CN112322706A - Specific human gene fragment, primer probe and application thereof - Google Patents

Abstract

The invention provides a human cell specific gene fragment, a specific primer and a probe thereof, and a method for specific quantitative detection of a human gene. According to the invention, a human specific gene segment with the length of 166bp on the FOXP2 gene is obtained through an NCBI website and a BLAST sequence comparison function thereof, and the human genes in tissues, blood and other non-human samples of various animals before clinical application are quantified through qPCR. The human cell specific gene fragment and the qPCR quantitative detection method adopted by the invention have the advantages of high specificity, strong sensitivity, good repeatability and simpler and more convenient operation, and provide a new thought and corresponding technical support for quantitatively detecting the specific human gene.

Description

Specific human gene fragment, primer probe and application thereof

Technical Field

The invention relates to the technical field of molecular biological detection, in particular to a specific human gene fragment, a primer, a probe and application thereof.

Background

In recent years, cell therapy drugs such as mesenchymal stem cells, hematopoietic stem cells, embryonic stem cells and immune cells have become hot spots for research in the field of diseases such as tumors, diabetes and multiple organ function decline, and a plurality of innovative drugs have entered clinical test stages, showing great application potential of the cell therapy drugs. At present, many cell therapy drugs are still in the preclinical research stage, and there is insufficient understanding on the distribution and metabolism of cell drugs after entering into the body, and the colonization and differentiation of stem cells in the body. The distribution and metabolism of cellular drugs in vivo have direct influence on the drug effect, so that the preclinical pharmacokinetic study is very important for the study of cellular drugs.

Human cells are detected in animal bodies before clinic, and the requirements on the specificity and the sensitivity of a detection method are extremely high. A commonly used assay is the fluorescent quantitative PCR method (qPCR), which is performed on genomic DNA in animal tissues and fluids by extraction of the DNA, for the qPCR detection of human-derived specific genes.

At present, no standard human source specific gene detection scheme exists, and the commonly used detection method mainly has the following defects: 1) the primer probes and the target genes detected by the primer probes are insufficient in specificity, and the human genes in various animal bodies cannot be specifically detected. Since the genome sequence similarity of human and nonhuman primates such as cynomolgus monkey exceeds 96% and the genome sequence similarity of human and mouse is 85%, the specificity of the method for detecting human genes in animals is highly required. 2) Due to the interference of animal background DNA, when the content of human genes in the animal body is low, accurate quantification cannot be realized. 3) The common human source specific gene Alu is a short interspersed repetitive sequence with rich content and unique primate genome, and has higher difficulty in distinguishing human and non-human primates; meanwhile, Alu gene has multiple copies in genome, and the copy number is slightly different between different parts and different ethnicities, and the result of the copy number determined cannot be directly corresponding to the cell amount. Real-time fluorescence PCR detection of human genes in entry biomaterialsEstablishment of the method (Huangjicheng, Huanghuimin, Liuyan, Li wavelet, Zhengkui, teacher Yongxia. China national sanitation quarantine journal, 2016,39(1)) provides a real-time fluorescence quantitative PCR detection method of human genes, which is applied to the detection of port entry and exit biomaterials, the experiment designs and screens detection primers and probes according to the nucleic acid sequence of human mitochondrial ND2 gene, the lowest detection limit is 1 × 10³copies/ml. Patent CN107937407A discloses a specific human gene fragment and its detection primer and probe, which can be used for detecting human cells.

The FOXP2 gene (Forkhead box P2, NCBI number NG _007491.3) is located on chromosome 7 of human, is the first gene found to regulate language and cognitive functions, and is also called "language gene". The FOXP2 encoded protein is composed of 715 amino acids, and contains a glutamate-rich region in the 715 amino acids, which has at its C-terminus an FKH DNA binding domain, also known as a winged helix domain, that binds DNA. The FOXP2 protein has extremely high conservation, and there are three amino acid differences between human and murine FOXP2 homologous proteins, and two of the three amino acid differences between human and gorilla FOXP2 homologous proteins.

