5'-caccgtactgctcagtccctcaccg-3' (SEQ ID NO: 6)

Downstream: 5'-aaaccggtgagggactgagcagtac-3' (SEQ ID NO: 7)

pX330 plasmid source: pX330 vector map, see FIG. 1. The plasmid backbone source vast is the plasmid platform, cat No. P0123.

The above sgRNA annealing primers were annealed and then ligated to pX330 plasmid (the plasmid was linearized with BbsI) to obtain expression vector pX330-sgRNA1.

The specific ligation reaction system is shown in Table 1.

TABLE 1 ligation reaction System

sgRNA annealing products	1μL(0.5μM)
		pX330-sgRNA vector	1μL(20ng)
T4 DNALigase	1μL(5U)
		10×T4 DNALigase buffer	1μL
H ₂ O	Is added to 10 mu L

The reaction conditions are as follows: after connection at 16℃for more than 30min, transformation into 30. Mu.L TOP10 competent cells was performed, 200. Mu.L was plated on Amp-resistant plates, and after incubation at 37℃for at least 12 hours, 2 clones were selected and inoculated into LB medium (5 mL) containing Amp resistance, and shaking culture at 37℃and 250rpm was performed for at least 12 hours.

Randomly selected clones were sent to a sequencing company for sequencing verification, the sequencing results are shown in FIG. 2, and the correctly ligated expression vector pX330-sgRNA1 was selected for subsequent experiments.

EXAMPLE 2 construction of the Ace2 Gene sgRNA2 and pX330-sgRNA2 plasmid

The sgRNA2 sequence that recognizes the target site is synthesized.

sgRNA 2-sequence (SEQ ID NO: 2): 5'-cttggcattttcctcggtgaggg-3'

Subsequent annealing experiments were performed on the upstream and downstream annealing primers for synthesizing sgrnas by introducing the BbsI cleavage site into the sgRNA site. The sequence of the upstream and downstream single-stranded primers for the synthesis of sgRNA2 is as follows:

upstream: 5'-caccgcttggcattttcctcggtga-3' (SEQ ID NO: 4)

Downstream: 5'-aaactcaccgaggaaaatgccaagc-3' (SEQ ID NO: 5)

The above sgRNA annealing primers were annealed and then ligated to pX330 plasmid (the plasmid was linearized with BbsI) to obtain expression vector pX330-sgRNA2.

The specific ligation reaction system is shown in Table 2.

TABLE 2 ligation reaction System

sgRNA annealing products	1μL(0.5μM)
		pX330-sgRNA vector	1μL(20ng)
T4 DNA Ligase	1μL(5U)
		10×T4 DNA Ligase buffer	1μL
H ₂ O	Is added to 10 mu L

Randomly selected clones were sent to a sequencing company for sequencing verification, the sequencing results are shown in FIG. 3, and the correctly ligated expression vector pX330-sgRNA2 was selected for subsequent experiments.

EXAMPLE 3 identification of pX330-sgRNA cleavage efficiency

Mu.g of the pX330-sgRNA plasmids prepared in example 1 and example 2, respectively, were transfected into mouse embryonic stem cells using the liposome 3000 (Lipofectamine 3000, invitrogen, cat. L3000001) method, and specific transfection procedures were described with reference to Lipofectamine 3000 reagent procedures. Two days after transfection, the mouse embryonic stem cells were harvested and subjected to genome extraction using a cell genome extraction kit (Tiangen, DP 304-02). Subsequently, PCR was performed on the extracted genome by designing the upstream and downstream primers (5 arm-sgF: ggttttgatttggccataaaatgttagc (SEQ ID NO: 10)) and the downstream primer (3 arm-sgR: attcccaggtccagtttcacctaag (SEQ ID NO: 11)) on both sides of the genomic cleavage site (using Northena Phanta Max Super-FidelityDNAPolyase). Then pX330-sgRNA cleavage efficiency was verified using T7 endonuclease I (T7 EI) (Biolabs, M0302L), which recognizes and cleaves incompletely paired DNA.

T7 EI experiment specific operation steps:

The above-described PCR products obtained by extracting the genome from each of cells transfected with pX330-sgRNA1 and pX330-sgRNA2 and amplifying 5arm-sgF +3arm-sgR were recovered (Tiangen, DP 214-02) and 1. Mu.g were subjected to an annealing reaction as follows:

TABLE 3 Table 3

PCR products	1μg
		Buffer
2	2μL
		H ₂ O	Is added to 20 mu L
Reaction conditions	Naturally cooling after boiling for 10min in a water bath kettle

Then 1 mu L T7 endonuclease I is added into the annealed product to react for 30min at 37 ℃, and then the gel is directly removed for verification. The running results are shown in fig. 4. The cleavage bands of the

sgrnas

1 and 2 of examples 1 and 2 are strong (the sgRNA1 can be cleaved into two bands of about 376bp and 581bp, and the sgRNA2 can be cleaved into two bands of about 371bp and 586 bp), and the cleavage efficiency is high.

Since the cleavage efficiency is mainly shown by the figures, in order to show the effect of the protocol of examples 1, 2, the cleavage efficiency of another sgRNA (designated sgRNA 3) is also listed in fig. 4.

The sgRNRA3 sequence (SEQ ID NO: 3) listed: 5'-caagtgaactttgataagacagg-3'

The sequence of the upstream and downstream single-stranded primer for the synthesis of sgRNA3 is as follows:

upstream: 5'-caccgcaagtgaactttgataagac-3' (SEQ ID NO: 8)

Downstream: 5'-aaacgtcttatcaaagttcacttgc-3' (SEQ ID NO: 9)

The rest of the procedure is as in example 1. Randomly selecting clones, sending the clones to a sequencing company for sequencing verification, and selecting an expression vector pX330-sgRNA3 with correct connection for subsequent experiments, wherein the sequencing result is shown in FIG. 5.

Since other sgrnas and pX330-sgRNA plasmids construct an important point not in the examples of the present invention, they are not described or exemplified in detail.

Example 4 design of targeting vector

Human ACE2 Gene (Gene ID: ID: 59272) CDS protein coding sequence (based on transcripts with NCBI accession numbers NM-001371415.1 →NP-001358344.1, CDS sequence shown as hACE2-CDS SEQ ID NO:12, protein sequence shown as hACE2-protein SEQ ID NO:13) was inserted into the promoter of murine ACE2 and 5' UTR region sequences, and human ACE2 Gene expression was initiated using the murine ACE2 promoter. Meanwhile, the inserted human ACE2 CDS sequence is added with an SV40 polyA sequence signal (SV 40-polyA sequence is shown as SEQ ID NO: 14) to enhance the transcription stop of human ACE2 mRNA.

The hACE2-CDS sequence is as follows (SEQ ID NO: 12):

atgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttag

the hACE2-protein sequence is as follows (SEQ ID NO: 13):

/>

SV40 polyA sequence (SEQ ID NO: 14):

aacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatctta

based on the sequence design, the inventors further designed a targeting protocol as shown in FIG. 6 and a vector comprising a 5 'homology arm (5 arm), a human ACE2 gene fragment, a 3' homology arm (3 arm). Wherein the 5 'homology arm is nucleotide 125683-126652 (5' homology arm sequence is shown as SEQ ID NO: 15) with NCBI accession number AC091606.8, and the 3 'homology arm is nucleotide 126796-127766 (3' homology arm sequence is shown as SEQ ID NO: 16) with NCBI accession number AC 091606.8. Meanwhile, a PGK-puromycin heterologous gene packet is also inserted into a vector for screening, and a pair of identical frt sites (SEQ ID NO: 18) are designed at two ends of an expression frame of a puromycin resistance gene (PGK-puro, SEQ ID NO: 17), so that FLP recombinase can be utilized for removal, and the safety problem caused by transgenesis can be solved. The constructed vector was subjected to complete sequence verification. The vector was linearized by AgeI prior to targeting (targeting vector schematic and targeting strategy schematic are shown in FIG. 6).

5' homology arm sequence (SEQ ID NO: 15):

ccctatggagtggagaagagtcttataattttttaaatgggcagagaaatgaatttatttttaatttttagagacagggtttctttgtatagctctagctgtctttgattggtagacaaagctgtcctcaaactcagagatcttccttcctttgtctcctgagtgctgggattaaaggcatggaccaccactgccctgccccattctctccattaattttaagtgaatgcttgcaaaagctcacttctttggtgaacagcttcctttacaaataagtacctttgccttcgtttttataggattcttaaaaagaaaaaaaagattcagccaggtggttgtggtgcacacctttaatcccagcagtcaggaggcagaggaaagcagatctcttgagtttgaggctagcctagtctacagagggagttccaggacagccaaggctacagagaggaactgtctaaaaacaccaagaaagagagaaaggagagagggagaggatggatagcttattgatagaattgtcagaaaaggctataagttccaatatgtgtcccatgatttctaagtctagccctttctgttatagtaaaatcatagtacaccctcctcctccagtgtatctttaacagcttttaaggaacatattaactaaatgtccaggttttgatttggccataaaatgttagcaaagctaaggttttctaggattaatgaataacatgtctttatttagtttacttaaaaaaatcattctaaaatatctgtttacatatctgtcctctccaggattaacttcatattggtccagcagcttgtttactgttctcttctgtttcttcttctgctttttttttcttctcttctcagtgcccaacccaagttcaaaggctgatgagagagaaaaactcatgaagagattttactctagggaaagttgctcagtggatgggatcttggcgcacggggaaag

3' homology arm sequence (SEQ ID NO: 16):

Gaattataatactaacattactgaagaaaatgcccaaaagatggtaagttcttgaggctacccagggggttattgattgcttcttaaagatcagaattactgcctataaaactggataaggaaatcatagagatctctcaagtgtgaggatgagtgactgcctctgtagctctgatcctagtctcccagatggctaaattcaattgaccttagagttcatctggaaaattgttatgaatgaattatttgcccagattccaaagatgagtgaaaatgtttaataaagttgccatcactattctcattatatttggtatgtaaagcattcatggaaatgttctaagtcgttattgagccaataattttctttagcttataatgccaacaggtctatccgagaactacaaatgacatattaactgaaaaatgcaactggggtttactgaaggcagcagcttagtaattaaggtaaccatggcttaggtgaaactggacctgggaattccttctttcattgacacagagctctgaggaatttccaaaggtcacagaagaaaagctataattaaactagtcccaaaaaatctcagcctactctgggaaagcagcatattttgtttgacaagtgcaaggacttagaacttttttttttctcactgatcctgaagtgccttttaagtatagttaagtggtggaaaattgagcaactatttaagaaaagactcttttttttcttcttccagcaatgctttccttcaaaacggtagcttcaaaacttcctgtcttttaaatgatcagggggctgtgtgtttaaattattgccattcatagaacagagtgggtctgaggatgcctgtttcctttgaaattctatgccccctcccagttttctaaaatttaagaaaccacagagactttgacaatgtagttgccaaatgagttgcttttaactgctctaatagtttggtctt

PGK-puro sequence (SEQ ID NO: 17):

Gggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatcccccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacctgcagcccaagctagcttaccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctga

frt sequence (SEQ ID NO: 18): gaagttcctattctctagaaagtataggaacttc

The carrier construction process is as follows:

the design of the upstream primer (5 arm-pcrF: tcgcacacattccacatccaccggtccctatggagtggagaagagtctta (SEQ ID NO: 19)) and the matched downstream primer (5 arm-pcrR: gaaggagccaggaagagcttgacatctttccccgtgcgccaagatcc (SEQ ID NO: 20)) for amplifying the bridged fragment of the 5' homology arm;

designing an upstream primer (hACE 2-F: ggatcttggcgcacggggaaagatgtcaagctcttcctggctccttc (SEQ ID NO: 21)) for amplifying the bridge fragment of human ACE2 CDS and a downstream primer (hACE 2-R: cattataagctgcaataaacaagttctaaaaggaggtctgaacatcatc (SEQ ID NO: 22)) for matching the upstream primer;

designing an upstream primer (SV 40-F: gatgatgttcagacctccttttagaacttgtttattgcagcttataatg (SEQ ID NO: 23)) for amplifying the bridge fragment of SV40 polyA and a downstream primer (SV 40-R: AGAGAATAGGAACTTCGCACGCGTtaagatacattgatgagtttggac (SEQ ID NO: 24)) for matching the same;

the upstream primer (3 arm-pcr F: tacgaagttatGtcgacgcGGCGCGCCgaattataatactaacattactg (SEQ ID NO: 25)) and the downstream primer (3 arm-pcr rR: tatgaccatgattacgccaagcttaagaccaaactattagagcagttaaaagc (SEQ ID NO: 26)) matched thereto were designed to amplify the 3' homology arm fragment. The amplified template of the 5 'homology arm and the 3' homology arm is C57BL6/J mouse genome, and the amplified template of the human ACE2 is human lung cell cDNA. The PCR reaction system (using Norflua Max Super-FidelityDNAPolyerase) and conditions are shown in Table 4:

TABLE 4 PCR reaction system (50. Mu.L)

If so, the 5' homology arm of the product fragment obtained by PCR amplification, the human ACE2 CDS and the SV40 polyA are matched with a Touch down PCR method by using a bridge PCR (overlap PCR) to form a continuous fragment 5arm-hACE-SV40; and the 3' homology arm obtained by PCR amplification is directly used for constructing a homologous recombination targeting vector after being recovered, and the construction process is as follows:

1. performing AgeI+MluI double digestion on the 5arm-hACE-SV40 fragment; the 3' homologous arm fragments are respectively connected by an enzyme digestion connection method after being subjected to AscI+HindIII double enzyme digestion, so that the targeting vector is obtained. 2. The obtained positive targeting vector is sent to sequencing identification after enzyme digestion identification, and the sequencing company verifies that the sequence is correct (as shown in figure 7), so that the humanized ACE2 targeting vector is successfully obtained, and the sequence is as follows:

the entire targeting vector sequence (SEQ ID NO: 27):

tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgtaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggtccctatggagtggagaagagtcttataattttttaaatgggcagagaaatgaatttatttttaatttttagagacagggtttctttgtatagctctagctgtctttgattggtagacaaagctgtcctcaaactcagagatcttccttcctttgtctcctgagtgctgggattaaaggcatggaccaccactgccctgccccattctctccattaattttaagtgaatgcttgcaaaagctcacttctttggtgaacagcttcctttacaaataagtacctttgccttcgtttttataggattcttaaaaagaaaaaaaagattcagccaggtggttgtggtgcacacctttaatcccagcagtcaggaggcagaggaaagcagatctcttgagtttgaggctagcctagtctacagagggagttccaggacagccaaggctacagagaggaactgtctaaaaacaccaagaaagagagaaaggagagagggagaggatggatagcttattgatagaattgtcagaaaaggctataagttccaatatgtgtcccatgatttctaagtctagccctttctgttatagtaaaatcatagtacaccctcctcctccagtgtatctttaacagcttttaaggaacatattaactaaatgtccaggttttgatttggccataaaatgttagcaaagctaaggttttctaggattaatgaataacatgtctttatttagtttacttaaaaaaatcattctaaaatatctgtttacatatctgtcctctccaggattaacttcatattggtccagcagcttgtttactgttctcttctgtttcttcttctgctttttttttcttctcttctcagtgcccaacccaagttcaaaggctgatgagagagaaaaactcatgaagagattttactctagggaaagttgctcagtggatgggatcttggcgcacggggaaagatgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcgtgcgaagttcctattctctagaaagtataggaacttcatcgataccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatcccccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacctgcagcccaagctagcttaccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaggtacctctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatcgatgaagttcctattctctagaaagtataggaacttctaacctcccgggtgacagataacttcgtataatgtatgctatacgaagttatgtcgacgcggcgcgccgaattataatactaacattactgaagaaaatgcccaaaagatggtaagttcttgaggctacccagggggttattgattgcttcttaaagatcagaattactgcctataaaactggataaggaaatcatagagatctctcaagtgtgaggatgagtgactgcctctgtagctctgatcctagtctcccagatggctaaattcaattgaccttagagttcatctggaaaattgttatgaatgaattatttgcccagattccaaagatgagtgaaaatgtttaataaagttgccatcactattctcattatatttggtatgtaaagcattcatggaaatgttctaagtcgttattgagccaataattttctttagcttataatgccaacaggtctatccgagaactacaaatgacatattaactgaaaaatgcaactggggtttactgaaggcagcagcttagtaattaaggtaaccatggcttaggtgaaactggacctgggaattccttctttcattgacacagagctctgaggaatttccaaaggtcacagaagaaaagctataattaaactagtcccaaaaaatctcagcctactctgggaaagcagcatattttgtttgacaagtgcaaggacttagaacttttttttttctcactgatcctgaagtgccttttaagtatagttaagtggtggaaaattgagcaactatttaagaaaagactcttttttttcttcttccagcaatgctttccttcaaaacggtagcttcaaaacttcctgtcttttaaatgatcagggggctgtgtgtttaaattattgccattcatagaacagagtgggtctgaggatgcctgtttcctttgaaattctatgccccctcccagttttctaaaatttaagaaaccacagagactttgacaatgtagttgccaaatgagttgcttttaactgctctaatagtttggtcttaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtc

comparative example 1

The 5' -homology arm, human ACE2 CDS and SV40 polyA of the PCR amplified product fragment were PCR-processed into a continuous fragment 5arm-hACE-SV40 by the bridge PCR (overlap PCR) method, and the PCR reaction conditions are shown in Table 5, and the other conditions were the same as in example 4.

TABLE 5 PCR reaction system (50. Mu.L)

The results are shown in FIG. 8, and the 3-fragment ligation fragment was not amplified.

EXAMPLE 5 acquisition of humanized ACE2 mouse embryonic Stem cells

In one embodiment, the humanized ACE2 mouse embryonic stem cells are obtained as follows:

the C57BL6/J mouse embryonic stem cells (said embryonic stem cells derived from established embryonic stem cell lines) were recovered from the pool of liquid nitrogen cryopreserved cells, and were grown in culture in 6cm dishes for 3 days, using in particular mouse embryonic stem cells with an algebraic number of p10 or less.

By matching with Nucleofector ^TM IIs/2b electrotransport device and Mouse ES Cell

Kit (Lonza, VPH-1001) mouse embryonic stem cell electrotransformation Kit, approximately 2X 10 using the A023 procedure ⁶ Individual cells were electroporated and the electroporation process was performed in 100 μl of electroporation buffer containing 3 μg of linearized targeting vector and 1 μg of pX330-sgRNA 1. The transfected cells were seeded into wells of 3 6-well plates and then recovered for 36 hours. After recovery, 1. Mu.g/mL puromycin (Merck) was added to the cell culture medium.

After 3-4 days of screening, puromycin resistant mouse embryonic stem cells were picked and cultured by pipetting the monoclonal cells using a glass pull needle and cloned into 96 well plates. The following day the monoclonal was digested by pancreatin and split into two cultures, one of which was lysed individually in 10 μl of NP 40 lysis buffer at 56 ℃ for 60 minutes followed by 10 minutes at 95 ℃.

Wherein, the specific steps of the culture of the mouse embryonic stem cells are as follows: feeder cells were prepared one day in advance, plated on different well plates as required, and cultured overnight to form a monolayer. Wherein the feeder cells are mouse embryo fibroblasts prepared by mitomycin C (MMC) method. Culturing with mES medium containing LIF and 2i (chip 99021 and pD0325901 inhibitor), changing fresh medium every day, adding medium appropriately according to cell growth vigor, transferring generation for 3 days, digesting with 0.25% pancreatin, and planting according to density of about 30 ten thousand 6 cm plate and 10 ten thousand 6 pore plate.

The mES+LIF+2i medium consisted of: knockout DMEM (1×, gibco) +15% FBS (FRONT BIOMEDICAL,0.22 μm Millipore filter) +GlutaMAX (100×, gibco) +NEAA (100×, gibco) +P/S (P: 50units, S:50mg/ml, hyclone) +beta-mercaptanol (gibco, using concentrations of 0.1 mM) +LIF (1000 units/ml, millipore) +CHIR99021 (GSK 3. Beta. Inhibitor, using concentrations of 3. Mu.M) +PD0325901 (MEK inhibitor, using concentrations of 1. Mu.M).

The composition of the NP40 lysate was: 10mL TE (20mM Tris pH8.0, 150mM NaCl,2mM EDTA) +0.5% NP40+10. Mu.L proteinase K (10 mg/mL).

In the method, the pX330-sgRNA1 is replaced by pX330-sgRNA2 or pX330-sgRNA3, and other steps are the same as those of the pX330-sgRNA1.

The targeting effect of the pX330-sgRNA1, pX330-sgRNA2 and pX330-sgRNA3 in combination with the targeting vector is shown in Table 6.

Table 6. Targeting effect of sgRNA1-3 with targeting vector (number of surviving clones)

pX330-sgRNA1	pX330-sgRNA2	pX330-sgRNA3
			231	187	43

Example 6 genotyping of humanized ACE2 mouse embryonic stem cells

The cell lysate obtained finally in example 5 was used as a template for genotyping PCR screening. PCR screening was performed according to the manufacturer's instructions by using Phanta Max Super-FidelityDNAPolyase reagent (Norwegian Co.). PCR analysis was used to direct HDR with 5 'homology arm and 3' homology arm inserted into the mouse Ace2 site. Since the ACE2 gene is located on the X chromosome, the mouse embryonic stem cells used are XY male, so there is no bi-allelic targeting.

