CN114214347B

CN114214347B - Plasmid system for tracing liver precursor cells and application

Info

Publication number: CN114214347B
Application number: CN202111304113.7A
Authority: CN
Inventors: 王红阳; 于乐兴; 晏梓钧; 刘傅言
Original assignee: Third Affiliated Hospital Of Chinese People's Liberation Army Naval Medical University
Current assignee: Third Affiliated Hospital Of Chinese People's Liberation Army Naval Medical University
Priority date: 2021-11-05
Filing date: 2021-11-05
Publication date: 2023-11-17
Anticipated expiration: 2041-11-05
Also published as: CN114214347A

Abstract

The application provides a plasmid system Epcam-cre-DTR for tracing liver precursor cells, wherein the base sequence of the plasmid system is shown as SEQ ID NO.1, and the DNA sequences of an Epcam promoter sequence, cre recombinase and diphtheria toxin receptor are inserted. After the Epcam-cre-DTR plasmid system and the sleep Beauy transposon system are injected into the tail vein, liver precursor cells expressing Epcam are started to specifically generate cre recombinase, bind with loxP sites, express tdTomato and diphtheria toxin receptors, and carry red fluorescent markers. The expression of liver precursor cells containing the genome integrated into the host was specifically cleared by intraperitoneal injection of diphtheria toxin, and the red fluorescent label disappeared.

Description

Plasmid system for tracing liver precursor cells and application

Technical Field

The application belongs to the technical field of medical biology, and particularly relates to a plasmid system for tracing liver precursor cells, a construction method and application of the plasmid system in tracing normal liver homeostasis and damaged liver regeneration to differentiation and proliferation of the liver precursor cells.

Background

The liver is the organ with the strongest regeneration capacity of human body. The steady state balance of normal liver and the source of liver cells for damaged liver regeneration are currently a matter of debate in the academy. Recent studies have shown that self-regeneration of hepatocytes is found in acute and subacute liver injury (Schaub JR, malato Y, gormond C, et al (2014) Evidence against a stem cell origin of new hepatocytes in a common mouse model of chronic liver injury. Cell Rep8 (4): 933-9.); in chronic liver injury, a state in which hepatocytes pass through hnf4α+sox9+ double positive was found, and self-renewal ability was shown in vitro, however Sox9 was not only biliary, but also a surface marker of liver precursor cells (Tarlow BD, pelz C, naugler WE, et al (2014) Bipotential adult liver progenitors are derived from chronically injured mature hepatosteps Cell 15 (5): 605-18.); in the case of p21 overexpression and Itgb1 knockdown, transdifferentiation of biliary epithelial cells into hepatocytes can be achieved in a short period of time (RavenA, lu WY, man TY, et al (2017) Cholangiocytes act as facultative liver stem cells during impaired hepatocyte regeneration.nature 547 (7663): 350-354.); in chronic liver injury of long duration, biliary epithelial cells transform to hepatocytes through Hnf4α+Krt19+ states (DengX, zhang X, li W, et al (2018) Chronic Liver Injury Induces Conversion of Biliary Epithelial Cells into hepatoducts. Cell Stem Cell23 (1): 114-122.e3.).

The cross-section of the hepatic lobule from portal vein region (PV) to central vein region (CV) is defined as three regions of heterogeneity that express different metabolic enzymes although of histological identical cell origin. Venous blood from the gut mixes with oxygenated arterial blood from the ductus zone (zone 1), passes through the central lobe (zone 2 ) hepatic blood sinus, enters the central venous zone (zone 3 ) and returns to the heart. In 2015, wang et al found that there were sustainable Self-renewing axin2+ diploid cells in region 3 by lineage tracing techniques that expressed Tbx3 liver precursor cell markers that subsequently disappeared in mature hepatocytes (Wang B, zhao L, fish M, et al (2015) Self-renewing diploid Axin2 (+) cells fuel homeostatic renewal ofthe lever. Nature 524 (7564): 180-5.); in 2019 Sun et al, refuted the above observations, cleared axin2+ cells from central venous regions temporarily destroyed 3 region, found that Axin2 was upregulated during liver regeneration from original liver parenchymal cells, indicating the simultaneous presence of local repair and repair of the whole liver (Sun T, pikiole M, orsini V, et al (2019) axin2+ Pericentral Hepatocytes Have Limited Contributions to Liver Homeostasis and regeneration.cell Stem Cell 26 (1): 97-107.e6.); in 2020, chen et al, using rainbow reporter mice randomly lineage tagged hepatocytes, found that hepatocyte homeostasis was dependent on moderate proliferation of hepatocytes in each region, and that proliferation of hepatocytes was carried by hepatocytes in each region after liver injury (Chen F, jimez RJ, sharma K, et al (2020) Broad Distribution of Hepatocyte Proliferation in Liver Homeostasis and regeneration.cell Stem Cell 26 (1): 27-33.e4.); 2021, wei et al, by 11 creER mice knockin model, labeled hepatocytes distributed in three regions, and found that region 2hepatocytes were the primary cell source for maintenance of hepatic homeostasis; proliferation of region 2 was found to be driven by insulin-like growth factor binding protein 2-rapamycin receptor-cyclin D1 (IGFBP 2-mTOR-CCND 1) by inhibition and activation of signaling pathways that regulate proliferation of region 2 (Wei Y, wanyg, jiaY, et al (2021) Liver homeostasis is maintained by midlobular zone2 hepatocytotes.science 371 (6532): eabb 1625.).

The epithelial cell adhesion molecule (Epithelial cell adhesion molecule, epcam) is Ca independent in epithelial cells ²⁺ Transmembrane glycoproteins that regulate intercellular adhesion. In 2010, terris B et al revealed that epcam+afp+liver injury subtype has characteristics of liver precursor cells (Terris B, cavard C, perret C (2010) Epcam, a new marker for cancer stem cells in hepatocellular carpinoma.j Hepatol 52 (2): 280-1.). Gene chip analysis showed that the Epcam+ subpopulation was present at high levels of stem cell related markers (Nio K, yamashita T, okada H, et al (2015) developing EpCAM (+) liver cancer stem cells by targeting chromatin remodeling enzyme CHD in human hepatocellular carpatol 63 (5): 1164-72) and that the Epcam+ subpopulation was found to have higher tumorigenicity in vivo than the EpCAM-subpopulation (Yamashita T, ji J, budhu A, et al (2009) EpCAM-positive hepatocellular carcinoma cells are tumor-initiating cells with stem/progenitor cell features. Gateway 136 (3): 1012-24). These evidence suggest that Epcam may be of great significance in diagnosing and treating liver cancer and liver injury regeneration.

