AU2020102457A4 - Recombinant plasmid pmdmcherry, construction method of recombinant plasmid pmdmcherry, and method for labeling edwardsiella ictaluri by mcheey fluorescent protein genes - Google Patents
Recombinant plasmid pmdmcherry, construction method of recombinant plasmid pmdmcherry, and method for labeling edwardsiella ictaluri by mcheey fluorescent protein genes Download PDFInfo
- Publication number
- AU2020102457A4 AU2020102457A4 AU2020102457A AU2020102457A AU2020102457A4 AU 2020102457 A4 AU2020102457 A4 AU 2020102457A4 AU 2020102457 A AU2020102457 A AU 2020102457A AU 2020102457 A AU2020102457 A AU 2020102457A AU 2020102457 A4 AU2020102457 A4 AU 2020102457A4
- Authority
- AU
- Australia
- Prior art keywords
- pmdmcherry
- recombinant plasmid
- seq
- fluorescent protein
- construction method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5091—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing the pathological state of an organism
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Urology & Nephrology (AREA)
- Plant Pathology (AREA)
- Hematology (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Toxicology (AREA)
- Cell Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Physiology (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a recombinant plasmid pMDMcherry, a
construction method of the recombinant plasmid pMDMcherry, and a method for
labeling Edwardsiella ictaluri by Mcherry fluorescent protein genes. The
recombinant plasmid pMDMcherry has a base sequence shown as SEQ ID NO:7.
When a pMDMcherry recombinant vector is introduced into the Edwardsiella
ictaluri, the Edwardsiella ictaluri presents red fluorescence when observed under a
fluorescence microscope. Stability tests show that, when the recombinant bacteria
perform passage to the 25t generation, plasmid stability may be 100%.
Introduction of the Mcherry fluorescent protein genes provides a simple and
intuitive method for researching interaction between the Edwardsiella ictaluri and
a host.
Drawings of Description
pR romote,
PMDMcherry
3720 bp
Orylac prfo
FIG. 1
1
Description
Drawings of Description
pR romote,
PMDMcherry 3720 bp
Orylac prfo
FIG. 1
Description
Technical Field
The present invention belongs to the technical field of biological monitoring, particularly relates to a recombinant plasmid pMDMcherry, a construction method of the recombinant plasmid pMDMcherry, and a method for labeling Edwardsiella ictaluriby Mcherry fluorescent protein genes.
Background
Zebra fish is an emerging model animal that develops in recent dozen years. As a vertebrate, the zebra fish has many unattainable advantages relative to mice as follows: the zebra fish is small in volume and low in breeding and maintaining cost; the zebra fish is short in reproductive cycle and large in egg laying amount; and more importantly, an embryo of the zebra fish is fertilized in vitro, and a development process may be directly and continuously observed. The zebra fish serving as an infection model of infectious diseases is increasingly favored by pathogenic microbiologists. Edwardsiella ictaluri is a bacterium of Edwardsiella Ewing and McWhorter in Enterobacteriaceae. Hawke first discovered that Ictalurus punctatus was infected with the Edwardsiella ictaluri in 1979. At present, it has been successively found that, fishes are infected with the Edwardsiella ictaluri to contract diseases in Australia, Thailand, Vietnam, Japan and China. Infected objects include Silurus soldatovi meridionalis Chen, Ictalurus punctatus, Pelteobagrusfulvidraco, Plotosus anguillaris and Tilapia mossambica, and have higher incidence rates and death rates, thereby seriously affecting development of
Description
the aquaculture industry. At present, study on pathogenesis of the Edwardsiella ictaluri is less reported in China, while a relationship between bacteria and a host is inevitably involved while studying the bacterium pathogenesis. Using marker genes is an effective means of monitoring growth and reproduction of the bacteria in the host and interaction between the bacteria and the host.