The identification of the insert-directing primer was located upstream of the puromycin resistance interior (Puro-F: aacctccccttctacgagc (SEQ ID NO: 28)), and the primer paired therewith was located downstream of the 3' homology arm (3 arm-outR: tacagccaggatctggatgtcagc (SEQ ID NO: 29)). If the recombinant vector is inserted at the correct position, a band of 1504bp should appear. At this time, the genome sequence of the Ace2 locus of the mouse embryonic stem cell is replaced by SEQ ID NO. 30:

ccctatggagtggagaagagtcttataattttttaaatgggcagagaaatgaatttatttttaatttttagagacagggtttctttgtatagctctagctgtctttgattggtagacaaagctgtcctcaaactcagagatcttccttcctttgtctcctgagtgctgggattaaaggcatggaccaccactgccctgccccattctctccattaattttaagtgaatgcttgcaaaagctcacttctttggtgaacagcttcctttacaaataagtacctttgccttcgtttttataggattcttaaaaagaaaaaaaagattcagccaggtggttgtggtgcacacctttaatcccagcagtcaggaggcagaggaaagcagatctcttgagtttgaggctagcctagtctacagagggagttccaggacagccaaggctacagagaggaactgtctaaaaacaccaagaaagagagaaaggagagagggagaggatggatagcttattgatagaattgtcagaaaaggctataagttccaatatgtgtcccatgatttctaagtctagccctttctgttatagtaaaatcatagtacaccctcctcctccagtgtatctttaacagcttttaaggaacatattaactaaatgtccaggttttgatttggccataaaatgttagcaaagctaaggttttctaggattaatgaataacatgtctttatttagtttacttaaaaaaatcattctaaaatatctgtttacatatctgtcctctccaggattaacttcatattggtccagcagcttgtttactgttctcttctgtttcttcttctgctttttttttcttctcttctcagtgcccaacccaagttcaaaggctgatgagagagaaaaactcatgaagagattttactctagggaaagttgctcagtggatgggatcttggcgcacggggaaagatgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcgtgcgaagttcctattctctagaaagtataggaacttcatcgataccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatcccccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacctgcagcccaagctagcttaccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaggtacctctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatcgatgaagttcctattctctagaaagtataggaacttctaacctcccgggtgacagataacttcgtataatgtatgctatacgaagttatgtcgacgcggcgcgccgaattataatactaacattactgaagaaaatgcccaaaagatggtaagttcttgaggctacccagggggttattgattgcttcttaaagatcagaattactgcctataaaactggataaggaaatcatagagatctctcaagtgtgaggatgagtgactgcctctgtagctctgatcctagtctcccagatggctaaattcaattgaccttagagttcatctggaaaattgttatgaatgaattatttgcccagattccaaagatgagtgaaaatgtttaataaagttgccatcactattctcattatatttggtatgtaaagcattcatggaaatgttctaagtcgttattgagccaataattttctttagcttataatgccaacaggtctatccgagaactacaaatgacatattaactgaaaaatgcaactggggtttactgaaggcagcagcttagtaattaaggtaaccatggcttaggtgaaactggacctgggaattccttctttcattgacacagagctctgaggaatttccaaaggtcacagaagaaaagctataattaaactagtcccaaaaaatctcagcctactctgggaaagcagcatattttgtttgacaagtgcaaggacttagaacttttttttttctcactgatcctgaagtgccttttaagtatagttaagtggtggaaaattgagcaactatttaagaaaagactcttttttttcttcttccagcaatgctttccttcaaaacggtagcttcaaaacttcctgtcttttaaatgatcagggggctgtgtgtttaaattattgccattcatagaacagagtgggtctgaggatgcctgtttcctttgaaattctatgccccctcccagttttctaaaatttaagaaaccacagagactttgacaatgtagttgccaaatgagttgcttttaactgctctaatagtttggtctt(seq id no:30)

the PCR identification results are shown in FIG. 9, and 14 clones were identified in total, wherein positive clones are marked with a number, and the PCR products are matched and consistent through the sequencing results. The positive mouse embryo stem cell clone of the PCR result is a successfully edited humanized mouse embryo stem cell model, but PGK-Puro screening marks are reserved in the humanized mouse embryo stem cell model, and the FLP recombinase can be utilized to remove the PGK-Puro screening marks because the two ends of the PGK-Puro have a pair of identical frt sites, so that the safety problem caused by transgenosis is solved.

The deletion method of the PGK-Puro screening mark is as follows:

continuously culturing the positive mouse embryo stem cells to 6cm tray, and using Nucleofector ^TM IIs/2b electrotransport device and Mouse ES Cell

Kit (Lonza, VPH-1001) mouse embryonic stem cell electrotransformation Kit, approximately 2X 10 using the A023 procedure ⁶ The individual cells were electroporated and the electroporation process was performed in 100. Mu.L of electroporation buffer containing the pPGK-FLPo plasmid (Addgene, 13793). The transfected cells were seeded into wells of 6 12-well platesAfter 3 days, the mouse embryonic stem cells are picked up by adopting a mode of sucking the monoclonal cells by a glass pull needle and cloned into a 96-well plate for culture, and the monoclonal digestion passage is divided into two parts in the next day, one part is subjected to puromycin screening, and the other part is subjected to normal culture. If the PGK-Puro resistance selection marker is successfully deleted, the cells are intolerant to death after puromycin selection. Clones corresponding to puromycin intolerance can be identified by genomic genotyping PCR using the upstream primer (hACE 2-F: tgatagtggttggcattgt (SEQ ID NO: 31)) and the downstream primer (3 arm-outR: tacagccaggatctggatgtcagc (SEQ ID NO: 29)). If the PGK-Puro screening mark is successfully deleted, the length of the PCR product is 1532bp, and the length of the PCR product before deletion of the PGK-Puro is 2863bp. The genotype identification results are shown in FIG. 9, the run-on band was the clone after successful deletion of PGK-puro at 1500bp, and the band was the clone before deletion at 3000 bp. The puromycin intolerant clone was the final successful editing of the humanized ACE2 targeted mouse embryonic stem cells, i.e. the mouse embryonic stem cells eventually obtained the humanized ACE2 gene as shown in figure 10. The genomic sequence of the Ace2 locus of the mouse embryonic stem cell after the final deletion of PGK-puro is replaced by SEQ ID NO. 32 as follows:

ccctatggagtggagaagagtcttataattttttaaatgggcagagaaatgaatttatttttaatttttagagacagggtttctttgtatagctctagctgtctttgattggtagacaaagctgtcctcaaactcagagatcttccttcctttgtctcctgagtgctgggattaaaggcatggaccaccactgccctgccccattctctccattaattttaagtgaatgcttgcaaaagctcacttctttggtgaacagcttcctttacaaataagtacctttgccttcgtttttataggattcttaaaaagaaaaaaaagattcagccaggtggttgtggtgcacacctttaatcccagcagtcaggaggcagaggaaagcagatctcttgagtttgaggctagcctagtctacagagggagttccaggacagccaaggctacagagaggaactgtctaaaaacaccaagaaagagagaaaggagagagggagaggatggatagcttattgatagaattgtcagaaaaggctataagttccaatatgtgtcccatgatttctaagtctagccctttctgttatagtaaaatcatagtacaccctcctcctccagtgtatctttaacagcttttaaggaacatattaactaaatgtccaggttttgatttggccataaaatgttagcaaagctaaggttttctaggattaatgaataacatgtctttatttagtttacttaaaaaaatcattctaaaatatctgtttacatatctgtcctctccaggattaacttcatattggtccagcagcttgtttactgttctcttctgtttcttcttctgctttttttttcttctcttctcagtgcccaacccaagttcaaaggctgatgagagagaaaaactcatgaagagattttactctagggaaagttgctcagtggatgggatcttggcgcacggggaaagatgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcgtgcgaagttcctattctctagaaagtataggaacttctaacctcccgggtgacagataacttcgtataatgtatgctatacgaagttatgtcgacgcggcgcgccgaattataatactaacattactgaagaaaatgcccaaaagatggtaagttcttgaggctacccagggggttattgattgcttcttaaagatcagaattactgcctataaaactggataaggaaatcatagagatctctcaagtgtgaggatgagtgactgcctctgtagctctgatcctagtctcccagatggctaaattcaattgaccttagagttcatctggaaaattgttatgaatgaattatttgcccagattccaaagatgagtgaaaatgtttaataaagttgccatcactattctcattatatttggtatgtaaagcattcatggaaatgttctaagtcgttattgagccaataattttctttagcttataatgccaacaggtctatccgagaactacaaatgacatattaactgaaaaatgcaactggggtttactgaaggcagcagcttagtaattaaggtaaccatggcttaggtgaaactggacctgggaattccttctttcattgacacagagctctgaggaatttccaaaggtcacagaagaaaagctataattaaactagtcccaaaaaatctcagcctactctgggaaagcagcatattttgtttgacaagtgcaaggacttagaacttttttttttctcactgatcctgaagtgccttttaagtatagttaagtggtggaaaattgagcaactatttaagaaaagactcttttttttcttcttccagcaatgctttccttcaaaacggtagcttcaaaacttcctgtcttttaaatgatcagggggctgtgtgtttaaattattgccattcatagaacagagtgggtctgaggatgcctgtttcctttgaaattctatgccccctcccagttttctaaaatttaagaaaccacagagactttgacaatgtagttgccaaatgagttgcttttaactgctctaatagtttggtctt(seq id no:32)

Example 7 formation of humanized ACE2 Gene engineered mice

1. 7.5 units PMSG was intraperitoneally injected into 4-10 week old B6C3F1 females, hCG was injected 48 hours later and caged with CD1 females, female mice were checked for vaginal plugs the next morning and females with vaginal plugs were picked out, and the corresponding fertilization times of females were recorded.

2. The pregnant mice are euthanized by cervical dislocation on the next day, the abdomen of the mice is sterilized by 70% alcohol, the skin and muscle layers of the abdomen are cut off by forceps and ophthalmic scissors, and the abdominal cavity is opened. The upper part of one uterine horn was grasped with forceps, a small opening was opened on the membrane near the oviduct with scissors, the junction of the oviduct and the ovary was cut off, the oviduct and the accompanying uterus were moved into a 35mm dish, the mouth end of the oviduct was fixed with forceps, the mouth was gently inserted with a washing needle filled with M2 culture solution (Hogan, B. (1994). Manipulating the mouse embryo: a laboratory manual,2nd edn (Cold Spring Harbor, NY, cold Spring Harbor Laboratory Press)), the oviduct was washed with 0.1mL of M2 culture solution, the washed embryo was collected with an egg transfer tube and washed 3 times with M2, and the 2-cell embryo of E1.5 mice was collected.

3. Placing the collected mouse embryo into a container containing 0.1mM MgSO4,0.1mM CaCl ₂ And 0.3M mannitol (Sigma-Aldrich Inc., st. Louis, mo.) with 0.3% bovine serum albumin, 60V 50 microsecond DC fusion was performed with a Cellfusion CF-150/B electrofusion apparatus and a 250-um fusion cell (BLS Ltd., budapest, hungary) to obtain 4-fold embryos; the resultant cells were placed in KSOM medium (Summers, M.C., mcGinnis, L.K., lawitts, J.A., raffin, M., and Biggers, J.D. (2000). IVF of mouse ova in a simplex optimized medium supplemented with amino acids.hum Reprod 15, 1791-1801.) and incubated in a CO2 incubator for 24 hours, and then the zona pellucida was removed with acid Table (Sigma-Aldrich, T1788) and aggregated with embryonic stem cells (i.e., humanized ACE2 mouse embryonic stem cells prepared herein) to form chimeric embryos (Nagy, A., rossant, J., nagy, R., abramow-Newerly, W., and Roder, J.C. (1993) Derivation of completely cell culture-derived mice from early-passage embryonic stem cells.Proc Natl Acad Sci U S A, 8424-8428).

4. In CO ₂ Culturing overnight in incubator, transplanting to uterus of pseudopregnant mice of E2.5 days, euthanizing the cervical dislocation method of the pregnant mice, performing laparotomy after 17 days, placing the alive and respirated newborn mice into a milk-substituted squirrel cage, and weaning after 21 days to obtain transgenic mice completely derived from embryonic stem cells, thus obtaining humanized ACE2 gene modified mice (figure 12).