And the related research of tracing liver precursor cells is carried out, so that a reliable regenerative cell source is provided for treatment modes such as liver transplantation and the like. There are no reports about the construction of a targeting liver precursor cell system, and no researches about the targeting tracer epcam+ liver precursor cells.

Disclosure of Invention

The application is carried out by relying on the research, provides a plasmid system Epcam-cre-DTR for tracing liver precursor cells, and also provides a construction method and application of the plasmid system.

The design of the application can be fused to Rosa26 ^{loxP-stop-loxP–tdTomato} Plasmid system Epcam-cre-DTR of mouse host genome. After tail vein injection of the Epcam-cre-DTR plasmid system and the sleep Beauty transposon system, liver precursor cells expressing Epcam are started to specifically generate cre recombinase, bind with loxP sites, express tdTomato and diphtheria toxin receptor (Diphtheria Toxin Receptor, DTR), and carry red fluorescent markers. The expression of liver precursor cells containing the genome integrated into the host was specifically cleared by intraperitoneal injection of Diphtheria Toxin (DT), and the red fluorescent marker disappeared.

In a first aspect of the application, there is provided a plasmid system Epcam-cre-DTR for tracing liver precursor cells, the base sequence of the plasmid system is shown in SEQ ID NO.1, the structure is shown in figure 1, and polynucleotides encoding Epcam promoter, cre recombinase and diphtheria toxin receptor are inserted and expressed.

Wherein, the base sequence of the Epcam promoter is shown as SEQ ID NO.2, the base sequence of cre recombinase is shown as SEQ ID NO.3, and the base sequence of the diphtheria toxin receptor is shown as SEQ ID NO. 4.

After the Epcam-cre-DTR plasmid system and the sleep befall transposon system co-transfect cells, the Epcam promoter promotes epcam+liver precursor cells to start to express cre recombinase, binds to loxP sites, expresses tdTomato and diphtheria toxin receptor (Diphtheria Toxin Receptor, DTR), and enables epcam+liver precursor cells to carry red fluorescent markers.

In a second aspect of the present application, there is provided a method for preparing a plasmid system Epcam-cre-DTR for tracing liver precursor cells, comprising the steps of:

A. construction of plasmid pT-Epcam-cre-DTR by seamless cloning

Performing double enzyme digestion on an Epcam promoter, cre recombinase, a diphtheria toxin receptor PCR product and a carrier by using Clal and Pmll, wherein a high-salt buffer system is adopted for reaction, and the reaction is placed in a 37 ℃ water bath for 3 hours, so that the enzyme digestion is performed fully; then separating by 0.8% agarose electrophoresis, and recovering gel; the enzyme fragments and the carrier are mixed according to the mol ratio of 2:1 to carry out recombination reaction.

B. Preparation of engineering bacteria

Melting competent DH5 alpha escherichia coli on ice; adding the constructed plasmid into competent DH5 alpha escherichia coli, gently mixing, standing in an ice bath for 30 minutes, and rapidly cooling in the ice bath for 2 minutes by heat shock in a water bath at 42 ℃ for 60-90 seconds, wherein escherichia coli cannot be oscillated in the cooling process; adding 0.9ml of sterile LB culture medium without antibiotics, gently mixing, and culturing on a shaking table at 37 ℃ and 180-200 rpm for 1 hour; centrifuging at 600g for 3 min, collecting transformed host bacteria, discarding supernatant, and adding ampicillin-containing LB medium for resuspension; the transformed host bacteria are evenly coated on LB agar medium containing ampicillin, cultured for 12-16 hours at 37 ℃ to obtain monoclonal colony containing recombinant plasmid,

selecting clone colony, adding LB culture medium containing ampicillin, culturing on a shaking table at 37 ℃ and 180-200 rpm for 12 hours, extracting plasmid of host bacteria, and cutting a 2950bp strip and a 3900bp strip by using Clal and Pmll double enzyme, wherein the host bacteria is positive recombinant.

C. Extraction and purification of plasmid pT-Epcam-cre-DTR

Taking monoclonal host bacteria which are verified to be positive recombinants, adding LB culture medium containing ampicillin, and culturing on a shaking table at 37 ℃ and 180-200 rpm for 12-16 hours; the bacterial liquid 12000g was centrifuged for 2min, the supernatant was discarded, bacterial cells were collected, and plasmid extraction and purification were performed according to the kit instructions.

In a third aspect of the application there is provided the use of a plasmid system in the preparation of a liver cell tracer. Preferably, the liver cell tracer is a tracer for tracing liver precursor cells, specifically epcam+ liver precursor cells.

According to experimental verification, 6-week-old C57BL/6J-Rosa26 ^{loxP-stop-loxP–tdTomato} Mice were injected i.v. with Epcam-cre-DTR targeting plasmid and sleep Beauty transposon system. Administered as shown from week 2DDC feeding results in mouse liver injury caused by mouse biliary tract response and liver fibrosis. Hematoxylin eosin staining experiments and sirius red staining experiments show that the modeling of the liver fibrosis model of the mice is successful. The materials are obtained 4 weeks after the successful molding, and immunofluorescence experiments show that the Epcam-cre-DTR system successfully marks the Epcam+liver precursor cells. The red fluorescence disappears after DT treatment, and the Epcam+ liver precursor cells can be effectively tracked and cleared, so that a plasmid system for tracking the liver precursor cells is obtained.

In a fourth aspect of the application, there is provided the use of the plasmid system described above in the preparation of a medicament for the treatment of liver injury.

Preferably, the drug for treating liver injury is a drug for tracing liver precursor cells, and the active components of the drug comprise the plasmid system and a transposon system for driving the plasmid system to transpose, so that the drug is integrated into the genome of Epcam+liver precursor cells.

In a fifth aspect, the present application provides a pharmaceutical composition for tracing liver precursor cells, comprising an active ingredient and pharmaceutically acceptable excipients; the active component comprises the plasmid system and a transposon system for driving the plasmid system to generate transposition and integrate into a cell genome, wherein the transposon system is a sleep Beauy transposon system.