Summary
In view of this, to overcome defects in the prior art, the present invention provides a recombinant plasmid pMDMcherry, a construction method of the recombinant plasmid pMDMcherry, and a method for labeling Edwardsiella ictaluriby Mcherry fluorescent protein genes. To achieve the above purpose of the present invention, technical solutions of the present invention are as follows: The recombinant plasmid pMDMcherry has a base sequence shown as SEQ ID NO:7. The present invention further provides a construction method of the recombinant plasmid pMDMcherry. The construction method includes the following steps: (1) taking a plasmid PRUAL as a template; taking SEQ ID No:1 and SEQ ID No:2 as primers; and performing PCR amplification to obtain a promoter fragment having a sequence number of SEQ ID NO:3; (2) taking a plasmid pLVX-PAmCherry-C1 as a template; taking SEQ ID No:4 and SEQ ID No:5 as primers; and performing PCR amplification to obtain a Mcherry fluorescent protein Mcherry fragment having a sequence number of SEQ ID NO:6;
Description
(3) mixing the promoter fragment in the step (1) and the Mcherry fluorescent protein Mcherry fragment in the step (2) to serve as a template; taking SEQ ID No:1 and SEQ ID No:5 as primers; and performing PCR amplification; (4) ligating a PCR product in the step (3) with a cloning vector, i.e., pMD18-T Vector; and performing sequencing identification after transformation, thereby obtaining the recombinant plasmid pMDMcherry having a sequence number of SEQ ID No:7. In some embodiments, a volume ratio of the promoter fragment in the step (1) to the Mcherry fluorescent protein Mcherry fragment in the step (2) is 1:1. In some embodiments, in the steps (1) to (3), a reaction system of the PCR amplification is totally 100 pl, including 20 pl of 5xbuffer, 8 pl of dNTPs, 2 pl of primersense, 2 pl of antisense, 1I l of templet, 1I l of Primerstar, and the balance of H 2 0. In some embodiments, in the steps (1) to (3), reaction procedures of the PCR amplification are as follows: the temperature is maintained at 95°C for 2 min; the temperature is maintained at 95°C for 30 s, at 50°C for 30 s and at 72°C for 30 s; totally 30 cycles are conducted; and the temperature is maintained at 72°C for 10 min. In some embodiments, in the step (4), a reaction system of the ligation reaction is totally 20 pl, including 2 pl of 10xbuffer, 5 pl of templet 1, 5 pl of templet 2, 5 pl of templet 3, 0.5 pl of T4 ligase and the balance of H 2 0. The present invention further provides a method for labeling Edwardsiella ictaluriby Mcherry fluorescent protein genes, including the following steps: (1) separating Edwardsiellaictaluri from a diseased zebra fish body; (2) preparing Edwardsiella ictaluricompetence; (3) transferring the recombinant plasmid pMDMcherry into the prepared Edwardsiellaictaluricompetence, thereby obtaining the product.
Description
Compared with the prior art, the present invention has beneficial effects as follows: 1. The Mcherry fluorescent protein can be self-catalyzed to form a chromophoric structure and emit red fluorescence when excited by blue light. As a reporter gene, Mcherry is a luminescent protein that can be expressed in living cells without an exogenous substrate or a cofactor. The Mcherry serving as a fluorescent labeled molecule has a sensitive marker detection rate and also has no radiological hazard. Therefore, a condition that labeled strains can be detected in vivo in real time can be realized; and bacterium tracking study can be well conducted. In the present invention, the recombinant plasmid pMDMcherry is prepared by virtue of ingenious primer design. 2. In the present invention, a Mcherry-labeled Edwardsiella ictaluri virulent strain is constructed by transferring the constructed recombinant plasmid pMDMcherry into the prepared Edwardsiellaictaluri competence; thus, a dynamic process that the host is infected with the Edwardsiella ictaluri is conveniently observed by a fluorescence microscope, thereby realizing fluorescent strain observation. The method is simple and intuitive, lays the foundation for researching the interaction between the Edwardsiella ictaluri and the host, and greatly decreases experimental cost. Meanwhile, quality stability is extremely high. 3. The Edwardsiella ictaluri strain used in the present invention is separated from the diseased zebra fish body and has higher pathogenicity on the zebra fish. The infection experiment study of the strain conducted by taking the model animal, i.e., the zebra fish, as the experimental animal has a greater advantage of knowing the pathogenesis of the Edwardsiellaictaluri.