The corresponding medium formulations are shown in table 7.

Table 7 Medium formulation

Example 8 verification of hACE2 expression in humanized ACE2 Gene-engineered mice

Small intestine, lung and kidney samples of a wild-type mouse and a humanized ACE2 gene-modified mouse (prepared in example 7) were taken for RNA extraction and qPCR to verify hACE2 gene expression. Tissue samples were lysed by adding Trizol reagent. 200 μl of chloroform is added into each milliliter of Trizol lysate, the mixture is subjected to vigorous shaking and then is left to separate layers, after repeated operation for 3 times, centrifugation is carried out at 14000rpm for 15min at 4 ℃, 400 μl of supernatant is taken into 400 μl of pre-cooled isopropanol, the mixture is inverted and mixed uniformly, the mixture is left to stand on ice for 5min at 4 ℃ and is centrifuged at 14000pm for 10min, and white precipitate is visible at the bottom of an EP tube to be RNA.

Removing the supernatant, adding precooled 70% ethanol solution, washing once, centrifuging, removing ethanol, airing RNA until the RNA is colorless and transparent, adding a proper amount of RNase-free H2O according to the precipitation amount, and completely dissolving in water bath at 60 ℃. The purity and concentration were measured by diluting 1. Mu.l with 10mM Tris-HCl (pH 7.5) and H2O 50-fold, and the OD260/280 was preferably about 2.0. The extracted RNA is stored at-80 ℃ and can be stored for a long time.

2. Mu.g of RNA was inverted and the system was as shown in Table 8. The inverted cDNA samples were diluted 30-fold and further used for fluorescent quantitative PCR detection of gene expression, hACE2 detection qPCR primers were as follows (hACE 2-qF: GGTCTTCAGTGCTCTCAG (SEQ ID NO: 33); hACE2-qR: GCATTCTTGTGGATTATCTGG (SEQ ID NO: 34)), and humanized ACE 2-genetically modified mice were seen to express human ACE2 at the RNA level and to have tissue specificity (FIG. 13).

TABLE 8

/>

In addition, humanized ACE2 gene is used for modifying small intestine, lung and testis tissues of the mice to carry out immunofluorescence tissue protein level to verify the expression condition of human ACE 2. Mouse tissues were fixed in 4% pfa overnight at 4 ℃. The next day, tissues were rinsed 3 times in PBS and cryoprotected overnight at 4 ℃ in 30% sucrose in PBS. The tissue was then treated with 30% sucrose/PBS and o.c.t. at 1:1 for 2-4 hours. The embedding medium was frozen (Sakura, catalog number 4583). Next, the tissue was transferred from the sucrose/OCT mixture into a low temperature mold and filled with o.c.t. The embedded tissue was frozen on dry ice and then stored at-80 ℃ until cryostat sections were taken. Frozen organoid tissues were cut into 20 μm sections using a cryostat and collected on superfrost Ultra Plus slides. The sections were dried overnight and then used for immunofluorescence. 4% PFA was post-fixed directly on a slide for 10 minutes at room temperature and then washed 3X10 times in PBS. The tissue region was outlined using a hydrophobic PAP pen. Blocking with PBS containing 0.05% sodium azide 5% bsa/0.3% tx100 and incubation for 30 min at room temperature. The tissues were then incubated with anti-ACE 2 antibodies (ET 1611-58, huaboo) overnight at 4 ℃. After PBS washing, the secondary antibody (A11004, invitrogen) was incubated for 1 hour, followed by DAPI for 2 minutes. Finally, the coverslip was mounted on a slide glass and observed, and it was seen from the tissue immunofluorescence result that human ACE2 was specifically expressed on the tissues of the humanized ACE2 genetically modified mice at the protein expression level (fig. 14).

EXAMPLE 9 humanized ACE2 Gene-modified mice infected with SARS-CoV-2

Humanized ACE2 Gene-modified mice were inhaled by nasal drip into 30. Mu.l DMEM containing 2X 10 ⁶ TCID ₅₀ SARS-CoV-2 with viral load, control group was instilled with 30. Mu.l DMEM. Lung, airway and small intestine tissues of infected mice were taken at D1, D3, D5, D6, D7 and D9, respectively, lysed with Trizol and subjected to RNA extraction and fluorescent quantitative PCR to detect SARS-CoV-2 virus titer, the RNA extraction method being identical to the hACE2 expression detection examples described above. The extracted tissue RNA will be used

The detection of the nucleoprotein N gene of SARS-CoV-2 was performed using the Probe One-step qRT-PCR Kit (Toyobo) Kit. The primers used for the fluorescent quantitative PCR detection are as follows: forward primer: 5'-GGGGAACTTCTCCTGCTAGAAT-3' (SEQ ID NO: 35); the reverse primer 5'-CAGACATTTTGCTCTCAAGCTG-3' (SEQ ID NO: 36) and TaqMan probe sequence of 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3' (SEQ ID NO: 37) showed that the lung, airway and small intestine viral loads of humanized ACE2 genetically modified mice after SARS-CoV-2 infection reached peaks at D1 and D3, and then declined, indicating that the humanized ACE2 genetically modified mice of the invention were susceptible to SARS-CoV-2 (FIG. 15), whereas the control mice did not detect virus. The broken lines in fig. 15 represent average values. / >

Sequence listing

<110> Guangzhou biomedical and health institute of China academy of sciences

<120> humanized ACE2 gene modified mouse embryonic stem cell model preparation method and application

<150> 202010152182.X

<151> 2020-03-06

<160> 37

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Natural sequence

<220>

<223> sgRNA1 sequence

<400> 1

tactgctcag tccctcaccg agg 23

<210> 2

<211> 23

<212> DNA

<213> Natural sequence

<220>

<223> sgRNA2 sequence

<400> 2

cttggcattt tcctcggtga ggg 23

<210> 3

<211> 23

<212> DNA

<213> Natural sequence

<220>

<223> sgRNRA3 sequence

<400> 3

caagtgaact ttgataagac agg 23

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Synthesis of upstream Single-stranded primer sequence of sgRNA2

<400> 4

caccgcttgg cattttcctc ggtga 25

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Synthesis of downstream Single-stranded primer sequence of sgRNA2

<400> 5

aaactcaccg aggaaaatgc caagc 25

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Synthesis of upstream Single-stranded primer sequence of sgRNA1

<400> 6

caccgtactg ctcagtccct caccg 25

<210> 7

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Synthesis of downstream Single-stranded primer sequence of sgRNA1

<400> 7

aaaccggtga gggactgagc agtac 25

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Synthesis of upstream Single-stranded primer sequence of sgRNA3

<400> 8

caccgcaagt gaactttgat aagac 25

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Synthesis of downstream Single-stranded primer sequence of sgRNA3