In a sixth aspect of the application, there is provided a pharmaceutical composition for the treatment of liver injury comprising a pharmaceutical composition for the tracking of liver precursor cells as described above, and diphtheria toxin for use in combination with the pharmaceutical composition.

In use, the pharmaceutical composition of the tracer liver precursor cells is introduced into the body first, and after a period of time, the diphtheria toxin is injected, and the diphtheria toxin specifically eliminates and expresses liver precursor cells containing the genome integrated into the host by binding to the diphtheria toxin receptor.

The beneficial effects of the application are as follows:

the experimental result proves that the Epcam-cre-DTR plasmid system can be effectively integrated into the genome of the hepatic precursor cells, and the Epcam+ hepatic precursor cells can be effectively tracked and cleared due to the fluorescent marking effect generated by the activation of tdTomato by cre recombinase and the cell clearing effect combined by DTR and DT, so that the plasmid system for tracking the hepatic precursor cells is obtained.

The application adopts the induction type expression vector, which can reduce the cost in large-scale cloning, thereby being beneficial to large-scale production. Since epcam+ liver precursor cells are a main cell subset of liver precursor cells, tracing epcam+ liver precursor cells has great significance for studying liver homeostasis balance and the role played by liver precursor cells in liver regeneration after liver injury.

Drawings

FIG. 1 is a schematic diagram of the construction of plasmid Epcam-cre-DTR by a seamless cloning method.

FIG. 2 shows the FIG. 2 of the restriction map of the plasmid Epcam-cre-DTR: lane1: plasmid, lane2: plasmidDigested with Clal-Pmll, lane3: DNA marker.

FIG. 3 is a verification experiment of plasmid Epcam-cre-DTR, A is Rosa26 ^{loxP-stop-loxP–tdTomato} Schematic of mice and tracer plasmid Epcam-cre-DTR tail intravenous injection, and schematic of experimental treatment process B.

FIG. 4 shows the results of hematoxylin eosin staining, sirius red staining and immunofluorescence experiments.

Detailed Description

The present application will be described in detail with reference to the drawings and examples thereof, which are provided on the premise of the technical solution of the present application, and the detailed embodiments and specific operation procedures are given, but the scope of the present application is not limited to the following examples.

The reagents and starting materials used in the present application are commercially available or may be prepared by literature procedures. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by conventional conditions such as Sambrook et al, molecular cloning: conditions described in the laboratory guidelines (NewYork: cold Spring Harbor Laboratory Press, 1989), or according to conventional conditions or manufacturer's recommendations.

Example 1 construction and purification of plasmid Epcam-cre-DTR

1. Construction of expression plasmid pT-Epcam-cre-DTR

The construction is carried out by adopting a seamless cloning method, and the specific construction steps are as follows:

after the sequencing is correct, the sequence is cut by Clal and Pmll double enzymes, and is connected with the carrier cut by Clal and Pmll double enzymes. Restriction enzymes for cleavage were purchased from New England Biolabs (NEB) and the reaction was carried out using the system recommended in the enzyme specifications.

The specific reaction process is as follows: and (3) carrying out double enzyme digestion on the PCR product and the carrier by using Clal and Pmll, wherein a high-salt (H) buffer system is adopted in the reaction, and the reaction is placed in a 37 ℃ water bath for 3 hours, so that the PCR product and the carrier are subjected to full enzyme digestion. Then, after separation by 0.8% agarose electrophoresis, gel recovery was performed using TIANGEN gel recovery kit (catalogue number: DP 209). The enzyme fragment and the carrier are mixed according to the molar ratio of 2:1, the recombination reaction was carried out using the Cloneexpress II kit (catalog number: C112) from Vazyme company, and the reaction was carried out according to the recommended system of the specification.

2. Preparation of engineering bacteria

The above-mentioned ligated product was transformed into competent DH 5. Alpha. E.coli strain (DH 5. Alpha. Competent cells, MD101-1, new Saimei Biotechnology Co., ltd.) to obtain engineering bacterium DH 5. Alpha (pT-Epcam-cre-DTR).

The method comprises the following specific steps: 0.1ml competent DH 5. Alpha. E.coli was thawed on ice. 10ng of the plasmid constructed above was added to competent DH 5. Alpha. E.coli, gently mixed, left in an ice bath for 30 minutes, heat shock in a 42℃water bath for 60 seconds (the longest heat shock time cannot exceed 90 seconds), and rapidly cooled in an ice bath for 2 minutes without shaking the E.coli during the cooling. 0.9ml of sterile (autoclaved) LB medium without antibiotics (containing 1% tryptone, 0.5% yeast extract and 1% sodium chloride, pH 7.0) was added, gently mixed and incubated on a shaker at 37℃and 180-200 rpm for 1 hour. The transformed host bacteria were collected by centrifugation at 600g for 3 minutes, the supernatant was discarded, and 0.3ml of ampicillin-containing LB medium was added for resuspension. The transformed host bacteria were spread on LB agar medium containing ampicillin uniformly and cultured overnight at 37℃for 12 to 16 hours. Thus, a monoclonal colony containing the recombinant plasmid was obtained. The colony is picked up, 5ml LB medium containing ampicillin is added, and the culture is carried out on a shaking table at 37 ℃ and 180-200 rpm for 12 hours. The plasmid of the host bacterium is extracted, and a 2950bp band and a 3900bp band can be cut by using Clal and Pmll double enzyme digestion (see figure 2), and the host bacterium is the positive recombinant.

Coli strain DH5 alpha containing plasmid pT-Epcam-cre-DTR is engineering bacterium DH5 alpha (pT-Epcam-cre-DTR).

3. Extraction and purification of plasmid pT-Epcam-cre-DTR

Engineering bacteria DH5 alpha (pT-Epcam-cre-DTR) can be used for mass production of plasmids pT-Epcam-cre-DTR. 2ml of monoclonal host bacteria which are verified to be positive recombinants are taken, 500ml of LB culture medium containing ampicillin is added, and the culture is carried out on a shaking table at 37 ℃ and 180-200 rpm for 12-16 hours. The bacterial liquid was centrifuged at 12000g for 2min, and the supernatant was discarded to collect the bacterial cells. Plasmid extraction and purification were carried out using Vazyme company FastPure EndoFree PlasmidMaxi Kit (catalogue number: DC 202), and the reaction was carried out according to the recommended system of the specification.