Description of Drawings
To clearly describe technical solutions in the embodiments of the present invention or in the prior art, drawings to be used in descriptions of the
Description
embodiments or the prior art will be briefly introduced below. Apparently, the drawings described below are merely part of the embodiments of the present invention. All other drawings may be obtained by those ordinary skilled in the art without contributing creative labor in accordance with these drawings. Fig. 1 is a schematic diagram of steps of constructing a plasmid pMDMcherry in Embodiment 1 of the present invention; and Fig. 2 is a fluorescent protein observed under a microscope in Embodiment 2 of the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and fully described below in combination with drawings in the embodiments of the present invention. Apparently, the described embodiments are merely part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those ordinary skilled in the art without contributing creative labor will belong to the protection scope of the present invention. Embodiment 1 Construction method of a recombinant plasmid pMDMcherry The construction method of the recombinant plasmid pMDMcherry in the present embodiment includes the following steps: (1) Preparation of promoter fragment A plasmid PRUAL was taken as a template; ppS (SEQ ID No:1) and ppA (SEQ ID No:2) were taken as forward and reverse primers; a PCR reaction was carried out according to a conventional method; and a PCR product was subjected to 1% agarose electrophoresis and subjected to gel extraction by a Gel Extraction Kit (Tiangen Biotechnology (Beijing) Co., Ltd.) so as to obtain a promoter fragment having a sequence number of SEQ ID NO:3, wherein the PCR reaction
Description
system was shown as Table 1, and PCR reaction conditions were shown as Table 2: ppS: 5'CGCCTAGGATACGCACACCGTGGAAAC3'(SEQ ID No:1) ppA: 5'CCTTGCTCACCATTTTTTCTTCCTCCA3'(SEQ ID No:2). Table 1 PCR amplification system
Reactant System (pl)
5xbuffer 20 dNTPs 8 primersense 2 antisense 2 templet 1 Primerstar 1 H2O to 100
Table 2 PCR amplification procedures
Step Temperature (C) Reaction time Number of cycles (piece)
1 95 2 min 1
2 95 30s 30 3 50 30s 30 4 72 30s 30
5 72 10 min 1
6 4 Pause 1
(2) Preparation ofMCHERRY fragment:
Description
A plasmid PLVX-PAMCHERRY-C1 VECTOR (TaKaRa Company) was taken as a template; MCS (SEQ ID No:4) and MCA (SEQ ID No:5) were taken as forward and reverse primers; a PCR reaction was carried out according to a conventional method; and a PCR product was subjected to 1% agarose electrophoresis and subjected to gel extraction by a Gel Extraction Kit so as to obtain a MCHEEY fragment having a sequence number of SEQ ID NO:6, wherein the PCR reaction system was shown as Table 1, and PCR reaction conditions were shown as Table 2: MCS: 5'AGGAAGAAAAAATGGTGAGCAAGGGCGA3'(SEQ ID No:4) MCA: 5'GCGTTCGAATTACTACTTGTACAGCT3'(SEQ ID No:5).
(3) Ligation of the promoter and MCHEEY
Since the primers ppA and MCS have a repeated sequence during design, the PCR amplification promoter fragment and the MCHEEY fragment thereof also have a repeated sequence. Thus, the promoter and MCHEEY fragments are conveniently ligated by a PCR method. The recovered promoter and MCHEEY fragments are mixed according to a ratio of 1:1 to serve as a template; ppS (SEQ ID No:1) and MCA (SEQ ID No:5) were taken as forward and reverse primers for carrying out a PCR reaction; and a PCR product was subjected to1% agarose electrophoresis and subjected to gel extraction by a Gel Extraction Kit, wherein the PCR reaction system was shown as Table 1, and PCR reaction conditions were shown as Table 2.
(5) T/A ligation, transformation and identification of the PCR product:
The purified PCR product in the step (4) and a cloning vector, i.e., pMD18-T Vector (purchased from TaKaRa Company) were ligated overnight at 16°C, wherein a ligation system was as shown in Table 3; competent Escherichiacoli DH5a was transformed by a conventional method, coated on an LB agar plate (containing 50 pg/mL of ampicillin) containing ampicillin, and cultured in an incubator at 37°C for 16 h; positive clone was picked and subjected to
Description
multiplication culture; and the recombinant plasmid PMDMcherry subjected to PCR identification was subjected to sequencing identification. A profile of the recombinant plasmid PMDMcherry constructed by the above method was as shown in Fig. 1; and a sequence of the recombinant plasmid PMDMcherry was shown as SEQ ID NO:7.