<400> 9

aaacgtctta tcaaagttca cttgc 25

<210> 10

<211> 28

<212> DNA

<213> Natural sequence

<220>

<223> 5arm-sgF

<400> 10

ggttttgatt tggccataaa atgttagc 28

<210> 11

<211> 25

<212> DNA

<213> Natural sequence

<220>

<223> 3arm-sgR

<400> 11

attcccaggt ccagtttcac ctaag 25

<210> 12

<211> 2418

<212> DNA

<213> Natural sequence

<220>

<223> hACE2-CDS sequence

<400> 12

atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc tcagtccacc 60

attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga agacctgttc 120

tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga gaatgtccaa 180

aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc cacacttgcc 240

caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct gcaggctctt 300

cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa cacaattcta 360

aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa tccacaagaa 420

tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga ctacaatgag 480

aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag gccattatat 540

gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga ggactatggg 600

gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta cagccgcggc 660

cagttgattg aagatgtgga acataccttt gaagagatta aaccattata tgaacatctt 720

catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag tccaattgga 780

tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa tctgtactct 840

ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat ggtggaccag 900

gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc tgttggtctt 960

cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg aaatgttcag 1020

aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag gatccttatg 1080

tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg gcatatccag 1140

tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa tgaaggattc 1200

catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca tttaaaatcc 1260

attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa cttcctgctc 1320

aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga gaagtggagg 1380

tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg gtgggagatg 1440

aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata ctgtgacccc 1500

gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac aaggaccctt 1560

taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg ccctctgcac 1620

aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat gctgaggctt 1680

ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa gaacatgaat 1740

gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga ccagaacaag 1800

aattcttttg tgggatggag taccgactgg agtccatatg cagaccaaag catcaaagtg 1860

aggataagcc taaaatcagc tcttggagat aaagcatatg aatggaacga caatgaaatg 1920

tacctgttcc gatcatctgt tgcatatgct atgaggcagt actttttaaa agtaaaaaat 1980

cagatgattc tttttgggga ggaggatgtg cgagtggcta atttgaaacc aagaatctcc 2040

tttaatttct ttgtcactgc acctaaaaat gtgtctgata tcattcctag aactgaagtt 2100

gaaaaggcca tcaggatgtc ccggagccgt atcaatgatg ctttccgtct gaatgacaac 2160

agcctagagt ttctggggat acagccaaca cttggacctc ctaaccagcc ccctgtttcc 2220

atatggctga ttgtttttgg agttgtgatg ggagtgatag tggttggcat tgtcatcctg 2280

atcttcactg ggatcagaga tcggaagaag aaaaataaag caagaagtgg agaaaatcct 2340

tatgcctcca tcgatattag caaaggagaa aataatccag gattccaaaa cactgatgat 2400

gttcagacct ccttttag 2418

<210> 13

<211> 805

<212> PRT

<213> Natural sequence

<220>

<223> hACE2-protein sequence

<400> 13

Met Ser Ser Ser Ser Trp Leu Leu Leu Ser Leu Val Ala Val Thr Ala

1 5 10 15

Ala Gln Ser Thr Ile Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe

20 25 30

Asn His Glu Ala Glu Asp Leu Phe Tyr Gln Ser Ser Leu Ala Ser Trp

35 40 45

Asn Tyr Asn Thr Asn Ile Thr Glu Glu Asn Val Gln Asn Met Asn Asn

50 55 60

Ala Gly Asp Lys Trp Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala

65 70 75 80

Gln Met Tyr Pro Leu Gln Glu Ile Gln Asn Leu Thr Val Lys Leu Gln

85 90 95

Leu Gln Ala Leu Gln Gln Asn Gly Ser Ser Val Leu Ser Glu Asp Lys

100 105 110

Ser Lys Arg Leu Asn Thr Ile Leu Asn Thr Met Ser Thr Ile Tyr Ser

115 120 125

Thr Gly Lys Val Cys Asn Pro Asp Asn Pro Gln Glu Cys Leu Leu Leu

130 135 140

Glu Pro Gly Leu Asn Glu Ile Met Ala Asn Ser Leu Asp Tyr Asn Glu

145 150 155 160

Arg Leu Trp Ala Trp Glu Ser Trp Arg Ser Glu Val Gly Lys Gln Leu

165 170 175

Arg Pro Leu Tyr Glu Glu Tyr Val Val Leu Lys Asn Glu Met Ala Arg

180 185 190

Ala Asn His Tyr Glu Asp Tyr Gly Asp Tyr Trp Arg Gly Asp Tyr Glu

195 200 205

Val Asn Gly Val Asp Gly Tyr Asp Tyr Ser Arg Gly Gln Leu Ile Glu

210 215 220

Asp Val Glu His Thr Phe Glu Glu Ile Lys Pro Leu Tyr Glu His Leu

225 230 235 240

His Ala Tyr Val Arg Ala Lys Leu Met Asn Ala Tyr Pro Ser Tyr Ile

245 250 255

Ser Pro Ile Gly Cys Leu Pro Ala His Leu Leu Gly Asp Met Trp Gly

260 265 270

Arg Phe Trp Thr Asn Leu Tyr Ser Leu Thr Val Pro Phe Gly Gln Lys

275 280 285

Pro Asn Ile Asp Val Thr Asp Ala Met Val Asp Gln Ala Trp Asp Ala

290 295 300

Gln Arg Ile Phe Lys Glu Ala Glu Lys Phe Phe Val Ser Val Gly Leu

305 310 315 320

Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp Pro

325 330 335

Gly Asn Val Gln Lys Ala Val Cys His Pro Thr Ala Trp Asp Leu Gly

340 345 350

Lys Gly Asp Phe Arg Ile Leu Met Cys Thr Lys Val Thr Met Asp Asp

355 360 365

Phe Leu Thr Ala His His Glu Met Gly His Ile Gln Tyr Asp Met Ala

370 375 380

Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly Phe

385 390 395 400

His Glu Ala Val Gly Glu Ile Met Ser Leu Ser Ala Ala Thr Pro Lys

405 410 415

His Leu Lys Ser Ile Gly Leu Leu Ser Pro Asp Phe Gln Glu Asp Asn

420 425 430

Glu Thr Glu Ile Asn Phe Leu Leu Lys Gln Ala Leu Thr Ile Val Gly

435 440 445

Thr Leu Pro Phe Thr Tyr Met Leu Glu Lys Trp Arg Trp Met Val Phe

450 455 460

Lys Gly Glu Ile Pro Lys Asp Gln Trp Met Lys Lys Trp Trp Glu Met

465 470 475 480

Lys Arg Glu Ile Val Gly Val Val Glu Pro Val Pro His Asp Glu Thr

485 490 495

Tyr Cys Asp Pro Ala Ser Leu Phe His Val Ser Asn Asp Tyr Ser Phe

500 505 510

Ile Arg Tyr Tyr Thr Arg Thr Leu Tyr Gln Phe Gln Phe Gln Glu Ala

515 520 525

Leu Cys Gln Ala Ala Lys His Glu Gly Pro Leu His Lys Cys Asp Ile

530 535 540

Ser Asn Ser Thr Glu Ala Gly Gln Lys Leu Phe Asn Met Leu Arg Leu

545 550 555 560

Gly Lys Ser Glu Pro Trp Thr Leu Ala Leu Glu Asn Val Val Gly Ala

565 570 575

Lys Asn Met Asn Val Arg Pro Leu Leu Asn Tyr Phe Glu Pro Leu Phe

580 585 590

Thr Trp Leu Lys Asp Gln Asn Lys Asn Ser Phe Val Gly Trp Ser Thr

595 600 605

Asp Trp Ser Pro Tyr Ala Asp Gln Ser Ile Lys Val Arg Ile Ser Leu

610 615 620

Lys Ser Ala Leu Gly Asp Lys Ala Tyr Glu Trp Asn Asp Asn Glu Met

625 630 635 640

Tyr Leu Phe Arg Ser Ser Val Ala Tyr Ala Met Arg Gln Tyr Phe Leu

645 650 655

Lys Val Lys Asn Gln Met Ile Leu Phe Gly Glu Glu Asp Val Arg Val

660 665 670

Ala Asn Leu Lys Pro Arg Ile Ser Phe Asn Phe Phe Val Thr Ala Pro

675 680 685

Lys Asn Val Ser Asp Ile Ile Pro Arg Thr Glu Val Glu Lys Ala Ile

690 695 700

Arg Met Ser Arg Ser Arg Ile Asn Asp Ala Phe Arg Leu Asn Asp Asn

705 710 715 720

Ser Leu Glu Phe Leu Gly Ile Gln Pro Thr Leu Gly Pro Pro Asn Gln

725 730 735

Pro Pro Val Ser Ile Trp Leu Ile Val Phe Gly Val Val Met Gly Val

740 745 750

Ile Val Val Gly Ile Val Ile Leu Ile Phe Thr Gly Ile Arg Asp Arg

755 760 765

Lys Lys Lys Asn Lys Ala Arg Ser Gly Glu Asn Pro Tyr Ala Ser Ile

770 775 780

Asp Ile Ser Lys Gly Glu Asn Asn Pro Gly Phe Gln Asn Thr Asp Asp

785 790 795 800

Val Gln Thr Ser Phe

805

<210> 14

<211> 122

<212> DNA

<213> Natural sequence

<220>

<223> SV40 polyA sequence

<400> 14

aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60

aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120

ta 122

<210> 15

<211> 970

<212> DNA

<213> Natural sequence

<220>

<223> 5' homology arm sequence

<400> 15

ccctatggag tggagaagag tcttataatt ttttaaatgg gcagagaaat gaatttattt 60

ttaattttta gagacagggt ttctttgtat agctctagct gtctttgatt ggtagacaaa 120

gctgtcctca aactcagaga tcttccttcc tttgtctcct gagtgctggg attaaaggca 180

tggaccacca ctgccctgcc ccattctctc cattaatttt aagtgaatgc ttgcaaaagc 240

tcacttcttt ggtgaacagc ttcctttaca aataagtacc tttgccttcg tttttatagg 300

attcttaaaa agaaaaaaaa gattcagcca ggtggttgtg gtgcacacct ttaatcccag 360

cagtcaggag gcagaggaaa gcagatctct tgagtttgag gctagcctag tctacagagg 420

gagttccagg acagccaagg ctacagagag gaactgtcta aaaacaccaa gaaagagaga 480

aaggagagag ggagaggatg gatagcttat tgatagaatt gtcagaaaag gctataagtt 540

ccaatatgtg tcccatgatt tctaagtcta gccctttctg ttatagtaaa atcatagtac 600

accctcctcc tccagtgtat ctttaacagc ttttaaggaa catattaact aaatgtccag 660

gttttgattt ggccataaaa tgttagcaaa gctaaggttt tctaggatta atgaataaca 720

tgtctttatt tagtttactt aaaaaaatca ttctaaaata tctgtttaca tatctgtcct 780

ctccaggatt aacttcatat tggtccagca gcttgtttac tgttctcttc tgtttcttct 840

tctgcttttt ttttcttctc ttctcagtgc ccaacccaag ttcaaaggct gatgagagag 900

aaaaactcat gaagagattt tactctaggg aaagttgctc agtggatggg atcttggcgc 960

acggggaaag 970

<210> 16

<211> 971

<212> DNA

<213> Natural sequence

<220>

<223> 3' homology arm sequence

<400> 16

gaattataat actaacatta ctgaagaaaa tgcccaaaag atggtaagtt cttgaggcta 60

cccagggggt tattgattgc ttcttaaaga tcagaattac tgcctataaa actggataag 120

gaaatcatag agatctctca agtgtgagga tgagtgactg cctctgtagc tctgatccta 180

gtctcccaga tggctaaatt caattgacct tagagttcat ctggaaaatt gttatgaatg 240

aattatttgc ccagattcca aagatgagtg aaaatgttta ataaagttgc catcactatt 300

ctcattatat ttggtatgta aagcattcat ggaaatgttc taagtcgtta ttgagccaat 360

aattttcttt agcttataat gccaacaggt ctatccgaga actacaaatg acatattaac 420

tgaaaaatgc aactggggtt tactgaaggc agcagcttag taattaaggt aaccatggct 480

taggtgaaac tggacctggg aattccttct ttcattgaca cagagctctg aggaatttcc 540

aaaggtcaca gaagaaaagc tataattaaa ctagtcccaa aaaatctcag cctactctgg 600

gaaagcagca tattttgttt gacaagtgca aggacttaga actttttttt ttctcactga 660

tcctgaagtg ccttttaagt atagttaagt ggtggaaaat tgagcaacta tttaagaaaa 720

gactcttttt tttcttcttc cagcaatgct ttccttcaaa acggtagctt caaaacttcc 780

tgtcttttaa atgatcaggg ggctgtgtgt ttaaattatt gccattcata gaacagagtg 840

ggtctgagga tgcctgtttc ctttgaaatt ctatgccccc tcccagtttt ctaaaattta 900

agaaaccaca gagactttga caatgtagtt gccaaatgag ttgcttttaa ctgctctaat 960

agtttggtct t 971

<210> 17

<211> 1124

<212> DNA

<213> Natural sequence

<220>

<223> PGK-puro sequence

<400> 17

gggtagggga ggcgcttttc ccaaggcagt ctggagcatg cgctttagca gccccgctgg 60

gcacttggcg ctacacaagt ggcctctggc ctcgcacaca ttccacatcc cccggtaggc 120

gccaaccggc tccgttcttt ggtggcccct tcgcgccacc ttctactcct cccctagtca 180

ggaagttccc ccccgccccg cagctcgcgt cgtgcaggac gtgacaaatg gaagtagcac 240

gtctcactag tctcgtgcag atggacagca ccgctgagca atggaagcgg gtaggccttt 300

ggggcagcgg ccaatagcag ctttgctcct tcgctttctg ggctcagagg ctgggaaggg 360

gtgggtccgg gggcgggctc aggggcgggc tcaggggcgg ggcgggcgcc cgaaggtcct 420

ccggaggccc ggcattctgc acgcttcaaa agcgcacgtc tgccgcgctg ttctcctctt 480

cctcatctcc gggcctttcg acctgcagcc caagctagct taccatgacc gagtacaagc 540

ccacggtgcg cctcgccacc cgcgacgacg tccccagggc cgtacgcacc ctcgccgccg 600

cgttcgccga ctaccccgcc acgcgccaca ccgtcgatcc ggaccgccac atcgagcggg 660

tcaccgagct gcaagaactc ttcctcacgc gcgtcgggct cgacatcggc aaggtgtggg 720

tcgcggacga cggcgccgcg gtggcggtct ggaccacgcc ggagagcgtc gaagcggggg 780

cggtgttcgc cgagatcggc ccgcgcatgg ccgagttgag cggttcccgg ctggccgcgc 840

agcaacagat ggaaggcctc ctggcgccgc accggcccaa ggagcccgcg tggttcctgg 900

ccaccgtcgg cgtctcgccc gaccaccagg gcaagggtct gggcagcgcc gtcgtgctcc 960

ccggagtgga ggcggccgag cgcgccgggg tgcccgcctt cctggagacc tccgcgcccc 1020

gcaacctccc cttctacgag cggctcggct tcaccgtcac cgccgacgtc gaggtgcccg 1080

aaggaccgcg cacctggtgc atgacccgca agcccggtgc ctga 1124

<210> 18

<211> 34

<212> DNA

<213> Natural sequence

<220>

<223> Frt sequence

<400> 18

gaagttccta ttctctagaa agtataggaa cttc 34

<210> 19

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> 5arm-pcrF

<400> 19

tcgcacacat tccacatcca ccggtcccta tggagtggag aagagtctta 50

<210> 20

<211> 47

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> 5arm-pcrR

<400> 20

gaaggagcca ggaagagctt gacatctttc cccgtgcgcc aagatcc 47

<210> 21

<211> 47

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> hACE2-F

<400> 21

ggatcttggc gcacggggaa agatgtcaag ctcttcctgg ctccttc 47

<210> 22

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> hACE2-R

<400> 22

cattataagc tgcaataaac aagttctaaa aggaggtctg aacatcatc 49

<210> 23

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> SV40-F

<400> 23

gatgatgttc agacctcctt ttagaacttg tttattgcag cttataatg 49

<210> 24

<211> 48

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> SV40-R

<400> 24

agagaatagg aacttcgcac gcgttaagat acattgatga gtttggac 48

<210> 25

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> 3arm-pcrF

<400> 25

tacgaagtta tgtcgacgcg gcgcgccgaa ttataatact aacattactg 50

<210> 26

<211> 53

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> 3arm-pcrR

<400> 26

tatgaccatg attacgccaa gcttaagacc aaactattag agcagttaaa agc 53

<210> 27

<211> 8470

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> targeting vector sequence

<400> 27

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgta ccgggtaggg gaggcgcttt tcccaaggca gtctggagca tgcgctttag 240