The base sequence of the constructed plasmid system Epcam-cre-DTR is shown as SEQ ID NO.1, the structure is shown as figure 1, and the polynucleotide for encoding the Epcam promoter, cre recombinase and diphtheria toxin receptor is inserted and expressed in the recombinant expression plasmid system. Wherein, the base sequence of the Epcam promoter is shown as SEQ ID NO.2, the base sequence of cre recombinase is shown as SEQ ID NO.3, the base sequence of the diphtheria toxin receptor is shown as SEQ ID NO.4, and the specific sequence is shown as follows.

The plasmid Epcam-cre-DTR was digested with the endonuclease Clal-Pmll, and subjected to agarose gel electrophoresis, the results of which are shown in FIG. 2.

Base sequence of plasmid System Epcam-cre-DTR (SEQ ID NO. 1)

CGCTCaCaATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCTACAGTTGAAGTCGGAAGTTTACATACACTTAAGTTGGAGTCATTAAAACTCGTTTTTCAACTACTCCACAAATTTCTTGTTAACAAACAATAGTTTTGGCAAGTCAGTTAGGACATCTACTTTGTGCATGACACAAGTCATTTTTCCAACAATTGTTTACAGACAGATTATTTCACTTATAATTCACTGTATCACAATTCCAGTGGGTCAGAAGTTTACATACACTAAGTTGACTGTGCCTTTAAACAGCTTGGAAAATTCCAGAAAATGATGTCATGGCTTTAGAAGCTTCTGATAGACTAATTGACATCATTTGAGTCAATTGGAGGTGTACCTGTGGATGTATTTCAAGGAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATATCGATACTAGTTCCGCTCCTCCTCACCCCATGCCATCTTCTCAGCTGGGAAATACTTTGATACACAAGGCATCGTGCAAGGCATTATGGGGCACATGCCCATATCCCAGACCCTGAGAGGAAAGGGGGAGGGCTGCATAAGACACTGGAGAGATGGCTCAGTGACTAAGCCCTGGCTGCTCTTAGAAGACCAGGGTTCAGTTTCTGACACTCACATGGCAGTAACAACTGCCTGCAGCTCCCGTTTCAGAGGATCAATGCTCTCTTTGGCCTGTATGGGAACTGCATGCATGTGATGCATAGACATACATGGGGGCAAAACACCCATACACATAAAATAAAAATAAAATATTTTTTAAAAAGATACCGTCTTTAAAAAAAGGCAAGCCATCACCCATTTGATCCTTTCCCATGCATCAGTGACTTAACAGAGCAGTGAACACAAAATTCTTCAAGGAAGGAGAAGCCATGGTGGTCATTGGTGGAGTCAGGGTCTCCAGAGAGCCCAAGTTGGACCCTAACTGCAGAGCTAGCCGAGGATGGTCTTCAACTTCTGATTTTCTGCTTTCACCTTCCCAGTGCTGGCATTGCGGGCCTCTGCCACCAAGCCCAGTTTAGGAGATGCTGGAGATCAAACCCAGGTTTTCAAGTGTGCTCAACAAACAGCCTTCTAACTGATCTACATCCCCAGAGGGCTGGAAATGTGTGCAACTTTTTCTGAGTTGTGAGTTGACAGAGATATTGGGGCAGGAGGGGAGTTAGAGGCTATTCTCCTTGAGATGCTATAAAGAATATTGTATCCAAAATTCTATCTGTGCTCTATGTAGAGATATCTAGTCTAATGCTTTCTGTAAACGCCCCCCCCCCCCGCCCAATTCTAGTGGGGAGTGTCATGCTATTTCATGAAGATGGAGGTCAGAGGATTAACTAGTGGGGGTGGGCTCTCTCCTTCTACCCTGTGGGTTCTAGGGACTGAATGCTGGACATCAGGAAGTAGGGGTCAGAGGATCCCTAACAGGCAGACATTTAGAGATAGGGCCACAAAAATAGGAGATGAAGATGGCAAACTTCCAGCTTCTCCCTCACCCTGCTGATCTGAGACAAAAGCCTGGAGGCTTAAATAGAAGGCCGGGCCTGCTTTTTCTCCCGCCAGTAGGGCCCACCTGCTGGAGGACCGGTCTGACAAGTTCATGACTGAATGAGGACTGTTTATCCCACCGGTATCGGCCTATCGGCTGCGCTGTCTTAGTTCAAACTGACCAACCCAAACTGGGGGCTGAACAGTGTGTCCGCCCCCCACTCCCACCCCTCCAAAGACCCATAAAACCCAGGTGTGGAGGAGAAGCAGCACTTCTTCCCTCTGATGGACTGATTCTGCACGTGAGACCTGCGGCGGCGGCGGCGGCGGCTGCTGCAGCTGCAGCTGCATGTTTCACTAGAGGTCTTTCCTCGATTTTTTTTTTTTTTTTTTTTGGTTTATTTTTCGAGACAAGAGTTTCTCTTGTGTGGGCCTGGCTGTATTCGAACTCACAGAGATCCTCCTGCCTCTGCTTTCGTCGTGCTAGGATTGAAGGTGTGTGCTACCCGCCCTGGTTCTCGAGCACCatgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgatGCTAGCGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTACTAGTCTCGAGACCATGAAGCTGCTGCCGTCGGTGGTGCTGAAGCTCTTTCTGGCTGCAGTTCTCTCGGCACTGGTGACTGGCGAGAGCCTGGAGCGGCTTCGGAGAGGGCTAGCTGCTGGAACCAGCAACCCGGACCCTCCCACTGTATCCACGGACCAGCTGCTACCCCTAGGAGGCGGCCGGGACCGGAAAGTCCGTGACTTGCAAGAGGCAGATCTGGACCTTTTGAGAGTCACTTTATCCTCCAAGCCACAAGCACTGGCCACACCAAACAAGGAGGAGCACGGGAAAAGAAAGAAGAAAGGCAAGGGGCTAGGGAAGAAGAGGGACCCATGTCTTCGGAAATACAAGGACTTCTGCATCCATGGAGAATGCAAATATGTGAAGGAGCTCCGGGCTCCCTCCTGCATCTGCCACCCGGGTTACCATGGAGAGAGGTGTCATGGGCTGAGCCTCAAGGTTCTGCCCACATGGTCCACCCCGGTGCAGCCAACCATCCTGGCCGTGGTGGCTGTGGTGCTGTCATCTGTCTGTCTGCTGGTCATCGTGGGGCTTCTCATGTTTAGGTACCATAGGAGAGGAGGTTATGATGTGGAAAATGAAGAGAAAGTGAAGTTGGGCATGACTAATTCCCACTGAGCGGCCGCCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGGGATCCCCTTGAAATACATCCACAGGTACACCTCCAATTGACTCAAATGATGTCAATTAGTCTATCAGAAGCTTCTAAAGCCATGACATCATTTTCTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAACTTAGTGTATGTAAACTTCTGACCCACTGGAATTGTGATACAGTGAATTATAAGTGAAATAATCTGTCTGTAAACAATTGTTGGAAAAATGACTTGTGTCATGCACAAAGTAGATGTCCTAACTGACTTGCCAAAACTATTGTTTGTTAACAAGAAATTTGTGGAGTAGTTGAAAAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTATAGGTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGC

Base sequence of Epcam promoter (SEQ ID NO. 2)

TCCGCTCCTCCTCACCCCATGCCATCTTCTCAGCTGGGAAATACTTTGATACACAAGGCATCGTGCAAGGCATTATGGGGCACATGCCCATATCCCAGACCCTGAGAGGAAAGGGGGAGGGCTGCATAAGACACTGGAGAGATGGCTCAGTGACTAAGCCCTGGCTGCTCTTAGAAGACCAGGGTTCAGTTTCTGACACTCACATGGCAGTAACAACTGCCTGCAGCTCCCGTTTCAGAGGATCAATGCTCTCTTTGGCCTGTATGGGAACTGCATGCATGTGATGCATAGACATACATGGGGGCAAAACACCCATACACATAAAATAAAAATAAAATATTTTTTAAAAAGATACCGTCTTTAAAAAAAGGCAAGCCATCACCCATTTGATCCTTTCCCATGCATCAGTGACTTAACAGAGCAGTGAACACAAAATTCTTCAAGGAAGGAGAAGCCATGGTGGTCATTGGTGGAGTCAGGGTCTCCAGAGAGCCCAAGTTGGACCCTAACTGCAGAGCTAGCCGAGGATGGTCTTCAACTTCTGATTTTCTGCTTTCACCTTCCCAGTGCTGGCATTGCGGGCCTCTGCCACCAAGCCCAGTTTAGGAGATGCTGGAGATCAAACCCAGGTTTTCAAGTGTGCTCAACAAACAGCCTTCTAACTGATCTACATCCCCAGAGGGCTGGAAATGTGTGCAACTTTTTCTGAGTTGTGAGTTGACAGAGATATTGGGGCAGGAGGGGAGTTAGAGGCTATTCTCCTTGAGATGCTATAAAGAATATTGTATCCAAAATTCTATCTGTGCTCTATGTAGAGATATCTAGTCTAATGCTTTCTGTAAACGCCCCCCCCCCCCGCCCAATTCTAGTGGGGAGTGTCATGCTATTTCATGAAGATGGAGGTCAGAGGATTAACTAGTGGGGGTGGGCTCTCTCCTTCTACCCTGTGGGTTCTAGGGACTGAATGCTGGACATCAGGAAGTAGGGGTCAGAGGATCCCTAACAGGCAGACATTTAGAGATAGGGCCACAAAAATAGGAGATGAAGATGGCAAACTTCCAGCTTCTCCCTCACCCTGCTGATCTGAGACAAAAGCCTGGAGGCTTAAATAGAAGGCCGGGCCTGCTTTTTCTCCCGCCAGTAGGGCCCACCTGCTGGAGGACCGGTCTGACAAGTTCATGACTGAATGAGGACTGTTTATCCCACCGGTATCGGCCTATCGGCTGCGCTGTCTTAGTTCAAACTGACCAACCCAAACTGGGGGCTGAACAGTGTGTCCGCCCCCCACTCCCACCCCTCCAAAGACCCATAAAACCCAGGTGTGGAGGAGAAGCAGCACTTCTTCCCTCTGATGGACTGATTCTGCACGTGAGACCTGCGGCGGCGGCGGCGGCGGCTGCTGCAGCTGCAGCTGCATGTTTCACTAGAGGTCTTTCCTCGATTTTTTTTTTTTTTTTTTTTGGTTTATTTTTCGAGACAAGAGTTTCTCTTGTGTGGGCCTGGCTGTATTCGAACTCACAGAGATCCTCCTGCCTCTGCTTTCGTCGTGCTAGGATTGAAGGTGTGTGCTACCCGCCCTGGTT

Base sequence of cre recombinase (SEQ ID NO. 3)

Atgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgat

Base sequence of diphtheria toxin receptor (SEQ ID NO. 4)

ATGAAGCTGCTGCCGTCGGTGGTGCTGAAGCTCTTTCTGGCTGCAGTTCTCTCGGCACTGGTGACTGGCGAGAGCCTGGAGCGGCTTCGGAGAGGGCTAGCTGCTGGAACCAGCAACCCGGACCCTCCCACTGTATCCACGGACCAGCTGCTACCCCTAGGAGGCGGCCGGGACCGGAAAGTCCGTGACTTGCAAGAGGCAGATCTGGACCTTTTGAGAGTCACTTTATCCTCCAAGCCACAAGCACTGGCCACACCAAACAAGGAGGAGCACGGGAAAAGAAAGAAGAAAGGCAAGGGGCTAGGGAAGAAGAGGGACCCATGTCTTCGGAAATACAAGGACTTCTGCATCCATGGAGAATGCAAATATGTGAAGGAGCTCCGGGCTCCCTCCTGCATCTGCCACCCGGGTTACCATGGAGAGAGGTGTCATGGGCTGAGCCTCAAGGTTCTGCCCACATGGTCCACCCCGGTGCAGCCAACCATCCTGGCCGTGGTGGCTGTGGTGCTGTCATCTGTCTGTCTGCTGGTCATCGTGGGGCTTCTCATGTTTAGGTACCATAGGAGAGGAGGTTATGATGTGGAAAATGAAGAGAAAGTGAAGTTGGGCATGACTAATTCCCACTGA

Example 2 Trace verification

Taking a mouse liver fibrosis model fed by 3,5-diethoxycarbonyl-1, 4-dihydro-osteoblast (3, 5-diethoxycarbonyl-1,4-dihydrocollidine, DDC) as an example, the integration of the Epcam-cre-DTR plasmid system into the host genome was demonstrated to track the proliferation of Epcam+ liver precursor cells in the case of liver injury.