In the prior art, researchers have studied FOXP2, and research shows that the FOXP2 protein has the effects of regulating the development of lung, esophagus and the like, regulating the proliferation and functions of alpha islet cells, regulating the growth of osteosarcoma cells, inhibiting the generation of cancers such as gastric cancer, liver cancer, breast cancer and the like, but the FOXP2 is not applied to the detection of human cells.

Therefore, for the detection of human cells in animal bodies before clinical treatment, a qPCR detection reagent and a method with good specificity and high sensitivity are needed to be determined.

Disclosure of Invention

Aiming at the defects, the invention provides a section of human cell specific gene fragment, specific primers and probes thereof, which have the advantages of good specificity, sensitivity, durability, precision and accuracy, simple and convenient operation and can be used for the quantification of human genes in various animal tissues and blood and other non-human samples before clinic.

In order to achieve the above object, the technical solution of the present invention is as follows:

in one aspect, the invention provides a primer probe combination for quantitatively detecting human genes.

Specifically, the primer comprises homo4-F and homo4-R, the nucleotide sequence of homo4-F is shown as SEQ ID NO. 2, and the nucleotide sequence of homo4-R is shown as SEQ ID NO. 3.

Specifically, the nucleotide sequence of the probe is shown as SEQ ID NO. 4.

Further specifically, the 5 'end of the probe is marked with a fluorescent reporter group, and the 3' end of the probe is marked with a quenching group; preferably, the fluorescent reporter group is at least one of FAM, HEX, VIC, JOE and ROX, and is further preferably FAM; preferably, the quencher is a fluorescence quencher, and further preferably is a TRAMA group.

On the other hand, the invention provides the application of the primer probe combination in the quantitative detection of the human genes.

In another aspect, the invention provides an application of the human cell-specific gene fragment in quantitative detection of the human gene.

Specifically, the nucleotide sequence of the human cell-specific gene fragment is shown in SEQ ID NO. 1.

More specifically, the human cell-specific gene fragment is located on Forkhead box P2(FOXP2, NCBI accession number NG _007491.3, 492046) -492211) gene, has no same sequence with animals such as monkey, mouse, rat, rabbit, dog, bird, chicken and baboon, and has high specificity.

In still another aspect, the present invention provides a vector comprising the above-described human-derived cell-specific gene fragment.

Specifically, the vector includes but is not limited to plasmid, virus, phage; preferably, the vector is a plasmid; further preferred is the pMD19-T vector plasmid.

In still another aspect, the present invention provides a host cell comprising the above-described human-derived cell-specific gene fragment.

Specifically, the host cell is an Escherichia coli cell.

In another aspect, the invention provides an application of the vector containing the human cell-specific gene segment or the host cell containing the human cell-specific gene segment in quantitative detection of the human gene.

In another aspect, the invention provides an application of the primer probe combination, the human cell-specific gene fragment, the vector containing the human cell-specific gene fragment or the host cell containing the human cell-specific gene fragment in the preparation of a tool for quantitatively detecting the human gene.

Specifically, the tool is an independent reagent or a kit.

In another aspect, the present invention provides a kit for quantitatively detecting a human gene, wherein the kit comprises the primer probe combination, a human cell-specific gene fragment, a vector comprising the human cell-specific gene fragment, or a host cell comprising the human cell-specific gene fragment.

It should be specifically noted that other human gene detection methods based on Forkhead box P2(FOXP2) gene or other primer probe sequences based on the same target gene fragment also belong to the scope of the present invention.

In another aspect, the present invention provides a method for quantitatively detecting a human gene, the method comprising the steps of:

(1) selecting a gene segment with high human-derived specificity and designing a primer and a probe;

(2) obtaining a standard plasmid containing the gene fragment with high human source specificity in the step (1);

(3) drawing a standard curve according to the standard plasmid obtained in the step (2);

(4) and (4) quantitatively detecting the content of the human genes.