Table 3 Ligation system
Reactant System (pl)
10xbuffer 2 templet 1 5 templet 2 5 T4 ligase 0.5 H20 to 20
Embodiment 2 Method for labeling Edwardsiellaictaluri by Mcherry fluorescent protein genes
The method for labeling Edwardsiella ictaluriby Mcherry fluorescent protein genes in the present embodiment includes the following steps: (1) An Edwardsiella ictaluri virulent strain was separated from a diseased zebra fish body by a conventional operating method; (2) Edwardsiella ictaluricompetence was prepared; Methods of the step (2) were as follows: (a) Edwardsiella ictaluri was inoculated into a BHI fluid medium and cultured on a shaker of 28°C at 280 rpm overnight; (b) the Edwardsiella ictaluri was transferred into a fluid medium containing 500 ml of BHI according to a ratio of 1:500, and cultured at 280 rpm for 2.5-3.5 h until OD600 was 0.6;
Description
(c) the Edwardsiella ictaluri was immediately quenched in an ice-water bath: a large container filled with an ice-water mixture may be selected; and the Edwardsiella ictaluri was rapidly rotated and shaken on the shaker, so that a culture temperature was decreased as soon as possible; (d) the Edwardsiella ictaluri was centrifuged in a 250 ml of precooled centrifuge cup at 4°C and 4000 rpm for 30 min; (e) the Edwardsiella ictaluri was washed with precooled sterile double distilled water after the supernatant was removed; a small amount of water suspension bacteria was added; the water was added to 500 mL after bacteria suspension; and the supernatant was removed at 4000 rpm for 20 min; (f) the solution was washed once with 500 mL of 10% precooled glycerin at 4000 rpm for 20 min; and bacteria in two centrifuge tubes were mixed, and washed once with 10% of 100 mL precooled glycerin at 4000 rpm for 20 min; (g) finally after the glycerin was poured off (as much as possible), 1 mL of glycerin suspension cells were added; every 80 pl of the cells were separately charged into a 1.5 mL EP tube (the EP tube should be precooled at -80C); and the cells were preserved at -80°C for later use; (3) Acquisition, ligation and transformation of the vector PMDMcherry A plasmid pMDMcherry (i.e., the recombinant plasmid obtained in Embodiment 1) of a strain that was subjected to sequencing identification to be accurate was extracted, and transferred into the prepared Edwardsiella ictaluri competence by electrotransformation. The electrotransformation method is as follows: (A) the competent cells were taken out of a refrigerator at -80°C and thawed on ice; (B) Ipl of the purified recombinant plasmid PMDMcherry (200 ng) was added into a 1.5 ml of centrifuge tube; and the recombinant plasmid and an electrode cup of 0.1CM were precooled on ice together;
Description
(C) 80 pl of the thawed competent cells were transferred into the 1.5 ml of centrifuge tube, carefully uniformly mixed, and placed on ice for 10 min; (D) an electrotransformation instrument was turned on and regulated to Manual; and a voltage was regulated to 2.1 KV; (E) the mixture was transferred into the precooled electrode cup; and the electrode cup was tapped to enable the mixture to uniformly enter the bottom of the electrode cup; (F) the electrode cup was pushed into the electrotransformation instrument; a button pulse was pressed; 1 ml ofBHI fluid medium was rapidly added into the electrode cup after a buzzing sound was heard; and the cells were resuspended and transferred into the 1.5 ml of centrifuge tube; (G) the cells were resuscitated at 37°C and 220-250 rpm for an hour; (H) 200 pl of the transformed product was coated on a BHI agar plate (containing 50 pg/mL of ampicillin) containing ampicillin, and cultured in a greenhouse at 28°C overnight; and the transformation result was checked next day; (4) Fluorescent strain observation The constructed strain was diluted with sterile water and coated on a glass slide; and the strain was observed at a magnification of 20x10 by a fluorescence microscope; thus the Mcherry fluorescent protein can be stably and efficiently expressed, as shown in Fig. 2. The recombinant vector PMDMcherry constructed in Embodiment 1 was introduced into the Edwardsiella ictaluri virulent strain and observed under the fluorescence microscope. If the Edwardsiella ictaluri presents red fluorescence, it is indicated that, the recombinant vector is successfully introduced. Stability tests show that, when the PMDMCHERRY performs passage to the 25thgeneration, plasmid stability maybe up to 100%. The above only describes preferred embodiments of the present invention, and does not limit the present invention. Modifications, equivalent replacements and
Description
improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention. The above embodiments merely express several implementations of the present invention. Descriptions of the embodiments are specific and detailed, but shall not be understood as a limitation to the scope of the patent of the present invention. It shall be indicated that, several modifications and improvements may be made by those ordinary skilled in the art without departing from the concept of the present invention. These modifications and improvements belong to the protection scope of the present invention. Therefore, the protection scope of the present invention shall be based on appended claims.