6-week-old C57BL/6J-Rosa26 ^{loxP-stop-loxP–tdTomato} Mice were injected i.v. with Epcam-cre-DTR targeting plasmid and sleep Beauty transposon system (fig. 3A). DDC feeding was administered from week 2 on in the manner shown in figure 3B, resulting in mouse liver injury due to the mouse biliary tract response and liver fibrosis.

The experimental results are shown in fig. 4, and according to hematoxylin eosin staining experiments and sirius red staining experiments, after DDC injection, liver parenchymal cells are different in size, irregular in arrangement and increased in atypical, so that the successful modeling of the liver fibrosis model of the mouse is indicated; the materials are obtained 4 weeks after the successful molding, and immunofluorescence experiments show that the Epcam-cre-DTR system successfully marks the Epcam+liver precursor cells.

While the preferred embodiments of the present application have been described in detail, the present application is not limited to the embodiments, and various equivalent modifications and substitutions can be made by those skilled in the art without departing from the spirit of the present application, and these equivalent modifications and substitutions are intended to be included in the scope of the present application as defined in the appended claims.

Sequence listing

<110> third affiliated Hospital of the navy medical university of the free army of Chinese people

<120> plasmid system for tracing liver precursor cells and application thereof

<130> claims, description

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 7199

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

cgctcacaat tccacacaac atacgagccg gaagcataaa gtgtaaagcc tggggtgcct 60

aatgagtgag ctaactcaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa 120

acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta 180

ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc 240

gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg 300

caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt 360

tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa 420

gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct 480

ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc 540

cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg 600

tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct 660

tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag 720

cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga 780

agtggtggcc taactacggc tacactagaa gaacagtatt tggtatctgc gctctgctga 840

agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg 900

gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag 960

aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag 1020

ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat 1080

gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct 1140

taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac 1200

tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa 1260

tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg 1320

gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt 1380

gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca 1440

ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt 1500

cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct 1560

tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg 1620

cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg 1680

agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg 1740

cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa 1800

aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt 1860

aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt 1920

gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt 1980

gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca 2040

tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat 2100

ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca ttaacctata 2160

aaaataggcg tatcacgagg ccctttcgtc tcgcgcgttt cggtgatgac ggtgaaaacc 2220

tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca 2280

gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggctgg cttaactatg 2340

cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat 2400

gcgtaaggag aaaataccgc atcaggcgcc attcgccatt caggctgcgc aactgttggg 2460

aagggcgatc ggtgcgggcc tcttcgctat tacgccagct ggcgaaaggg ggatgtgctg 2520

caaggcgatt aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg 2580

ccagtgaatt cgagctcggt accctacagt tgaagtcgga agtttacata cacttaagtt 2640

ggagtcatta aaactcgttt ttcaactact ccacaaattt cttgttaaca aacaatagtt 2700

ttggcaagtc agttaggaca tctactttgt gcatgacaca agtcattttt ccaacaattg 2760

tttacagaca gattatttca cttataattc actgtatcac aattccagtg ggtcagaagt 2820

ttacatacac taagttgact gtgcctttaa acagcttgga aaattccaga aaatgatgtc 2880

atggctttag aagcttctga tagactaatt gacatcattt gagtcaattg gaggtgtacc 2940

tgtggatgta tttcaaggaa ttctgtggaa tgtgtgtcag ttagggtgtg gaaagtcccc 3000

aggctcccca gcaggcagaa gtatgcaaag catgcatatc gatactagtt ccgctcctcc 3060

tcaccccatg ccatcttctc agctgggaaa tactttgata cacaaggcat cgtgcaaggc 3120

attatggggc acatgcccat atcccagacc ctgagaggaa agggggaggg ctgcataaga 3180

cactggagag atggctcagt gactaagccc tggctgctct tagaagacca gggttcagtt 3240

tctgacactc acatggcagt aacaactgcc tgcagctccc gtttcagagg atcaatgctc 3300

tctttggcct gtatgggaac tgcatgcatg tgatgcatag acatacatgg gggcaaaaca 3360

cccatacaca taaaataaaa ataaaatatt ttttaaaaag ataccgtctt taaaaaaagg 3420

caagccatca cccatttgat cctttcccat gcatcagtga cttaacagag cagtgaacac 3480