Specifically, in step (1), the human-derived gene fragment with high specificity can be obtained through bioinformatics center such as NCBI, and the sequence can be analyzed by performing BLAST function on NCBI website.

Specifically, in the step (2), the standard plasmid is used as a standardThe concentration range of the standard product is 10-1 × 10⁷copies/. mu.L; the quality control sample of the standard plasmid is QCH, QCM, QCL and LLOQ sample, and the concentration of the QCH sample is 5 multiplied by 10⁶copies/mu L, the concentration of the QCM sample is 2 x 10⁴The concentration of the QCL sample is 30 copies/mu L, and the concentration of the LLOQ sample is 10 copies/mu L.

Specifically, in step (3), the standard curve can be obtained by a qPCR method using the standard of the standard plasmid obtained in step (2).

More specifically, in the step (3), in the qPCR reaction system, the final concentration of the template, i.e., the standard plasmid standard, is 20-2 × 10⁷copies/. mu.g DNA; the final concentration of homo4-F was 200nM, that of homo4-R was 200nM, that of homo4-P was 200nM, and that of the blank mouse liver genome was 1. mu.g/reaction.

Specifically, in the step (4), the method for quantitatively detecting the content of the human-derived gene is obtained by qPCR detection.

Further specifically, in the qPCR reaction system in the step (4), the final concentration of the sample to be detected is 0-2 μ g/reaction, the final concentration of homo4-F is 200nM, the final concentration of homo4-R is 200nM, and the final concentration of homo4-P is 200 nM.

Compared with the prior art, the invention has the advantages that:

(1) the specificity is strong: the human-derived cell specific gene fragment provided by the invention has no non-specific amplification in animals such as monkeys, mice, rats, rabbits, dogs, birds, chickens and baboons.

(2) The sensitivity is high: the lowest limit of quantitation can reach 10 copies/. mu.L.

(3) The durability is strong: the added amount of the exogenous gene and different tissues and whole blood gene groups of various animals have no effect of inhibiting or promoting the amplification reaction.

(4) Good repeatability, high precision and accuracy: the plasmid standard product has stable detection standard curve result and good repeatability.

(5) The operation is simple and convenient: the quantitative plasmid standard substance is constructed by adopting commercial blunt-end plasmids, enzyme digestion purification is not needed, time is saved, and cost is reduced.

Drawings

FIG. 1 is a diagram showing the results of gel electrophoresis of the standard plasmid of example 2, wherein M is KB Ladder, 1 is the standard plasmid, and 2 is the plasmid digested with HindIII enzyme and EcoRI enzyme.

FIG. 2 is a standard graph of example 5.

FIG. 3 is the qPCR detection profile of example 5.

Detailed Description

The present invention will be further illustrated in detail with reference to the following specific examples, which are not intended to limit the present invention but are merely illustrative thereof. The experimental methods used in the following examples are not specifically described, and the materials, reagents and the like used in the following examples are generally commercially available under the usual conditions without specific descriptions.

Example 1 detection kit for human Gene

1. Human cell-specific gene fragments: through NCBI website and BLAST sequence alignment function, the species specificity of the FOXP2 gene is determined, and the segment with the highest specificity is selected as the specific gene segment for quantitatively detecting the human cells.