cagccccgct gggcacttgg cgctacacaa gtggcctctg gcctcgcaca cattccacat 300

ccaccggtcc ctatggagtg gagaagagtc ttataatttt ttaaatgggc agagaaatga 360

atttattttt aatttttaga gacagggttt ctttgtatag ctctagctgt ctttgattgg 420

tagacaaagc tgtcctcaaa ctcagagatc ttccttcctt tgtctcctga gtgctgggat 480

taaaggcatg gaccaccact gccctgcccc attctctcca ttaattttaa gtgaatgctt 540

gcaaaagctc acttctttgg tgaacagctt cctttacaaa taagtacctt tgccttcgtt 600

tttataggat tcttaaaaag aaaaaaaaga ttcagccagg tggttgtggt gcacaccttt 660

aatcccagca gtcaggaggc agaggaaagc agatctcttg agtttgaggc tagcctagtc 720

tacagaggga gttccaggac agccaaggct acagagagga actgtctaaa aacaccaaga 780

aagagagaaa ggagagaggg agaggatgga tagcttattg atagaattgt cagaaaaggc 840

tataagttcc aatatgtgtc ccatgatttc taagtctagc cctttctgtt atagtaaaat 900

catagtacac cctcctcctc cagtgtatct ttaacagctt ttaaggaaca tattaactaa 960

atgtccaggt tttgatttgg ccataaaatg ttagcaaagc taaggttttc taggattaat 1020

gaataacatg tctttattta gtttacttaa aaaaatcatt ctaaaatatc tgtttacata 1080

tctgtcctct ccaggattaa cttcatattg gtccagcagc ttgtttactg ttctcttctg 1140

tttcttcttc tgcttttttt ttcttctctt ctcagtgccc aacccaagtt caaaggctga 1200

tgagagagaa aaactcatga agagatttta ctctagggaa agttgctcag tggatgggat 1260

cttggcgcac ggggaaagat gtcaagctct tcctggctcc ttctcagcct tgttgctgta 1320

actgctgctc agtccaccat tgaggaacag gccaagacat ttttggacaa gtttaaccac 1380

gaagccgaag acctgttcta tcaaagttca cttgcttctt ggaattataa caccaatatt 1440

actgaagaga atgtccaaaa catgaataat gctggggaca aatggtctgc ctttttaaag 1500

gaacagtcca cacttgccca aatgtatcca ctacaagaaa ttcagaatct cacagtcaag 1560

cttcagctgc aggctcttca gcaaaatggg tcttcagtgc tctcagaaga caagagcaaa 1620

cggttgaaca caattctaaa tacaatgagc accatctaca gtactggaaa agtttgtaac 1680

ccagataatc cacaagaatg cttattactt gaaccaggtt tgaatgaaat aatggcaaac 1740

agtttagact acaatgagag gctctgggct tgggaaagct ggagatctga ggtcggcaag 1800

cagctgaggc cattatatga agagtatgtg gtcttgaaaa atgagatggc aagagcaaat 1860

cattatgagg actatgggga ttattggaga ggagactatg aagtaaatgg ggtagatggc 1920

tatgactaca gccgcggcca gttgattgaa gatgtggaac atacctttga agagattaaa 1980

ccattatatg aacatcttca tgcctatgtg agggcaaagt tgatgaatgc ctatccttcc 2040

tatatcagtc caattggatg cctccctgct catttgcttg gtgatatgtg gggtagattt 2100

tggacaaatc tgtactcttt gacagttccc tttggacaga aaccaaacat agatgttact 2160

gatgcaatgg tggaccaggc ctgggatgca cagagaatat tcaaggaggc cgagaagttc 2220

tttgtatctg ttggtcttcc taatatgact caaggattct gggaaaattc catgctaacg 2280

gacccaggaa atgttcagaa agcagtctgc catcccacag cttgggacct ggggaagggc 2340

gacttcagga tccttatgtg cacaaaggtg acaatggacg acttcctgac agctcatcat 2400

gagatggggc atatccagta tgatatggca tatgctgcac aaccttttct gctaagaaat 2460

ggagctaatg aaggattcca tgaagctgtt ggggaaatca tgtcactttc tgcagccaca 2520

cctaagcatt taaaatccat tggtcttctg tcacccgatt ttcaagaaga caatgaaaca 2580

gaaataaact tcctgctcaa acaagcactc acgattgttg ggactctgcc atttacttac 2640

atgttagaga agtggaggtg gatggtcttt aaaggggaaa ttcccaaaga ccagtggatg 2700

aaaaagtggt gggagatgaa gcgagagata gttggggtgg tggaacctgt gccccatgat 2760

gaaacatact gtgaccccgc atctctgttc catgtttcta atgattactc attcattcga 2820

tattacacaa ggacccttta ccaattccag tttcaagaag cactttgtca agcagctaaa 2880

catgaaggcc ctctgcacaa atgtgacatc tcaaactcta cagaagctgg acagaaactg 2940

ttcaatatgc tgaggcttgg aaaatcagaa ccctggaccc tagcattgga aaatgttgta 3000

ggagcaaaga acatgaatgt aaggccactg ctcaactact ttgagccctt atttacctgg 3060

ctgaaagacc agaacaagaa ttcttttgtg ggatggagta ccgactggag tccatatgca 3120

gaccaaagca tcaaagtgag gataagccta aaatcagctc ttggagataa agcatatgaa 3180

tggaacgaca atgaaatgta cctgttccga tcatctgttg catatgctat gaggcagtac 3240

tttttaaaag taaaaaatca gatgattctt tttggggagg aggatgtgcg agtggctaat 3300

ttgaaaccaa gaatctcctt taatttcttt gtcactgcac ctaaaaatgt gtctgatatc 3360

attcctagaa ctgaagttga aaaggccatc aggatgtccc ggagccgtat caatgatgct 3420

ttccgtctga atgacaacag cctagagttt ctggggatac agccaacact tggacctcct 3480

aaccagcccc ctgtttccat atggctgatt gtttttggag ttgtgatggg agtgatagtg 3540

gttggcattg tcatcctgat cttcactggg atcagagatc ggaagaagaa aaataaagca 3600

agaagtggag aaaatcctta tgcctccatc gatattagca aaggagaaaa taatccagga 3660

ttccaaaaca ctgatgatgt tcagacctcc ttttagaact tgtttattgc agcttataat 3720

ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat 3780

tctagttgtg gtttgtccaa actcatcaat gtatcttaac gcgtgcgaag ttcctattct 3840

ctagaaagta taggaacttc atcgataccg ggtaggggag gcgcttttcc caaggcagtc 3900

tggagcatgc gctttagcag ccccgctggg cacttggcgc tacacaagtg gcctctggcc 3960

tcgcacacat tccacatccc ccggtaggcg ccaaccggct ccgttctttg gtggcccctt 4020

cgcgccacct tctactcctc ccctagtcag gaagttcccc cccgccccgc agctcgcgtc 4080

gtgcaggacg tgacaaatgg aagtagcacg tctcactagt ctcgtgcaga tggacagcac 4140

cgctgagcaa tggaagcggg taggcctttg gggcagcggc caatagcagc tttgctcctt 4200

cgctttctgg gctcagaggc tgggaagggg tgggtccggg ggcgggctca ggggcgggct 4260

caggggcggg gcgggcgccc gaaggtcctc cggaggcccg gcattctgca cgcttcaaaa 4320

gcgcacgtct gccgcgctgt tctcctcttc ctcatctccg ggcctttcga cctgcagccc 4380

aagctagctt accatgaccg agtacaagcc cacggtgcgc ctcgccaccc gcgacgacgt 4440

ccccagggcc gtacgcaccc tcgccgccgc gttcgccgac taccccgcca cgcgccacac 4500

cgtcgatccg gaccgccaca tcgagcgggt caccgagctg caagaactct tcctcacgcg 4560

cgtcgggctc gacatcggca aggtgtgggt cgcggacgac ggcgccgcgg tggcggtctg 4620

gaccacgccg gagagcgtcg aagcgggggc ggtgttcgcc gagatcggcc cgcgcatggc 4680

cgagttgagc ggttcccggc tggccgcgca gcaacagatg gaaggcctcc tggcgccgca 4740

ccggcccaag gagcccgcgt ggttcctggc caccgtcggc gtctcgcccg accaccaggg 4800

caagggtctg ggcagcgccg tcgtgctccc cggagtggag gcggccgagc gcgccggggt 4860

gcccgccttc ctggagacct ccgcgccccg caacctcccc ttctacgagc ggctcggctt 4920

caccgtcacc gccgacgtcg aggtgcccga aggaccgcgc acctggtgca tgacccgcaa 4980

gcccggtgcc tgaggtacct ctcatgctgg agttcttcgc ccaccccaac ttgtttattg 5040

cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt 5100

tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat catcgatgaa 5160

gttcctattc tctagaaagt ataggaactt ctaacctccc gggtgacaga taacttcgta 5220

taatgtatgc tatacgaagt tatgtcgacg cggcgcgccg aattataata ctaacattac 5280

tgaagaaaat gcccaaaaga tggtaagttc ttgaggctac ccagggggtt attgattgct 5340

tcttaaagat cagaattact gcctataaaa ctggataagg aaatcataga gatctctcaa 5400

gtgtgaggat gagtgactgc ctctgtagct ctgatcctag tctcccagat ggctaaattc 5460

aattgacctt agagttcatc tggaaaattg ttatgaatga attatttgcc cagattccaa 5520

agatgagtga aaatgtttaa taaagttgcc atcactattc tcattatatt tggtatgtaa 5580

agcattcatg gaaatgttct aagtcgttat tgagccaata attttcttta gcttataatg 5640

ccaacaggtc tatccgagaa ctacaaatga catattaact gaaaaatgca actggggttt 5700

actgaaggca gcagcttagt aattaaggta accatggctt aggtgaaact ggacctggga 5760

attccttctt tcattgacac agagctctga ggaatttcca aaggtcacag aagaaaagct 5820

ataattaaac tagtcccaaa aaatctcagc ctactctggg aaagcagcat attttgtttg 5880

acaagtgcaa ggacttagaa cttttttttt tctcactgat cctgaagtgc cttttaagta 5940

tagttaagtg gtggaaaatt gagcaactat ttaagaaaag actctttttt ttcttcttcc 6000

agcaatgctt tccttcaaaa cggtagcttc aaaacttcct gtcttttaaa tgatcagggg 6060

gctgtgtgtt taaattattg ccattcatag aacagagtgg gtctgaggat gcctgtttcc 6120

tttgaaattc tatgccccct cccagttttc taaaatttaa gaaaccacag agactttgac 6180

aatgtagttg ccaaatgagt tgcttttaac tgctctaata gtttggtctt aagcttggcg 6240

taatcatggt catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac 6300

atacgagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca 6360

ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat 6420

taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc 6480

tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca 6540

aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 6600

aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 6660

ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 6720

acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt 6780

ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 6840

tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 6900

tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt 6960

gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 7020

agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 7080

tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 7140

agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt 7200

tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct 7260

acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 7320

tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa 7380

agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc 7440

tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact 7500

acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc 7560

tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt 7620

ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta 7680

agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg 7740

tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt 7800

acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc 7860

agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 7920

actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 7980

tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc 8040

gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 8100

ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac 8160

tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa 8220

aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 8280

tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 8340

tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 8400

gacgtctaag aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg 8460

ccctttcgtc 8470

<210> 28

<211> 19

<212> DNA

<213> Natural sequence

<220>

<223> Puro-F

<400> 28

aacctcccct tctacgagc 19

<210> 29

<211> 24

<212> DNA

<213> Natural sequence

<220>

<223> 3arm-outR

<400> 29

tacagccagg atctggatgt cagc 24

<210> 30

<211> 5922

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> murine embryonic stem cell Ace2 site genome replacement sequence

<400> 30

ccctatggag tggagaagag tcttataatt ttttaaatgg gcagagaaat gaatttattt 60

ttaattttta gagacagggt ttctttgtat agctctagct gtctttgatt ggtagacaaa 120

gctgtcctca aactcagaga tcttccttcc tttgtctcct gagtgctggg attaaaggca 180

tggaccacca ctgccctgcc ccattctctc cattaatttt aagtgaatgc ttgcaaaagc 240

tcacttcttt ggtgaacagc ttcctttaca aataagtacc tttgccttcg tttttatagg 300

attcttaaaa agaaaaaaaa gattcagcca ggtggttgtg gtgcacacct ttaatcccag 360

cagtcaggag gcagaggaaa gcagatctct tgagtttgag gctagcctag tctacagagg 420

gagttccagg acagccaagg ctacagagag gaactgtcta aaaacaccaa gaaagagaga 480

aaggagagag ggagaggatg gatagcttat tgatagaatt gtcagaaaag gctataagtt 540

ccaatatgtg tcccatgatt tctaagtcta gccctttctg ttatagtaaa atcatagtac 600

accctcctcc tccagtgtat ctttaacagc ttttaaggaa catattaact aaatgtccag 660

gttttgattt ggccataaaa tgttagcaaa gctaaggttt tctaggatta atgaataaca 720

tgtctttatt tagtttactt aaaaaaatca ttctaaaata tctgtttaca tatctgtcct 780

ctccaggatt aacttcatat tggtccagca gcttgtttac tgttctcttc tgtttcttct 840

tctgcttttt ttttcttctc ttctcagtgc ccaacccaag ttcaaaggct gatgagagag 900

aaaaactcat gaagagattt tactctaggg aaagttgctc agtggatggg atcttggcgc 960

acggggaaag atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc 1020

tcagtccacc attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga 1080

agacctgttc tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga 1140

gaatgtccaa aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc 1200

cacacttgcc caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct 1260

gcaggctctt cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa 1320

cacaattcta aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa 1380

tccacaagaa tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga 1440

ctacaatgag aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag 1500

gccattatat gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga 1560

ggactatggg gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta 1620

cagccgcggc cagttgattg aagatgtgga acataccttt gaagagatta aaccattata 1680

tgaacatctt catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag 1740

tccaattgga tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa 1800

tctgtactct ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat 1860

ggtggaccag gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc 1920

tgttggtctt cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg 1980

aaatgttcag aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag 2040

gatccttatg tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg 2100

gcatatccag tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa 2160

tgaaggattc catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca 2220

tttaaaatcc attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa 2280

cttcctgctc aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga 2340

gaagtggagg tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg 2400

gtgggagatg aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata 2460

ctgtgacccc gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac 2520

aaggaccctt taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg 2580

ccctctgcac aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat 2640

gctgaggctt ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa 2700

gaacatgaat gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga 2760

ccagaacaag aattcttttg tgggatggag taccgactgg agtccatatg cagaccaaag 2820

catcaaagtg aggataagcc taaaatcagc tcttggagat aaagcatatg aatggaacga 2880

caatgaaatg tacctgttcc gatcatctgt tgcatatgct atgaggcagt actttttaaa 2940

agtaaaaaat cagatgattc tttttgggga ggaggatgtg cgagtggcta atttgaaacc 3000

aagaatctcc tttaatttct ttgtcactgc acctaaaaat gtgtctgata tcattcctag 3060

aactgaagtt gaaaaggcca tcaggatgtc ccggagccgt atcaatgatg ctttccgtct 3120

gaatgacaac agcctagagt ttctggggat acagccaaca cttggacctc ctaaccagcc 3180

ccctgtttcc atatggctga ttgtttttgg agttgtgatg ggagtgatag tggttggcat 3240

tgtcatcctg atcttcactg ggatcagaga tcggaagaag aaaaataaag caagaagtgg 3300

agaaaatcct tatgcctcca tcgatattag caaaggagaa aataatccag gattccaaaa 3360

cactgatgat gttcagacct ccttttagaa cttgtttatt gcagcttata atggttacaa 3420

ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg 3480

tggtttgtcc aaactcatca atgtatctta acgcgtgcga agttcctatt ctctagaaag 3540

tataggaact tcatcgatac cgggtagggg aggcgctttt cccaaggcag tctggagcat 3600

gcgctttagc agccccgctg ggcacttggc gctacacaag tggcctctgg cctcgcacac 3660

attccacatc ccccggtagg cgccaaccgg ctccgttctt tggtggcccc ttcgcgccac 3720

cttctactcc tcccctagtc aggaagttcc cccccgcccc gcagctcgcg tcgtgcagga 3780

cgtgacaaat ggaagtagca cgtctcacta gtctcgtgca gatggacagc accgctgagc 3840

aatggaagcg ggtaggcctt tggggcagcg gccaatagca gctttgctcc ttcgctttct 3900

gggctcagag gctgggaagg ggtgggtccg ggggcgggct caggggcggg ctcaggggcg 3960

gggcgggcgc ccgaaggtcc tccggaggcc cggcattctg cacgcttcaa aagcgcacgt 4020

ctgccgcgct gttctcctct tcctcatctc cgggcctttc gacctgcagc ccaagctagc 4080

ttaccatgac cgagtacaag cccacggtgc gcctcgccac ccgcgacgac gtccccaggg 4140

ccgtacgcac cctcgccgcc gcgttcgccg actaccccgc cacgcgccac accgtcgatc 4200

cggaccgcca catcgagcgg gtcaccgagc tgcaagaact cttcctcacg cgcgtcgggc 4260

tcgacatcgg caaggtgtgg gtcgcggacg acggcgccgc ggtggcggtc tggaccacgc 4320

cggagagcgt cgaagcgggg gcggtgttcg ccgagatcgg cccgcgcatg gccgagttga 4380

gcggttcccg gctggccgcg cagcaacaga tggaaggcct cctggcgccg caccggccca 4440

aggagcccgc gtggttcctg gccaccgtcg gcgtctcgcc cgaccaccag ggcaagggtc 4500

tgggcagcgc cgtcgtgctc cccggagtgg aggcggccga gcgcgccggg gtgcccgcct 4560

tcctggagac ctccgcgccc cgcaacctcc ccttctacga gcggctcggc ttcaccgtca 4620

ccgccgacgt cgaggtgccc gaaggaccgc gcacctggtg catgacccgc aagcccggtg 4680

cctgaggtac ctctcatgct ggagttcttc gcccacccca acttgtttat tgcagcttat 4740

aatggttaca aataaagcaa tagcatcaca aatttcacaa ataaagcatt tttttcactg 4800

cattctagtt gtggtttgtc caaactcatc aatgtatctt atcatcgatg aagttcctat 4860

tctctagaaa gtataggaac ttctaacctc ccgggtgaca gataacttcg tataatgtat 4920

gctatacgaa gttatgtcga cgcggcgcgc cgaattataa tactaacatt actgaagaaa 4980

atgcccaaaa gatggtaagt tcttgaggct acccaggggg ttattgattg cttcttaaag 5040

atcagaatta ctgcctataa aactggataa ggaaatcata gagatctctc aagtgtgagg 5100

atgagtgact gcctctgtag ctctgatcct agtctcccag atggctaaat tcaattgacc 5160

ttagagttca tctggaaaat tgttatgaat gaattatttg cccagattcc aaagatgagt 5220

gaaaatgttt aataaagttg ccatcactat tctcattata tttggtatgt aaagcattca 5280

tggaaatgtt ctaagtcgtt attgagccaa taattttctt tagcttataa tgccaacagg 5340

tctatccgag aactacaaat gacatattaa ctgaaaaatg caactggggt ttactgaagg 5400

cagcagctta gtaattaagg taaccatggc ttaggtgaaa ctggacctgg gaattccttc 5460

tttcattgac acagagctct gaggaatttc caaaggtcac agaagaaaag ctataattaa 5520

actagtccca aaaaatctca gcctactctg ggaaagcagc atattttgtt tgacaagtgc 5580

aaggacttag aacttttttt tttctcactg atcctgaagt gccttttaag tatagttaag 5640

tggtggaaaa ttgagcaact atttaagaaa agactctttt ttttcttctt ccagcaatgc 5700

tttccttcaa aacggtagct tcaaaacttc ctgtctttta aatgatcagg gggctgtgtg 5760

tttaaattat tgccattcat agaacagagt gggtctgagg atgcctgttt cctttgaaat 5820

tctatgcccc ctcccagttt tctaaaattt aagaaaccac agagactttg acaatgtagt 5880

tgccaaatga gttgctttta actgctctaa tagtttggtc tt 5922

<210> 31

<211> 19

<212> DNA

<213> Natural sequence

<220>

<223> hACE2-F

<400> 31

tgatagtggt tggcattgt 19

<210> 32

<211> 4591

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> deletion of the mouse embryonic Stem cell Ace2 site genome substitution sequence after PGK-puro