aaaattcttc aaggaaggag aagccatggt ggtcattggt ggagtcaggg tctccagaga 3540

gcccaagttg gaccctaact gcagagctag ccgaggatgg tcttcaactt ctgattttct 3600

gctttcacct tcccagtgct ggcattgcgg gcctctgcca ccaagcccag tttaggagat 3660

gctggagatc aaacccaggt tttcaagtgt gctcaacaaa cagccttcta actgatctac 3720

atccccagag ggctggaaat gtgtgcaact ttttctgagt tgtgagttga cagagatatt 3780

ggggcaggag gggagttaga ggctattctc cttgagatgc tataaagaat attgtatcca 3840

aaattctatc tgtgctctat gtagagatat ctagtctaat gctttctgta aacgcccccc 3900

ccccccgccc aattctagtg gggagtgtca tgctatttca tgaagatgga ggtcagagga 3960

ttaactagtg ggggtgggct ctctccttct accctgtggg ttctagggac tgaatgctgg 4020

acatcaggaa gtaggggtca gaggatccct aacaggcaga catttagaga tagggccaca 4080

aaaataggag atgaagatgg caaacttcca gcttctccct caccctgctg atctgagaca 4140

aaagcctgga ggcttaaata gaaggccggg cctgcttttt ctcccgccag tagggcccac 4200

ctgctggagg accggtctga caagttcatg actgaatgag gactgtttat cccaccggta 4260

tcggcctatc ggctgcgctg tcttagttca aactgaccaa cccaaactgg gggctgaaca 4320

gtgtgtccgc cccccactcc cacccctcca aagacccata aaacccaggt gtggaggaga 4380

agcagcactt cttccctctg atggactgat tctgcacgtg agacctgcgg cggcggcggc 4440

ggcggctgct gcagctgcag ctgcatgttt cactagaggt ctttcctcga tttttttttt 4500

tttttttttt ggtttatttt tcgagacaag agtttctctt gtgtgggcct ggctgtattc 4560

gaactcacag agatcctcct gcctctgctt tcgtcgtgct aggattgaag gtgtgtgcta 4620

cccgccctgg ttctcgagca ccatgtccaa tttactgacc gtacaccaaa atttgcctgc 4680

attaccggtc gatgcaacga gtgatgaggt tcgcaagaac ctgatggaca tgttcaggga 4740

tcgccaggcg ttttctgagc atacctggaa aatgcttctg tccgtttgcc ggtcgtgggc 4800

ggcatggtgc aagttgaata accggaaatg gtttcccgca gaacctgaag atgttcgcga 4860

ttatcttcta tatcttcagg cgcgcggtct ggcagtaaaa actatccagc aacatttggg 4920

ccagctaaac atgcttcatc gtcggtccgg gctgccacga ccaagtgaca gcaatgctgt 4980

ttcactggtt atgcggcgga tccgaaaaga aaacgttgat gccggtgaac gtgcaaaaca 5040

ggctctagcg ttcgaacgca ctgatttcga ccaggttcgt tcactcatgg aaaatagcga 5100

tcgctgccag gatatacgta atctggcatt tctggggatt gcttataaca ccctgttacg 5160

tatagccgaa attgccagga tcagggttaa agatatctca cgtactgacg gtgggagaat 5220

gttaatccat attggcagaa cgaaaacgct ggttagcacc gcaggtgtag agaaggcact 5280

tagcctgggg gtaactaaac tggtcgagcg atggatttcc gtctctggtg tagctgatga 5340

tccgaataac tacctgtttt gccgggtcag aaaaaatggt gttgccgcgc catctgccac 5400

cagccagcta tcaactcgcg ccctggaagg gatttttgaa gcaactcatc gattgattta 5460

cggcgctaag gatgactctg gtcagagata cctggcctgg tctggacaca gtgcccgtgt 5520

cggagccgcg cgagatatgg cccgcgctgg agtttcaata ccggagatca tgcaagctgg 5580

tggctggacc aatgtaaata ttgtcatgaa ctatatccgt aacctggata gtgaaacagg 5640

ggcaatggtg cgcctgctgg aagatggcga tgctagcgag ggcagaggaa gtcttctaac 5700

atgcggtgac gtggaggaga atcccggccc tactagtctc gagaccatga agctgctgcc 5760

gtcggtggtg ctgaagctct ttctggctgc agttctctcg gcactggtga ctggcgagag 5820

cctggagcgg cttcggagag ggctagctgc tggaaccagc aacccggacc ctcccactgt 5880

atccacggac cagctgctac ccctaggagg cggccgggac cggaaagtcc gtgacttgca 5940

agaggcagat ctggaccttt tgagagtcac tttatcctcc aagccacaag cactggccac 6000

accaaacaag gaggagcacg ggaaaagaaa gaagaaaggc aaggggctag ggaagaagag 6060

ggacccatgt cttcggaaat acaaggactt ctgcatccat ggagaatgca aatatgtgaa 6120

ggagctccgg gctccctcct gcatctgcca cccgggttac catggagaga ggtgtcatgg 6180

gctgagcctc aaggttctgc ccacatggtc caccccggtg cagccaacca tcctggccgt 6240

ggtggctgtg gtgctgtcat ctgtctgtct gctggtcatc gtggggcttc tcatgtttag 6300

gtaccatagg agaggaggtt atgatgtgga aaatgaagag aaagtgaagt tgggcatgac 6360

taattcccac tgagcggccg ccgactgtgc cttctagttg ccagccatct gttgtttgcc 6420

cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa 6480

atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg 6540

ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg gatgcggtgg 6600

gctctatggg gatccccttg aaatacatcc acaggtacac ctccaattga ctcaaatgat 6660

gtcaattagt ctatcagaag cttctaaagc catgacatca ttttctggaa ttttccaagc 6720

tgtttaaagg cacagtcaac ttagtgtatg taaacttctg acccactgga attgtgatac 6780

agtgaattat aagtgaaata atctgtctgt aaacaattgt tggaaaaatg acttgtgtca 6840

tgcacaaagt agatgtccta actgacttgc caaaactatt gtttgttaac aagaaatttg 6900

tggagtagtt gaaaaacgag ttttaatgac tccaacttaa gtgtatgtaa acttccgact 6960

tcaactgtat aggtctagag tcgacctgca ggcatgcaag cttggcgtaa tcatggtcat 7020

agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata cgagccggaa 7080

gcataaagtg taaagcctgg ggtgcctaat gagtgagcta actcacatta attgcgttgc 7140

gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggc 7199

<210> 2

<211> 1583

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

tccgctcctc ctcaccccat gccatcttct cagctgggaa atactttgat acacaaggca 60

tcgtgcaagg cattatgggg cacatgccca tatcccagac cctgagagga aagggggagg 120

gctgcataag acactggaga gatggctcag tgactaagcc ctggctgctc ttagaagacc 180

agggttcagt ttctgacact cacatggcag taacaactgc ctgcagctcc cgtttcagag 240

gatcaatgct ctctttggcc tgtatgggaa ctgcatgcat gtgatgcata gacatacatg 300

ggggcaaaac acccatacac ataaaataaa aataaaatat tttttaaaaa gataccgtct 360

ttaaaaaaag gcaagccatc acccatttga tcctttccca tgcatcagtg acttaacaga 420

gcagtgaaca caaaattctt caaggaagga gaagccatgg tggtcattgg tggagtcagg 480

gtctccagag agcccaagtt ggaccctaac tgcagagcta gccgaggatg gtcttcaact 540

tctgattttc tgctttcacc ttcccagtgc tggcattgcg ggcctctgcc accaagccca 600

gtttaggaga tgctggagat caaacccagg ttttcaagtg tgctcaacaa acagccttct 660

aactgatcta catccccaga gggctggaaa tgtgtgcaac tttttctgag ttgtgagttg 720

acagagatat tggggcagga ggggagttag aggctattct ccttgagatg ctataaagaa 780