Human cell-specific gene fragment sequence (SEQ ID NO: 1):

TGCTATGTGATGGACATGGTTCTGTTTTAGTATTCATTGCATTTATAAGTACCAATATGCCAGAGTGGTAGTCTGGAACACCGTAAGAGTACTGGTGGGCTAAAAGGAAGAAAGAGGTCAAAAAGATAGATGGGGTACCTAAAGCCTGCCATATGTTTTCATCACT。

2. specific primers and probes are designed according to the sequence of the specific gene fragment of the human cell, and the sequence is as follows:

homo4-F(SEQID NO:2)：5’-TGGTAGTCTGGAACACCGTAAGAGT-3’；

homo4-R(SEQID NO:3)：5’-CATATGGCAGGCTTTAGGTACCC-3’；

homo4-P(SEQID NO:4)：

FAM-CTGGTGGGCTAAAAGGAAGAAAGAGGTC-TRAMA。

the primer is confirmed by the BLAST function of NCBI website, and only can specifically identify and amplify the specific gene fragment sequence (SEQ ID NO:1) of the human cells.

Example 2 Standard plasmid construction

1. Human cell-specific gene fragment acquisition

The genome DNA in human whole blood is extracted by a commercial genome extraction kit (blood/tissue/cell genome DNA extraction kit, Tiangen Biochemical technology (Beijing) Ltd., product No. DP304) and is used as a template for amplifying the human cell specific gene fragment. The reaction system is prepared as follows:

TABLE 1 PCR reaction System

Name of reagent	Volume (μ L)
		Form panel	5
homo4-PF1	1
		homo4-PR1	1
Premix Ex Taq Hot Start Version	10
		Deionized water	To 20

Wherein, the primer homo4-PF1(SEQ ID NO: 5): 5'-TGCTATGTGATGGACATGGTTCT-3', respectively; homo4-PR1(SEQ ID NO: 6): 5'-AGTGATGAAAACATATGGCAGGC-3' are provided.

Reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 20sec, renaturation at 55 ℃ for 20sec, extension at 72 ℃ for 1min, 30 cycles; final extension at 72 ℃ for 10 min; storing at 4 ℃. The amplification product is 166bp, and the size of the amplification band is detected by adopting 1% agarose gel low-temperature electrophoresis.

PCR product recovery

PCR amplification is carried out according to the reaction conditions, the reaction system is expanded to 50 mu L in an equal ratio, and 3-5 times of amplification are carried out simultaneously. After completion of the PCR reaction, the reaction mixture was subjected to 1% agarose gel electrophoresis (DL2000 DNA Marker). The PCR product was recovered from the specifically amplified band according to the instructions of a general agarose gel DNA recovery kit (Tiangen Biochemical technology, Beijing, Ltd., Cat. No. DP 209).

3. Connection of

The 1.2 step PCR recovery product was taken and pMD19-T vector Cloning Kit (Takara, 6013) was formulated as the ligation system in Table 2 below:

TABLE 2 connection System

After mixing, connecting for 30min at 16 ℃.

4. Ligation product conversion

The ligation products were transformed into competent cells of E.coli JM109 according to the following procedure:

1) thawing 50. mu.L of competent cells on ice, adding 10. mu.L of ligation product, and ice-cooling for 30 min;

2) performing water bath heat shock at 42 ℃ for 60sec, and immediately performing ice bath for 2 min;

3) adding 500 μ L LB liquid medium balanced to room temperature, and incubating at 37 deg.C for about 1h in a shaker at 180 rpm;

4) spreading the culture solution on LB solid screening plate, air drying, and culturing at 37 deg.C for 12-18 h.

5. Screening and identification of positive clones

After culturing for 12-18h, 3 white colonies were picked and transferred to 5mL LB/Amp liquid medium, and cultured at 37 ℃ for 6h with shaking at 200 rpm.

According to the PCR system and conditions described in Table 1, the bacterial solution was subjected to PCR amplification, the amplification product was subjected to electrophoresis in 1% agarose gel, and the results of the electrophoresis are shown in FIG. 1.

For the clone with positive PCR identification result, the residual thallus is collected and the plasmid is extracted according to the operation instruction of a high-purity plasmid small-extraction medium-amount kit (Tiangen Biochemical technology (Beijing) Co., Ltd., product No. DP 107). The extracted plasmid was submitted to third party company for plasmid sequencing. As can be seen from the sequencing result (plasmid whole gene sequencing sequence is shown as SEQID NO:7), the constructed plasmid contains the complementary strand fragment (SEQID NO:8) of the human cell-specific gene fragment, which indicates that the plasmid is successfully constructed and can be used as a subsequent quantitative standard.