Description
Sequence Listing
<110> Applicant: Pearl River Fisheries Research Institute of Chinese Academy of Fishery Sciences
<120> Recombinant plasmid pMDMcherry, construction method of recombinant plasmid pMDMcherry, and method for labeling Edwardsiellaictaluri by Mcherry fluorescent protein genes <130> 7
<170> PatentInI version 3.1
<210> 1
<211> 27
<22> DNA
1 Artificial sequence
<400:> 1
<210> 2
<211> 27
<212> DNA
<21 3>Artificial sequence
<400:> 2 Cettgrc~ Catttttj-Ct TCtetC~a2
<210> 3
Description
<211> 304
<212> DNA
<213> Artificial sequence
<400> 3
cgcetaggat acgcacaccg tggaaacgga tgaaggcacg aacecagttg acataagcct 60
gttcggttcg taaactgtaa tgcaagtagc gtatgegetc acgcaactggtccagaacct 120
tgacegaacg cageggtggt aacggegeag tggcggtttt catggcttgt tatgactgtt 180
tttttgtaca gtetatgect egggcatect agcageaagegcgttacgcc gtgggtcgat 240
gtttgatgtt atggagcagc ancgatgtta cgcagcagca acgatactag tggaggaaga 300
aaaa 304
<210> 4
<211> 28
<212> DNA
<213> Artificial sequence
<400> 4
aggaagaaaa aatggtgage aagggcga 28
<210> 5
<211> 26
<212> DNA
<213> Artificial sequence
<400> 5
Description gcgttegaat tactacttgt acaget 26
<210> 6
<211> 714
<212> DNA
<213> Artificial sequence
<400> 6
atggtgagca agggtgagga ggataacatg gecatcatca aggagtteat gegettcaag 60
gtgcacatgg agggctcegt gaacggecae gagttcgigai tegagggcga gggegaggge 120
cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 180
ttcgcctggg acatcctgteccetcagttc atgtacggct ccaaggceta cgtgaagcac 240
ccegcegacatcccegacta Cttgaagetg teettecccg agggCttcaa gtgggacgc 300
gtgatgaact tgaggacggcggegtggtgaccgtgaccaggactectcetgcaggac 360
ggcgagttea tctacaaggt gaagctgcge ggcaccaact tcccetcega eggccccgta 420
atgcagaaga agaccatggg ctgggaggcc tcctccgage ggatgtacc egaggacgge 480
gcc tgaagg gegagatcaa geagaggetg gaagctgagg a1ggeggcca ctacgacget 540
gaggtcaaga ccacctacaa ggccaagaag ccgtgcagetgcccggCgc ctacaacgtc 600
aacatcaagt tggacatcac ctcccacaac gaggactaca ccategtgga acagtacgaa 660
cgegcgagg gecgecact eaceggegge atggacgage tgtacaagta gtaa 714
<210> 7
<211> 3720
<212> DNA
<213> Artificial sequence
1A
Description <400> 7
tegegcgttt eggtgatgac ggtgaaaace tetgacacat geagetccg gagacggtca 60
cagcttgtct gtaagcggat gcCgggagea gaciagccg tcagggegeg teagegggtg 120
ttggegggtg tcgggge tgg ettaactatg cggcatcaga gcagat tgta ctgagagtge 180
accatatgeg gtgtgaaat cgeacagat gegtaaggag aaaataccge atcaggegcc 210
attcgccatt caggctgege aactgttggg aagggegatc ggtgegggcc tcttegetat 300
taegccaget ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgcagggt 360
tttccagt cgacgttgtl aaacgacgg ccagtgccaa gettgcatge ctgcaggteg 420
acgattgcgt tegaacgcet aggatacgca caccgtggaa acggatgaag gcacgaaccc 480
agttgacata agectgtteg gttcgtaaac tgtaatgaa gtagegtatgcgctcacgca 510
actggtccag aaccttgacc gaaegcageg gtggtaacgg cgcagtggeg gttttcatgg 600
ettgttatgactgtttttllgtagtctettgctgggeatctagagcaagegegtt 660
acgccgtgggtcgatgtttgatgttatggagcagcaacga tgttacgcag cagcaacgat 720