tattgtatcc aaaattctat ctgtgctcta tgtagagata tctagtctaa tgctttctgt 840

aaacgccccc cccccccgcc caattctagt ggggagtgtc atgctatttc atgaagatgg 900

aggtcagagg attaactagt gggggtgggc tctctccttc taccctgtgg gttctaggga 960

ctgaatgctg gacatcagga agtaggggtc agaggatccc taacaggcag acatttagag 1020

atagggccac aaaaatagga gatgaagatg gcaaacttcc agcttctccc tcaccctgct 1080

gatctgagac aaaagcctgg aggcttaaat agaaggccgg gcctgctttt tctcccgcca 1140

gtagggccca cctgctggag gaccggtctg acaagttcat gactgaatga ggactgttta 1200

tcccaccggt atcggcctat cggctgcgct gtcttagttc aaactgacca acccaaactg 1260

ggggctgaac agtgtgtccg ccccccactc ccacccctcc aaagacccat aaaacccagg 1320

tgtggaggag aagcagcact tcttccctct gatggactga ttctgcacgt gagacctgcg 1380

gcggcggcgg cggcggctgc tgcagctgca gctgcatgtt tcactagagg tctttcctcg 1440

attttttttt tttttttttt tggtttattt ttcgagacaa gagtttctct tgtgtgggcc 1500

tggctgtatt cgaactcaca gagatcctcc tgcctctgct ttcgtcgtgc taggattgaa 1560

ggtgtgtgct acccgccctg gtt 1583

<210> 3

<211> 1029

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

atgtccaatt tactgaccgt acaccaaaat ttgcctgcat taccggtcga tgcaacgagt 60

gatgaggttc gcaagaacct gatggacatg ttcagggatc gccaggcgtt ttctgagcat 120

acctggaaaa tgcttctgtc cgtttgccgg tcgtgggcgg catggtgcaa gttgaataac 180

cggaaatggt ttcccgcaga acctgaagat gttcgcgatt atcttctata tcttcaggcg 240

cgcggtctgg cagtaaaaac tatccagcaa catttgggcc agctaaacat gcttcatcgt 300

cggtccgggc tgccacgacc aagtgacagc aatgctgttt cactggttat gcggcggatc 360

cgaaaagaaa acgttgatgc cggtgaacgt gcaaaacagg ctctagcgtt cgaacgcact 420

gatttcgacc aggttcgttc actcatggaa aatagcgatc gctgccagga tatacgtaat 480

ctggcatttc tggggattgc ttataacacc ctgttacgta tagccgaaat tgccaggatc 540

agggttaaag atatctcacg tactgacggt gggagaatgt taatccatat tggcagaacg 600

aaaacgctgg ttagcaccgc aggtgtagag aaggcactta gcctgggggt aactaaactg 660

gtcgagcgat ggatttccgt ctctggtgta gctgatgatc cgaataacta cctgttttgc 720

cgggtcagaa aaaatggtgt tgccgcgcca tctgccacca gccagctatc aactcgcgcc 780

ctggaaggga tttttgaagc aactcatcga ttgatttacg gcgctaagga tgactctggt 840

cagagatacc tggcctggtc tggacacagt gcccgtgtcg gagccgcgcg agatatggcc 900

cgcgctggag tttcaatacc ggagatcatg caagctggtg gctggaccaa tgtaaatatt 960

gtcatgaact atatccgtaa cctggatagt gaaacagggg caatggtgcg cctgctggaa 1020

gatggcgat 1029

<210> 4

<211> 627

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

atgaagctgc tgccgtcggt ggtgctgaag ctctttctgg ctgcagttct ctcggcactg 60

gtgactggcg agagcctgga gcggcttcgg agagggctag ctgctggaac cagcaacccg 120

gaccctccca ctgtatccac ggaccagctg ctacccctag gaggcggccg ggaccggaaa 180

gtccgtgact tgcaagaggc agatctggac cttttgagag tcactttatc ctccaagcca 240

caagcactgg ccacaccaaa caaggaggag cacgggaaaa gaaagaagaa aggcaagggg 300

ctagggaaga agagggaccc atgtcttcgg aaatacaagg acttctgcat ccatggagaa 360

tgcaaatatg tgaaggagct ccgggctccc tcctgcatct gccacccggg ttaccatgga 420

gagaggtgtc atgggctgag cctcaaggtt ctgcccacat ggtccacccc ggtgcagcca 480

accatcctgg ccgtggtggc tgtggtgctg tcatctgtct gtctgctggt catcgtgggg 540

cttctcatgt ttaggtacca taggagagga ggttatgatg tggaaaatga agagaaagtg 600

aagttgggca tgactaattc ccactga 627

Claims

1. A plasmid system Epcam-cre-DTR for tracing liver precursor cells is characterized in that the base sequence of the plasmid system is shown as SEQ ID NO. 1.

2. The method for preparing the liver precursor cell tracing plasmid system Epcam-cre-DTR according to claim 1, comprising the steps of:

A. construction of plasmid Epcam-cre-DTR by adopting seamless cloning method

Performing double enzyme digestion on an Epcam promoter, cre recombinase, a diphtheria toxin receptor PCR product and a carrier by using Clal and Pmll, wherein a high-salt buffer system is adopted for reaction, and the reaction is placed in a 37 ℃ water bath for 3 hours, so that the enzyme digestion is performed fully; then separating by 0.8% agarose electrophoresis, and recovering gel; mixing the enzyme fragments and the carrier according to a molar ratio of 2:1, and carrying out recombination reaction;

B. preparation of engineering bacteria

selecting clone colony, adding LB culture medium containing ampicillin, culturing on a shaking table at 37 ℃ and 180-200 rpm for 12 hours, extracting plasmid of host bacteria, and cutting a 2950bp strip and a 3900bp strip by using Clal and Pmll double enzyme, wherein the host bacteria is positive recombinant;

C. extraction and purification of plasmid Epcam-cre-DTR

3. Use of the plasmid system of claim 1 for the preparation of a liver precursor cell tracer.

4. Use of the plasmid system of claim 1 for the preparation of a medicament for the treatment of liver injury comprising a liver precursor cell tracer as set forth in claim 3.

5. Use according to claim 3, characterized in that:

the active components of the liver precursor cell tracer comprise the plasmid system and a sleep Beauy transposon system which drives the plasmid system to transpose.

6. A pharmaceutical composition for tracing liver precursor cells is characterized by comprising an active component and pharmaceutically available auxiliary materials, wherein the active component comprises a plasmid system and a transposon system for driving the plasmid system to generate transposition,

the plasmid system is the plasmid system of claim 1, and the transposon system is a Sleeping

Beaury transposon subsystem.

7. A pharmaceutical combination for treating liver injury comprising the liver precursor cell tracing pharmaceutical composition of claim 6, and diphtheria toxin in combination with the pharmaceutical composition.