Complementary strand fragment of human cell-specific gene fragment (SEQ ID NO: 8):

AGTGATGAAAACATATGGCAGGCTTTAGGTACCCCATCTATCTTTTTGACCTCTTTCTTCCTTTTAGCCCACCAGTACTCTTACGGTGTTCCAGACTACCACTCTGGCATATTGGTACTTATAAATGCAATGAATACTAAAACAGAACCATGTCCATCACATAGCA。

example 3 qPCR method and sample detection

The method for detecting stem cells in preclinical mouse tissues and whole blood and the mouse tissue distribution test of stem cell drugs are taken as examples:

1. collecting a tissue sample: whole blood, liver, kidney, spleen, heart and lung tissues were collected according to the animal test protocol, each tissue was collected at 30-50 mg/part, and then stored in an ultra-low temperature refrigerator for future use.

2. Nucleic acid extraction: the genomic DNA was extracted using a commercially available tissue/whole blood genomic DNA extraction kit (blood/cell/tissue genomic DNA extraction kit, Tiangen Biochemical technology (Beijing) Ltd., DP 304). And (3) determining the concentration of the DNA by using an enzyme-labeling instrument, wherein the OD260/OD280 ratio of the extracted nucleic acid is required to be between 1.6 and 1.9, and diluting a sample with high DNA concentration to be below 0.4 mu g/mu L by using TE Buffer for determination.

qPCR assay

3.1 Standard Curve preparation: plasmid standards were gradient diluted to 1X 10 using a 0.04mg/mL yeast tRNA (Invitrogen, cat # 15401011) solution⁷、1×10⁶、1×10⁵、1×10⁴、1×10³、1×10²10 copies/. mu.L, and Blank with 0.04mg/mL yeast tRNA solution.

3.2 quality control sample preparation: plasmid standards were gradient diluted to 5X 10 using a 0.04mg/mL yeast tRNA (Invitrogen, cat # 15401011) solution⁶、2×10⁴30, 10 copies/. mu.L (1X 10, respectively)⁷、4×10⁴60, 20 copies/reaction) were used as QCH (high concentration quality control), QCM (medium concentration quality control), QCL (low concentration quality control) and LLOQ (minimum quantitation limit) samples, respectively.

3.3 qPCR reaction System:

the standard reaction system is shown in table 3 below:

TABLE 3 Standard reaction System

Reagent	Volume (μ L)	Final concentration
			Form panel
	2	20-2×107copies/μg DNA
			homo4-F	0.4	200nM
homo4-R	0.4	200nM
			homo4-P	0.4	200nM
2×SuperReal PreMix(Probe)	10	/
			Distilled Water	1.8	/
Blank mouse liver genome 0.2 mug/muL	5	1 μ g/reaction
			Final volume	20	/

Sample reaction systems are shown in table 4 below:

TABLE 4 sample reaction systems

Of these, 2 XSuperReal PreMix (Probe) was purchased from Tiangen Biochemical technology, Inc. (Beijing), Inc., under the product number FP 206.

3.4 reaction conditions

95℃15min；

95℃3sec，62℃1min，plate read 40×。

3.5 validation index and pass criteria: the method was examined for precision accuracy, durability, selectivity and recovery. The variation coefficient (CV%) of each concentration quality control sample in batch and between batches is required to be not more than 50%. The average accuracy (average of measured values/theoretical value x 100%) is between 50 and 150%.

3.6 data processing: the quantitative range of the standard curve is 10-1 multiplied by 10⁷copies/μL(20-2×10⁷copies/reaction, 1 copies/. mu.g DNA). The sample results are expressed as copy number of the human gene contained in each microgram of DNA, and are calculated as copies/μ g of DNA (copies/reaction)/extracted nucleic acid concentration (μ g/μ L)/PCR sample volume.