actagtggag gaagaaaaaa tggtgagcaa gggtgaggag gataacatgg ccatcatcaa 780
ggagtteatg egettcaagg tgeacatgga gggctcegtg aseggccacg agt tcgagat 810
cgagggcgag ggetgagggccgcectacga gggcaccag accgccaagc tganggtgac 900
caagggtggc ccctgcct tcgcctggga catcctgteccctcagttca tgtacggctc 960
caaggcctac gtgaageacc cgecgacatcccgacta ttgaagctgt cettccega 1020
gggettaag tgggagegeg tgatgaaett cgaggacgge ggcgtggtga cegtgacca 1080
ggactcetcc ctgcaggacg gCgagttcat ctacaaggtg aagctgcgeg geaccaactt 1110
cccetccgac ggcccgtaa tgcagaagaa gaccatgggc tgggaggcCtcctccgagCg 1200
gatgtacccc gggacggcgccetgaaggg cgagatcaag cagaggetga agctgaagga 1260
cggcggccac tacgacgetg aggtcaagac cacctacaag gecaagaage cgtgcaget 1320
Description geccggcgcctacaacgtcaacatcaagtt ggacatcacc tccacaacg aggaetacac 1380
catcgtggaa ncagtcgaac gegccgaggg cgccactccaccggeggea tggacgagt 1440
gtacaagtag taaalctta gaggatecc gggtaccgagctcgaatteg taatcatggt 1500
catagctgtt tCctggtga aattgttatc egetcacaat tccacacaac atacgagccg 1560
gaagcataaa gtgtaaagcc tggggtgcet aatgagtgag ctaactcaca ttaattgcgt 1620
tgcgctcact gcccgctttc cagtcgggaa acctgtCgtg ccagtgcat taatgaateg 1680
gecaacgcge ggggagaggc ggtttgcgta ttgggegetc ttcegettee tegeteactg 1740
actcgetgeg ctcggtcgtt eggetgcgge gagcggtatC agcteactca aaggcggtaa 1800
tacggttatc cacagaatca ggggatancg caggaaagaa catgtgagea aaaggccagc 1860
aaaaggecag gaaccgtaaa aaggcgcgt tgtggcgtt tttccatagg etcegccccc 1920
etgacgageateaaaatcggctcaa gtcagaggtg gCgaaacceg acaggactat 1980
aaagatacca ggegtttcc cetggaaget cectcgtgcgetctetgtt cegaceetgc 2040
cgcttaccgg atacctgtec gccttietcc cttgggang egtggcgett tteatagct 2100
cacgetgtag gtateteagt teggtgtagg tcgttcgctc caagctgggc tgtgtgacg 2160
aacccCccgt tcagceecgac egetgegcet tatceggtan ctatcgtett gagtecaaee 2220
cggtaagaca cgacttatcg ccactggcag cagecactgg taacaggatt agcagagega 2280
ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa 2340
gaacagtatt tggtatetgc gcctgctga agccagttac (ttcggaaaa agagttggta 2400
gctettgate eggaaaca acacegtg gtagggtgg tttttttgtt tgcaagage 2160
agattacgeg cagaaaaaa ggattcaag aagatettt gatcttttct aegggtetg 2520
acgctCagtg gaacgaaaac tcacgttaag ggattttggt catgagatta taaaaagga 2580
tettcaceta gatcetttta aattaaaaat gaagttttaa atcaatCtaa agtatatatg 2640
agtaaacttg gtetgaeagt taccaatgct taatcagtga ggcacetate tcagcgatct 2700
16C
Description gtetatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg 2760
agggettacc atetggeccc agtgctgcaa tgatacegeg agacecacgc teaccggcte 2820
cagatttate agcaataaac cagcageggaagggccga gegcagaagt ggtcctgcaa 2880
ctttatccgc ctccatccag tctattaatt gttgccggg agtagagta agtagttcgc 2940
cagttaatag tttgcgcaac gttgttgcca ttgtacagg catgtggtg tacgctcgt 3000
cgtttggtat ggettcattc agctccggtt eccaacgatc aaggegagtt acatgatccc 3060
ccatgttgtg caaaaaageg gttagetcet tcggtcetcc gatcgttgte agagtaagt 3120
tggccgagt gttatcactc atggttatgg cagcactgca taattctett actgteatgc 3180
catecgtaag atgettttet gtgactggtg agtactcaac caagtcatte tgagaatagt 3240