<400> 32

ccctatggag tggagaagag tcttataatt ttttaaatgg gcagagaaat gaatttattt 60

ttaattttta gagacagggt ttctttgtat agctctagct gtctttgatt ggtagacaaa 120

gctgtcctca aactcagaga tcttccttcc tttgtctcct gagtgctggg attaaaggca 180

tggaccacca ctgccctgcc ccattctctc cattaatttt aagtgaatgc ttgcaaaagc 240

tcacttcttt ggtgaacagc ttcctttaca aataagtacc tttgccttcg tttttatagg 300

attcttaaaa agaaaaaaaa gattcagcca ggtggttgtg gtgcacacct ttaatcccag 360

cagtcaggag gcagaggaaa gcagatctct tgagtttgag gctagcctag tctacagagg 420

gagttccagg acagccaagg ctacagagag gaactgtcta aaaacaccaa gaaagagaga 480

aaggagagag ggagaggatg gatagcttat tgatagaatt gtcagaaaag gctataagtt 540

ccaatatgtg tcccatgatt tctaagtcta gccctttctg ttatagtaaa atcatagtac 600

accctcctcc tccagtgtat ctttaacagc ttttaaggaa catattaact aaatgtccag 660

gttttgattt ggccataaaa tgttagcaaa gctaaggttt tctaggatta atgaataaca 720

tgtctttatt tagtttactt aaaaaaatca ttctaaaata tctgtttaca tatctgtcct 780

ctccaggatt aacttcatat tggtccagca gcttgtttac tgttctcttc tgtttcttct 840

tctgcttttt ttttcttctc ttctcagtgc ccaacccaag ttcaaaggct gatgagagag 900

aaaaactcat gaagagattt tactctaggg aaagttgctc agtggatggg atcttggcgc 960

acggggaaag atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc 1020

tcagtccacc attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga 1080

agacctgttc tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga 1140

gaatgtccaa aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc 1200

cacacttgcc caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct 1260

gcaggctctt cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa 1320

cacaattcta aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa 1380

tccacaagaa tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga 1440

ctacaatgag aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag 1500

gccattatat gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga 1560

ggactatggg gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta 1620

cagccgcggc cagttgattg aagatgtgga acataccttt gaagagatta aaccattata 1680

tgaacatctt catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag 1740

tccaattgga tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa 1800

tctgtactct ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat 1860

ggtggaccag gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc 1920

tgttggtctt cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg 1980

aaatgttcag aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag 2040

gatccttatg tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg 2100

gcatatccag tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa 2160

tgaaggattc catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca 2220

tttaaaatcc attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa 2280

cttcctgctc aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga 2340

gaagtggagg tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg 2400

gtgggagatg aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata 2460

ctgtgacccc gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac 2520

aaggaccctt taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg 2580

ccctctgcac aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat 2640

gctgaggctt ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa 2700

gaacatgaat gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga 2760

ccagaacaag aattcttttg tgggatggag taccgactgg agtccatatg cagaccaaag 2820

catcaaagtg aggataagcc taaaatcagc tcttggagat aaagcatatg aatggaacga 2880

caatgaaatg tacctgttcc gatcatctgt tgcatatgct atgaggcagt actttttaaa 2940

agtaaaaaat cagatgattc tttttgggga ggaggatgtg cgagtggcta atttgaaacc 3000

aagaatctcc tttaatttct ttgtcactgc acctaaaaat gtgtctgata tcattcctag 3060

aactgaagtt gaaaaggcca tcaggatgtc ccggagccgt atcaatgatg ctttccgtct 3120

gaatgacaac agcctagagt ttctggggat acagccaaca cttggacctc ctaaccagcc 3180

ccctgtttcc atatggctga ttgtttttgg agttgtgatg ggagtgatag tggttggcat 3240

tgtcatcctg atcttcactg ggatcagaga tcggaagaag aaaaataaag caagaagtgg 3300

agaaaatcct tatgcctcca tcgatattag caaaggagaa aataatccag gattccaaaa 3360

cactgatgat gttcagacct ccttttagaa cttgtttatt gcagcttata atggttacaa 3420

ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg 3480

tggtttgtcc aaactcatca atgtatctta acgcgtgcga agttcctatt ctctagaaag 3540

tataggaact tctaacctcc cgggtgacag ataacttcgt ataatgtatg ctatacgaag 3600

ttatgtcgac gcggcgcgcc gaattataat actaacatta ctgaagaaaa tgcccaaaag 3660

atggtaagtt cttgaggcta cccagggggt tattgattgc ttcttaaaga tcagaattac 3720

tgcctataaa actggataag gaaatcatag agatctctca agtgtgagga tgagtgactg 3780

cctctgtagc tctgatccta gtctcccaga tggctaaatt caattgacct tagagttcat 3840

ctggaaaatt gttatgaatg aattatttgc ccagattcca aagatgagtg aaaatgttta 3900

ataaagttgc catcactatt ctcattatat ttggtatgta aagcattcat ggaaatgttc 3960

taagtcgtta ttgagccaat aattttcttt agcttataat gccaacaggt ctatccgaga 4020

actacaaatg acatattaac tgaaaaatgc aactggggtt tactgaaggc agcagcttag 4080

taattaaggt aaccatggct taggtgaaac tggacctggg aattccttct ttcattgaca 4140

cagagctctg aggaatttcc aaaggtcaca gaagaaaagc tataattaaa ctagtcccaa 4200

aaaatctcag cctactctgg gaaagcagca tattttgttt gacaagtgca aggacttaga 4260

actttttttt ttctcactga tcctgaagtg ccttttaagt atagttaagt ggtggaaaat 4320

tgagcaacta tttaagaaaa gactcttttt tttcttcttc cagcaatgct ttccttcaaa 4380

acggtagctt caaaacttcc tgtcttttaa atgatcaggg ggctgtgtgt ttaaattatt 4440

gccattcata gaacagagtg ggtctgagga tgcctgtttc ctttgaaatt ctatgccccc 4500

tcccagtttt ctaaaattta agaaaccaca gagactttga caatgtagtt gccaaatgag 4560

ttgcttttaa ctgctctaat agtttggtct t 4591

<210> 33

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> hACE2-qF

<400> 33

ggtcttcagt gctctcag 18

<210> 34

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> hACE2-qR

<400> 34

gcattcttgt ggattatctg g 21

<210> 35

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Forward primer

<400> 35

ggggaacttc tcctgctaga at 22

<210> 36

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> reverse primer

<400> 36

cagacatttt gctctcaagc tg 22

<210> 37

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> TaqMan probes

<400> 37

ttgctgctgc ttgacagatt 20

Claims

1. The sgRNA is characterized in that the sequence of the sgRNA is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

2. The sgRNA of claim 1, wherein the sequence of the primers upstream and downstream of the synthesis of the sgRNA of SEQ ID NO. 2 is shown as SEQ ID NO. 4 and SEQ ID NO. 5, respectively.

3. The sgRNA of claim 1, wherein the sequences of the primers upstream and downstream of the synthesis of the sgRNA of SEQ ID No. 1 are shown in SEQ ID No. 6 and SEQ ID No. 7, respectively.

4. The sgRNA of claim 1, wherein the sgRNA-targeted gene is an animal ACE2 gene for site-directed cleavage of the ACE2 gene.

5. The sgRNA of claim 1, wherein the sgRNA is used to construct a humanized animal model.

6. The sgRNA of claim 1, wherein the target point of the sgRNA is located on exon 1 of the ACE2 gene of the animal.

7. The sgRNA of claim 6, wherein the target is within 140bp of the 5' utr of the ACE2 gene of the animal.

8. The sgRNA of any one of claims 4 to 7, wherein the animal is a mammal.

9. The sgRNA of claim 8, wherein the mammal is a rodent.

10. The sgRNA of claim 9, wherein the rodent is a mouse.

11. A carrier assembly, the carrier assembly comprising: (1) A vector comprising the sgRNA of any one of claims 1-10; (2) A targeting vector comprising a 5 'homology arm, a human ACE2 gene fragment, an SV40 polyA sequence, and a 3' homology arm; the targeting vector targets an animal ACE2 gene, the animal ACE2 gene comprising a target corresponding to the sgRNA of any one of claims 1 to 10.

12. The vector combination of claim 11, wherein the 5' homology arm is a 5' homology arm homologous to a 5' target sequence at a genomic locus of interest.

13. The vector combination of claim 12, wherein the targeting vector is used to initiate expression of a human gene of interest using an animal gene promoter after insertion of the CDS sequence of the human gene into the promoter and 5' utr region sequences of the animal gene.

14. The vector combination of claim 12, wherein the 3' homology arm is a 3' homology arm that is homologous to a 3' target sequence at a genomic locus of interest.

15. The vector combination of claim 14, wherein the targeting vector further comprises the screening marker PGK-Puro.

16. The carrier combination of claim 11, wherein the animal is a mammal.

17. The vector combination of claim 16, wherein the mammal is a rodent.

18. The vector combination of claim 13, wherein the animal is a mouse.

19. A DNA molecule encoding the sgRNA of any one of claims 1-10.

20. A cell comprising the sgRNA of any one of claims 1-10 or the targeting vector of any one of claims 11-18 or the DNA molecule of claim 19, said cell being incapable of developing into an animal subject, said cell excluding germ cells.

21. Use of the sgRNA of any one of claims 1 to 10 for the preparation of a genetically humanized cell line or a genetically humanized animal model, said animal being a mouse.

22. The use of claim 21, wherein the gene is ACE2.

23. A method for constructing a humanized animal cell line, wherein the sgRNA of any one of claims 1 to 10 is used in the method, the method comprising the steps of: (1) Constructing a targeting vector according to any one of the claims 11-18; (2) Introducing the constructed targeting vector and the vector with the sgRNA of any one of claims 1 to 10 attached thereto into embryonic stem cells of animal origin; (3) Culturing the embryonic stem cells in the step (2) into clones to obtain the embryonic stem cells; the animals were mice.

24. The method of claim 23, comprising introducing a human gene of interest into the animal cell such that the gene of interest expresses the CDS of the full length human gene of interest in situ within the animal cell.

25. The method of claim 24, wherein the gene of interest is ACE2.

26. The method of claim 23, wherein the method uses gene editing techniques for the construction of the humanized animal cell model.

27. The method of claim 26, wherein the gene editing technique comprises an embryonic stem cell-based DNA homologous recombination technique, a CRISPR/Cas9 technique.

28. The ACE2 gene humanized animal cell line produced by the method of any one of claims 23-27, which is incapable of developing into an animal subject, said cells not comprising germ cells.

29. A method of constructing a genetically humanized animal model comprising injecting the animal cell of claim 28 into an animal.

30. The method of claim 29, comprising forming the animal cells into an animal subject by tetraploid compensation or blastocyst injection.

31. A tissue, body fluid, cell or a fragment thereof or an extract thereof of a humanized mouse, or a tissue, body fluid, cell or a fragment thereof or an extract thereof of a humanized offspring of a humanized mouse, wherein the humanized mouse is constructed using the method of any one of claims 29-30, wherein the cell or tissue is incapable of developing into an animal subject, and wherein the cell does not comprise germ cells.

32. Use of a humanized animal model or a progeny thereof derived from the construction method of any one of claims 29-30 for the manufacture of human antibodies, or as a model system for pharmacological, immunological, microbiological and medical research, or for the production of animal experimental disease models for etiology research and/or for the development of new diagnostic and/or therapeutic strategies, or for screening, validating, evaluating or studying ACE2 gene function, ACE2 antibodies, drugs against ACE2 targets, pharmacodynamic research.