Example 4 specific assay

By using the specific primers and probes in embodiment 1 of the invention and the method in embodiment 3, genome samples of human-derived cells, cynomolgus monkeys, baboons, big and small mice, miniature pigs, dogs, cats and chickens are detected respectively, and the results show that the human-derived cell samples are positive, the samples of the cynomolgus monkeys, baboons, big and small mice, miniature pigs, dogs, cats and chickens are negative, and no non-specific amplification exists, which indicates that the primers and probes provided by the invention have strong specificity.

Example 5 sensitivity detection

The concentration of the plasmid standard substance in the invention is 10-1 × 10⁷copies/μL(20-2×10⁷copies/response) range, with the lowest limit of 10copies/μ L (20 copies/response), correlation coefficient of standard curve (R)²) The gene fragment is 0.999, the amplification Efficiency (Efficiency) is 100.0 percent, the specific gene fragment, the primer, the probe and the detection method thereof have better sensitivity, and the standard curve is shown in the attached figure 2 in detail.

TABLE 5 sensitivity detection

Example 6 accuracy testing

The 4 quality control samples in example 3 were tested, each quality control sample was examined for 6 replicates, and each replicate 5 times to obtain an average value as an actual measurement value, and the Coefficient of Variation (CV) thereof was calculated.

TABLE 6 accuracy testing

According to the detection results in table 6, the average accuracy of the quality control samples is between 95% and 110%, and the detection variation coefficient is less than 0.2, which shows that the accuracy of the invention is good.

Example 7 precision testing

3 batches of the kit of the embodiment 1 are selected to respectively detect the quality control samples in the embodiment 3, each quality control sample is repeated for 5 times, and the Coefficient of Variation (CV) of each quality control sample is calculated.

TABLE 7 precision determination

According to the detection results in table 7, the coefficient of variation of precision detection is less than 0.2, which indicates that the precision of the invention is better.

EXAMPLE 8 durability test

QCL (low concentration) quality control samples are selected, genomes of cynomolgus monkeys, NOD/SCID mice, NOG mice and nude rats are added into a qPCR reaction system for detection, each quality control sample is repeated for 3 times, and the variation Coefficient (CV) and the average accuracy of the quality control samples are calculated.

TABLE 8 durability test

According to the detection results in table 8, the detection variation coefficient is less than 0.2, and the average accuracy is between 80 and 140%, which indicates that the invention has strong durability, and the addition of the exogenous gene and the genome of different tissues and whole blood of various animals have no inhibition or promotion effect on the amplification reaction.

Example 9 tissue distribution

The mesenchymal stem cell medicine is 4 multiplied by 10⁷cells/kg are administered to NOG mice by a single intravenous administration, 1-7d of stem cells are mainly distributed in the lung after administration, and the content of the stem cells is in a descending trend; until 14-21d after administration, individual animals had stem cell genes detected in their lungs. The muscle, stomach and whole blood of individual animals have stem cell gene detection at 1-21d after administration, and the stem cell content in the rest tissues is lower than the lower limit of the quantification of the method.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Beijing Showa-showa-induced New drug research center, Inc