gtatgcggeg accgagttgc tettgcccgg egtcaatacg ggalaatacc ggccacata 3300
gcagaacttt aaaAgtgctc atcattggaa aacgttettc ggggcggaaaa ctctcagga 3360
tcttaccget gttgagatec agttcgatgt aaccactcg tgcacccaac tgatcttcag 3420
catettttac tttCccagc gttIttgggt gagaaaac aggaggcaa aatgegeaa 3480
aaaagggaat aagggegaca eggaaatgtt gaatactcat actttectt tttcaatatt 3540
attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga 3600
aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag 3660
aaaCCattat tatcatgaea tta ctHtaHaaaataggcg tatcacgagg cctttc(gtc 3720
Claims (7)
1. A recombinant plasmid pMDMcherry, having a base sequence shown as SEQ ID NO:7.
2. A construction method of the recombinant plasmid pMDMcherry of claim 1, comprising the following steps: (1) taking a plasmid PRUAL as a template; taking SEQ ID No:1 and SEQ ID No:2 as primers; and performing PCR amplification to obtain a promoter fragment having a sequence number of SEQ ID NO:3; (2) taking a plasmid pLVX-PAmCherry-C1 as a template; taking SEQ ID No:4 and SEQ ID No:5 as primers; and performing PCR amplification to obtain a Mcherry fluorescent protein Mcherry fragment having a sequence number of SEQ ID NO:6; (3) mixing the promoter fragment in the step (1) and the Mcherry fluorescent protein Mcherry fragment in the step (2) to serve as a template; taking SEQ ID No:1 and SEQ ID No:5 as primers; and performing PCR amplification; (4) ligating a PCR product in the step (3) with a cloning vector, i.e., pMD18-T Vector; and performing identification after transformation, thereby obtaining the recombinant plasmid pMDMcherry having a sequence number of SEQ ID No:7.
3. The construction method of the recombinant plasmid pMDMcherry according to claim 2, wherein a volume ratio of the promoter fragment in the step (1) to the Mcherry fluorescent protein Mcherry fragment in the step (2) is 1:1.
4. The construction method of the recombinant plasmid pMDMcherry according to claim 2, wherein in the steps (1) to (3), a reaction system of the PCR amplification is totally 100 pl, comprising 20 pl of 5xbuffer, 8 pl of dNTPs, 2 pl of primersense, 2 pl of antisense, 1 pl of templet, 1 pl of Primerstar, and the balance of H 2 0.
5. The construction method of the recombinant plasmid pMDMcherry according to claim 2, wherein in the steps (1) to (3), reaction procedures of the PCR amplification are as follows: the temperature is maintained at 95°C for 2 min;
Claims
the temperature is maintained at 95°C for 30 s, at 50°C for 30 s and at 72°C for 30 s; totally 30 cycles are conducted; and the temperature is maintained at 72°C for 10 min.
6. The construction method of the recombinant plasmid pMDMcherry according to claim 2, wherein in the step (4), a reaction system of the ligation reaction is totally 20 pl, comprising 2 pl of 10xbuffer, 5 pl of templet 1, 5 pl of templet 2, 5 pl of templet 3, 0.5 pl of T4 ligase and the balance of H 2 0.