<120> specific human gene fragment, primer probe and application thereof

<130> 20201028

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 166

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

tgctatgtga tggacatggt tctgttttag tattcattgc atttataagt accaatatgc 60

cagagtggta gtctggaaca ccgtaagagt actggtgggc taaaaggaag aaagaggtca 120

aaaagataga tggggtacct aaagcctgcc atatgttttc atcact 166

<210> 2

<211> 25

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

tggtagtctg gaacaccgta agagt 25

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

catatggcag gctttaggta ccc 23

<210> 4

<211> 28

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

ctggtgggct aaaaggaaga aagaggtc 28

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

tgctatgtga tggacatggt tct 23

<210> 6

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

agtgatgaaa acatatggca ggc 23

<210> 7

<211> 2860

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acccggggat 420

cctctagaga ttagtgatga aaacatatgg caggctttag gtaccccatc tatctttttg 480

acctctttct tccttttagc ccaccagtac tcttacggtg ttccagacta ccactctggc 540

atattggtac ttataaatgc aatgaatact aaaacagaac catgtccatc acatagcaaa 600

tcgtcgacct gcaggcatgc aagcttggcg taatcatggt catagctgtt tcctgtgtga 660

aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa gtgtaaagcc 720

tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact gcccgctttc 780

cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc 840

ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt 900

cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca 960

ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa 1020

aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat 1080

cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc 1140

cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc 1200

gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt 1260

tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac 1320

cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg 1380

ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca 1440

gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt tggtatctgc 1500

gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa 1560

accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa 1620

ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac 1680

tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta 1740

aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt 1800

taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata 1860

gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc 1920

agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac 1980

cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag 2040

tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac 2100

gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc 2160

agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg 2220

gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc 2280

atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct 2340

gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc 2400

tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc 2460

atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc 2520

agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc 2580

gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca 2640

cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt 2700

tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt 2760

ccgcgcacat ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca 2820

ttaacctata aaaataggcg tatcacgagg ccctttcgtc 2860

<210> 8

<211> 166

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

agtgatgaaa acatatggca ggctttaggt accccatcta tctttttgac ctctttcttc 60

cttttagccc accagtactc ttacggtgtt ccagactacc actctggcat attggtactt 120

ataaatgcaa tgaatactaa aacagaacca tgtccatcac atagca 166

Claims (10)

1. A primer probe combination for quantitatively detecting human genes is characterized in that primers comprise homo4-F and homo4-R, nucleotide sequences of homo4-F are shown as SEQ ID NO. 2, and nucleotide sequences of homo4-R are shown as SEQ ID NO. 3; the nucleotide sequence of the probe is shown as SEQ ID NO. 4.

2. The primer probe combination for quantitatively detecting the human genes as claimed in claim 1, wherein the 5 'end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a quencher group; the fluorescence reporter group is at least one of FAM, HEX, VIC, JOE and ROX, and the quencher group is a fluorescence quencher group; the fluorescence reporter group is FAM, and the quencher group is TRAMA group.

3. The primer probe combination of claim 1, wherein the primer probe combination is used for quantitative detection of human genes.

4. The application of the human cell specific gene segment in the quantitative detection of the human gene is characterized in that the nucleotide sequence of the human cell specific gene segment is shown as SEQ ID NO. 1.

5. The use according to claim 4, wherein the human cell-specific gene fragment is located in FOXP2 gene.

6. The application of a carrier containing a human source cell specific gene segment or a host cell containing the human source cell specific gene segment in quantitative detection of a human source gene.

7. The primer probe combination, the human-derived cell-specific gene segment, the vector containing the human-derived cell-specific gene segment or the host cell containing the human-derived cell-specific gene segment of claim 1 is applied to the preparation of a tool for quantitatively detecting the human-derived gene.

8. The use of claim 7, wherein the means is a separate reagent or kit.

9. A kit for quantitative detection of human genes, comprising the primer probe combination of claim 1, a human cell-specific gene fragment, a vector comprising a human cell-specific gene fragment, or a host cell comprising a human cell-specific gene fragment.

10. A method for quantitatively detecting a human gene is characterized by comprising the following steps:

(1) selecting a gene segment with high human-derived specificity and designing a primer and a probe;

(2) obtaining a standard plasmid containing the gene fragment with high human source specificity in the step (1);

(3) drawing a standard curve according to the standard plasmid obtained in the step (2);

(4) and (4) quantitatively detecting the content of the human genes.

Images