7. A method for labeling Edwardsiella ictaluriby Mcherry fluorescent protein genes, comprising the following steps: (1) separating Edwardsiellaictaluri from a diseased zebra fish body; (2) preparing Edwardsiella ictaluricompetence; (3) transferring the recombinant plasmid pMDMcherry of claim 1 into the preparedEdwardsiella ictaluri competence, thereby obtaining the product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2020102457A AU2020102457A4 (en) | 2020-09-28 | 2020-09-28 | Recombinant plasmid pmdmcherry, construction method of recombinant plasmid pmdmcherry, and method for labeling edwardsiella ictaluri by mcheey fluorescent protein genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2020102457A AU2020102457A4 (en) | 2020-09-28 | 2020-09-28 | Recombinant plasmid pmdmcherry, construction method of recombinant plasmid pmdmcherry, and method for labeling edwardsiella ictaluri by mcheey fluorescent protein genes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| AU2020102457A4 true AU2020102457A4 (en) | 2020-11-12 |
Family
ID=73048421
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2020102457A Ceased AU2020102457A4 (en) | 2020-09-28 | 2020-09-28 | Recombinant plasmid pmdmcherry, construction method of recombinant plasmid pmdmcherry, and method for labeling edwardsiella ictaluri by mcheey fluorescent protein genes |
Country Status (1)
| Country | Link |
|---|---|
| AU (1) | AU2020102457A4 (en) |
-
2020
- 2020-09-28 AU AU2020102457A patent/AU2020102457A4/en not_active Ceased
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755092A (en) | GLCCI1 gene Cre-LoxP conditional gene knockout mouse model-based construction kit and construction method | |
| US20020025561A1 (en) | Vectors for gene-self-assembly | |
| CN113549618B (en) | SARS-CoV-2 nucleic acid detection method based on RAA amplification and CRISPR-Cas13a system | |
| CN113481327B (en) | Novel coronavirus ORF1ab gene detection method based on RAA amplification and CRISPR-Cas12a | |
| CN108395996B (en) | Classical swine fever virus subunit vaccine and preparation method and application thereof | |
| CN108531471B (en) | Long gene synthesis method | |
| CN109609579B (en) | Genetically engineered bacterium for producing beta-carotene and construction method thereof | |
| CN108285886A (en) | The method that recombined bacillus subtilis resting cell produces N-acetyl-neuraminate | |
| CN114933970B (en) | Toxoplasma gene knock-out strain lacking 6-phosphogluconate dehydrogenase 1 gene | |
| CN114292864B (en) | Bacillus bailii mutant strain with high surfactant yield, construction method and application thereof | |
| CN104357459B (en) | The full-length infectious clone of japanese encephalitis virus of Carrying Green Fluorescent Protein gene and preparation method and application | |
| CN104651402A (en) | General type gene targeting vector | |
| CN112626116B (en) | Method for site-specific integration of large-fragment exogenous DNA | |
| CN113604505A (en) | pSFV-p32 virus-like particle and preparation method and application thereof | |
| AU2020102457A4 (en) | Recombinant plasmid pmdmcherry, construction method of recombinant plasmid pmdmcherry, and method for labeling edwardsiella ictaluri by mcheey fluorescent protein genes | |
| CN109652352B (en) | Genetically engineered bacterium for efficiently immobilizing enterococcus faecium glutamate decarboxylase and immobilization method | |
| CN113584223B (en) | Identification method of D614G mutation in SARS-CoV-2 based on CRISPR-Cas12a | |
| CN111979134B (en) | Construction and application of recombinant saccharomyces cerevisiae for synthesizing carminic acid | |
| CN111321163B (en) | Construction and application of bacillus subtilis linear plasmid system | |
| CN113073097B (en) | CHO cell endogenous temperature-sensitive promoter and application thereof | |
| CN107661496A (en) | A kind of pig parvoviral immune composition and preparation method and application | |
| CN112322706A (en) | Specific human gene fragment, primer probe and application thereof | |
| JP3688118B2 (en) | Gene trap vector and gene trap method using this vector | |
| CN114214347B (en) | Plasmid system for tracing liver precursor cells and application | |
| CN110607380B (en) | Mulberry phytoplasma ltrA gene and application thereof in molecular detection of mulberry phytoplasma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FGI | Letters patent sealed or granted (innovation patent) | ||
| MK22 | Patent ceased section 143a(d), or expired - non payment of renewal fee or expiry |